Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

חיסונים של האלפקות (לאמה pacos) עם חלבונים אנטיגניים וייצור נוגדנים תחום יחיד אנטיגן ספציפי

doi: 10.3791/58471 Published: January 26, 2019

Summary

שיטה לייצור מחשבים בודדת בנוגדנים אלפקות, כולל חיסון, איסוף דם, בידוד תאי B והבחירה מתואר.

Abstract

כתב יד זה, שיטה של חיסון של אלפקה, השימוש בשיטות ביולוגיה מולקולרית כדי לייצר נוגדנים מחשבים בודדת אנטיגן ספציפי תיאר, הפגינו. גמליים, כגון אלפקות, לאמות, הפכו משאב יקר-ערך למחקר ביורפואי מאז שהם מייצרים סוג הרומן של נוגדן שרשרת בלבד כבד אשר יכול לשמש כדי לייצר נוגדנים מחשבים בודדת. בגלל המערכת החיסונית הוא גמיש במיוחד, מחשבים בודדת נוגדנים יכולים להתבצע הרבה חלבונים שונים אנטיגנים, וכל הייצורים החיים אפילו שונים של אנטיגן, עם מידה גבוהה מאוד של ירידה לפרטים. תכונות אלה, בין היתר, להפוך מחשבים בודדת נוגדנים כלי יקר ערך למחקר ביורפואי. שיטה לייצור מחשבים בודדת בנוגדנים אלפקות הוא דיווח. פרוטוקול חיסונים, איסוף דם של בידוד תאי B מתואר. B-התאים משמשים להקמת ספריה immunized, אשר משמש בבחירה של נוגדנים ספציפיים מחשבים בודדת באמצעות גלילה רציפה. נוגדנים בשם תחום אחד ספציפי שהושג באמצעות גלילה רציפה מאושרות על-ידי נפתחים, אליסה, או מבחני ג'ל-shift. הנוגדנים מחשבים בודדת וכתוצאה מכך יכול לשמש לאחר מכן ישירות או כחלק ריאגנט מהונדסים. השימושים של מחשבים בודדת נוגדן ואת חברי ההנהלה של נוגדן מבוססי מחשבים בודדת לשימושים מבניים הביוכימי, הסלולר, ויוו, טיפולית. מחשבים בודדת נוגדנים יכול להיות מיוצר בכמויות גדולות כמו חומרים במערכות ביטוי prokaryotic, מטוהרים, ולא להשתמש ישירות או ניתן לתכנן להכיל סמני ספציפי או תגיות זה יכול לשמש עיתונאים מחקרים סלולר או בכל אבחון.

Introduction

אלפקות, ועם שאר בני משפחת גמליים, הפכו מקור פופולרי עבור יצירת נוגדנים עבור מחקר ביו1,2,3. גמליים יש מערכת חיסונית ייחודית שהם מייצרים גם נוגדנים נורמליים, כמו גם נוגדנים רק שרשרת כבדה אשר מאפשרים הייצור של נוגדנים מחשבים בודדת קטן הרבה יותר, תוך שמירה על ירידה לפרטים גבוה ואהדה גבוהה. לפיכך, גמליים נוגדנים לספק ריאגנט רב-תכליתי שימושי למגוון רחב של מטרות. שיטה כדי לחסן את האלפקה לייצר נוגדנים מחשבים בודדת למגוון של חלבונים אנטיגניים מתואר כאן. נוגדנים אלה יכול להיות מיוצר גמליים באמצעות תהליך פשוט למדי כי רק מחייב את חיסון באמצעות זריקות קטנות של החלבון היעד (אנטיגן) ו צייר דם4. לאחר מכן, בניית ספרייה, M13 phage התצוגה5 ו panning נגד אנטיגן רקומביננטי6 משמש כדי לבודד לייצר נוגדנים מחשבים בודדת עם התכונות הרצויות. כי התהליך מנצל הכוח של טכנולוגיית התצוגה phage, אנטיגנים חמישה או יותר יכול להיות מנוצל בו זמנית לכל בעל חיים, ובכך להפחית את מספר בעלי החיים בשימוש ומקושרת עלויות.

נוגדנים בתרבית של טיפוסי או immunoglobulins הם מולקולות גדולות בהיקף של שני סוגים של שרשראות (2 שרשראות כבדות ו 2 שרשראות אור), אשר מקושרים זה לזה באמצעות אגרות חוב דיסולפידי. נוגדנים אלה הם גדולים יחסית, מפגין מולקולרית משקל ~ 140-190 kDa עבור המין IgG שופע יותר בני אדם, עכברים, עזים, ארנבות. בשל מבנה יחידת משנה מרובה שלהם, משקל מולקולרי גבוה, ואגרות דיסולפידי immunoglobulins יכול להיות מאתגר למדי לייצר בכמויות גדולות, שהופך את עלות גבוהה. בשנות התשעים, התגלה כי גמליים, הכוללת גמלים, לאמות, אלפקות לבצע, בנוסף בנוגדנים מסוג בתרבית של טיפוסי, צורה הרומן של אימונוגלובולינים פשוטה במבנה, אחזקת שרשראות כבדות רק7. נוגדנים אלה גמליים ייחודי בעל היכולת באותו לאגד חומרים זרים עם זיקה גבוהה במיוחד אבל רק מורכב של שרשרת חלבון אחד8. יתר על כן, גמליים נוגדנים יכולים השפעול ייחתכו למקטע אפילו קטנה יותר יחידה HHV, הנקרא גם נוגדן מחשבים בודדת9. עקב גודלם הקטן, מחשבים בודדת נוגדנים שימושיים עבור מגוון רחב של יישומי המחקר הביו-רפואי, הינם זמינים ממגוון רחב של מקורות אקדמיים ומסחריים1,10. חריג נראה סופג המערבי מאז נוגדנים מחשבים בודדת לעיתים קרובות יותר מכוונות כלפי קונפורמציה תלויים epitopes, אשר בדרך כלל אבודים בתנאים denaturing בשימוש שהכלים המערבי.

מאז הם מורכבים משרשרת מפוליפפטיד יחיד, נוגדנים ספציפיים מחשבים בודדת יכול להיות שנבחרו, בקלות מיוצר בכמויות גדולות כמו חומרים של חיידקים. מחשבים בודדת נוגדנים יכולים גם להיות מהונדסים גנטית להכיל סמני ספציפי או תגיות יכול לשמש בתור "כתב קבוצות" לאבחון מחלות11. קלות זו של מניפולציה בשילוב עם גמישותם של שימוש הופך מחשבים בודדת נוגדנים משאב חשוב עבור חוקרים באוניברסיטאות ובמקומות אחרים.

כמו חלק מכוני הבריאות הלאומיים נתמך הליבה, שיטות קיימות הותאמו לייצר נוגדנים מחשבים בודדת אלפקות3,4. אלפקות יש יתרונות משמעותיים הן מבחינת קלות הטיפול ביחס גמליים בני משפחה גדולה יותר, כמו גם נגישות. אלפקות גדלים נרחב עבור סיבים ובשר, ובכך ניתן להשיג כתמורה החקלאים אלפקה מקומית, ניתן לזהות דרך אתרי האינטרנט שלהם או דרך המדינה מגדלת עמותות. שני גזעים של אלפקות זמינים, סורי, Huacaya. Huacaya נפוצים יותר, שימשו עבור פרוטוקול זה, אך הפרוטוקול היא חלים באופן כללי על גזעים או ישים גם באופן נרחב יותר גמליים אחרים.

Protocol

כל ההליכים עם האלפקות בוצעו על פי פרוטוקולים (2017-2627 ו- 2018-2925) אושרה על ידי של אוניברסיטת קנטאקי אכפת לי חיה מוסדיים שימוש הוועדה (IACUC).

1. דור של אנטיגן ספציפי אלפקה נוגדנים

  1. טיפול אלפקה ושיקולים כללי
    1. להשיג אישור מוסדיים ו/או הרגולציה המתאימה.
    2. להשיג אלפקות למבוגרים, פחות מ- 10 שנים של גיל עם גוף במצב ציון של 3.0 לפחות (סולם 1-5)12. . כי הם עדר חיות, בית מינימום של שני אבל רצוי שלושה בעלי חיים ביחד.
      הערה: זכרים מומלץ כי, ככלל, הם יש טמפרמנט אפילו יותר קל יותר לעבוד עם.
    3. לבדוק את מצב הבריאות של חיות דרך בדיקה וטרינרית כולל הסקירה של דיאטה, דיור, חיסון, טפיל בקרת תוכניות13. ודא החיות מעודכן עם חיסונים המתאימים לאזור הגיאוגרפי המקומי המבוסס על המלצות וטרינרי מקצועי. לפתח טפיל חוץ - endoparasite בקרת תוכנית בהתייעצות עם רופא וטרינר בהתבסס על סקירה של ההיסטוריה של העדר של המקור ושל תנאים מקומיים מסוימים13.
    4. ואקלום של שבוע אחד לפחות, כולל הכשרה הלטר וחשיפה איפוק.
    5. לאסוף דגימת דם 4 מ"ל לקבל סרום לשימוש כפקד חיסון קדם (ראה צעד 1.4). להקפיא את סרה ולאחסן ב-20 ° C ב- 0.5 מ ל aliquots.
      הערה: בשלב זה, ניתן לקחת דם נוסף עבור ניתוח מלא ספירת דם (CBC) לעקוב אחר מצב תקינות הראשונית החיה.
  2. הכנה אנטיגן
    1. להכין חלבונים מטוהרים אנטיגניים תמיסת מלח באגירה פוספט (PBS) או תמיסת מלח באגירה HEPES (HBS) ותתרכזי כדי ≥1 מ"ג/מ"ל כ 3 מ ג חלבון נחוץ עבור פרוטוקול מלא, לרבות חיסונים, גלילה לצדדים, אישור של שיבוטים.
      הערה: גמליים נוגדנים מציגים ירידה לפרטים גבוה, סלקטיביות נגד חלבונים אנטיגניים אך לא מתאימים בדרך כלל חלבונים לא מובנים או אנטיגנים פפטיד אשר הם בדרך כלל לא מובנים.
    2. להקים טוהר אנטיגן, עם טוהר > 90% הרצוי. לנצל שיטה אנליטית כגון עמודים מרחביות.
      התראה: זיהום משמעותי עם חלבונים אחרים יכול להוביל לבעיות במהלך הבחירה היכן נוגדנים מחשבים בודדת ניתן לבודד מזהמים מאשר את חלבון המטרה.
    3. להכין aliquots הקפוא של אנטיגן המכילה סכום כולל של 100 µg של אנטיגן. µL 50 של 2 מ"ג/מ"ל הכנה אידיאלית. µL 100 של 1 מ"ג/מ"ל הוא הפתרון חלבון שתדללו הכי מתאים חיסונים. לחלופין, אם לא ניתן לעבור ההקפאה/ההפשרה אנטיגן ידוע להיות יציב פתרון לטווח ארוך, ניתן לאחסן ב 4 º C.
      הערה: כדי להבטיח שאנטיגן יכולות לעבור מחזור ההקפאה/ההפשרה, בדיקה ש-aliquot 20 µL של אנטיגן צריך ובשמפו לתוך דקה עם קירות PCR צינור והצמדה קפוא חנקן נוזלי. להפשיר את הצינור, לבצע במהירות גבוהה צנטריפוגה ולוודא את ההתאוששות כמותיים על-ידי השוואת UV/VIS הקליטה לפני ואחרי הקפאה או על-ידי הפעלת של ג'ל מרחביות-דף. אם אפשרי, צריך אנטיגן גם להיבדק על השמירה של פעילות ביולוגית. אם מחזור הפשרת ההקפאה הוא מוצלח, אנטיגן הנותרים הוא הצמד קפוא 100 µL aliquots ומאוחסנים ב-80 מעלות צלזיוס. אם יש בעיות עם מחזור ההקפאה/ההפשרה, הפרוטוקול יכול לחזור עם התוספת של עד 20% גליצרול.
  3. התחסנות
    1. לערבב עד חמישה אנטיגנים, 200 µg כל אחד, עם אדג'וונט באמצעי אחסון הסופי של בין 300 עד 1,000 µL. אדג'וונט יהוו ≥50% נפח סופי השימוש במים diluent.
      הערה: אם המאגר אינו הכרחי, להשתמש HEPES, מגבים או גליצין. PH בין 5 ו- 6 הוכיח לעיתים קרובות להיות יותר נוח מאשר נייטרלית לחלוטין. הימנע יונים ערכיות כגון פוספט או ציטראט, מאחר שהם יכולים לעורר קרישת הדם.
    2. קיצוץ השיער של האלפקה. עם מספריים חשמליות, בדפוס חרמש הירח לאורך הבסיס של הצוואר של כתף לכתף כדי לחשוף את האזורים הסמוכים אל בלוטות הלימפה קשת.
    3. מחזיק האלפקה בצוואר, לאט מזריקים אנטיגן subcutaneously לאורך הבסיס של הצוואר ליד בלוטות הלימפה קשת באמצעות מחט 22 גרם. לבצע חמש זריקות של µL ~ 200 (או פחות) ~ 5 ס מ אחד מהשני.
      הערה: החיות צריך ריסון על ידי חבר סגל השנייה במהלך הזריקות. הזרקת ודימום אלפקות דורש זהירות מכיוון שהן נוטה בועט, לא רק מאחור אבל לצדדים. שיש חיות זה לזה, קבוצה, במהלך ההליכים הוא אופטימלי. בהתחשב בכך, הם חיות עדר הם רגועים יותר בקבוצה, איפוק המשוייכת נדרש במהלך ההליכים.
    4. לפקח על החיות להזרקה ~ 20 דקות פוסט סימנים של אנפילקסיס (ראה צעד 1.6). צג עבור דלקת מקומית באתרי הזרקה שבועי, אשר לא צפוי בעת שימוש את אדג'וונט המומלצת. ודא כי דליפת דם מהאתר של הזרקת אינה מוגזמת.
    5. לבצע חמש זריקות עוקבות boosting שבועי באמצעות 100 µg של כל אנטיגן ומערבבים. מסיכה לשיער באתרי הזרקה עשוי להידרש אחת לשבוע בהתאם לעונה. בסתיו ובחורף, השיער החיות יכול לצמוח במהירות.
  4. עד זוב דם
    1. קליפ ולחטא אתר אוסף עם מטליות אלכוהול.
    2. לרסן את החיה בעדינות עם הצוואר מוחזק זקוף, ישר.
      הערה: בעלי חיים יכול לרסנם באופן ידני כפי שמתואר בסרטון. אם הוא זמין, שימוש המצנח אלפקה לרסן את האלפקות במהלך הדימום, זריקות יכולה להקל על הטיפול. לשימוש של המצנח אלפקה, אלפקות haltered הוביל לתוך תעלת, משחרר את רצועות עם מהדורות מהיר וברים של הצוואר. גירסאות של המגלש אלפקה זמינות של ספקים מסחריים.
    3. באמצעות ההקרנה הגחון של התהליך רוחבי של החוליות כנקודת ציון, occlude את הווריד על ידי הפעלת לחץ פשוט המדיאלי לתהליך הגחון.
      הערה: יש פארו צוואר ברורים אין אלפקה למבוגרים. העורקים העורק מוגנים על-ידי הקרנות הגחון של התהליכים בחוליות רוחבי. זה עור עבה (למשל, 1 ס מ עבה "נלחמים צלחת" 1/3 האמצעי של צוואר אצל זכרים) מערכת השרירים בצוואר ומקשה באופן חזותי או ימשש ומוחלף על עצמו. כתוצאה מכך, השימוש ציוני בחוליות הוא האינדיקטורים מועיל ביותר עבור מיקום צוואר.
    4. הכנס את המחט בזווית של 45° מעט המדיאלי (~ אצבע רוחב) כדי ההקרנה לעבר המרכז של הצוואר. לתפעל את המחט עד זרימת הדם.
      הערה: עורק הצוואר ואת העורק קרובים אחד לשני. דם ורידי יכול להיות די בצבע אדום אבל עדיין כהה יותר מדם עורקי. מסע בעקבות, הלחץ צריך להיות מוחל על האתר של 0.5-1 דקות (או יותר אם בעורק מתבצעת) עד hemostasis מובטחת.
    5. לצייר 4-10 מ"ל של דם למטרות אנליטית. לנצל את a 1.5 inch, המחט 20 גרם בדרך כלל בשילוב עם מזרק בגודל המתאים או דם אוסף שפופרת. לנצל לבנדר העליון K2צינורות EDTA לאיסוף הדם כולו כאשר לטיהור לימפוציטים. לנצל זהב סרום העליון ההפרדה צינורות (BD) בעת איסוף הדם לייצור סרום.
    6. צייר 50-100 מ של דם למטרות ייצור. השתמש הרחבה נוספים 12 אינץ אינפוזיה סט עם ערכת אינפוזיה 19-20 G המכונף "פרפר".
      הערה: סיומת להגדיר תצורה מאפשרת עוזר למלא מספר צינורות איסוף דם, ומאפשר את venipuncturist להתמקד ייצוב המחט אוסף. התוספת של ערכת אינפוזיה להכיל פוטנציאל התנועה של החיה (3-5 דקות הליך) ונותן במרחק נוח לעבוד עבור המפעילים.
  5. החיסון ניטור
    1. שלושה-ארבעה ימים לאחר את 3rd ו-th 5 זריקות, לבצע בליד מבחן קטן מתוך כל בעל חיים כדי להשיג סרה לבדיקה. הקפאת ולאחסן את sera ב- 0.5 מ ל aliquots. להשיג דגימות דם נוספות באותו זמן מעקב של החיה, כפי שפורט לעיל.
    2. לאשר הנוכחות של נוגדנים אנטיגן ספציפי על-ידי אליסה באמצעות של sera המתקבל במבחן דימומים בנקודות זמן מראש מערכת החיסון שלושה שבועות, חמישה שבועות. עדיף לקחת דימום הסופי ואילו כייל נוגדנים עדיין עולה.
    3. לייצר אנטיגן זיקה צלחות באמצעות משטח הלוחיות 96-ובכן שטופלו. לדלל 0.1 µg של אנטיגן במאגר סודיום קרבונט 100 מ מ, pH 9.0. להוסיף 100 µL של הפתרון מכל קידוח, דגירה בין לילה ב 4 º C. דילולים עשר של כל אנטיגן נבדקים כפילויות. פקד ריק טוב מוכן זה מצופה קרבונט מאגר בלבד.
    4. לאחר לילה הדגירה, להפוך את הצלחת להסיר את התוכן של הבארות. ולשטוף שלוש פעמים עם 0.1 מ"ל ל- PBS, 0.1% Tween 20 (PBS-T).
    5. לחסום את הבארות על-ידי הוספת מ 0.1 ל BSA (5 מ"ג/מ"ל) ב- PBS-T המקננת את הצלחת לשעה בטמפרטורת החדר.
    6. לשטוף את הצלחת שלוש פעמים עם PBS-T מאת pipetting הפתרון שטיפת לתוך הבאר ולאחר מכן להסיר את הפתרון שטיפת מאת ההיפוך של הצלחת.
    7. להכין דילולים טורי כפולה של 0.3 מ ל כל אחד סרה מראש המערכת החיסונית ואת המערכת החיסונית במאגר PBS-T באמצעות לדילול ההתחלתי של 1/100, עד 1/102, 400.
    8. להוסיף 100 µL של דילול כל הבארות, מאפשרים תקופת דגירה של 2 h בטמפרטורת החדר.
    9. הסר את הנסיוב מכל קידוח, לשטוף עם 0.2 מ של PBS-T שלוש פעמים.
    10. דגירה אחד טוב עם 0.1 מ"ל של עז מצומדת HRP לאמה אנטי איג נוגדנים לדילול 1:20,000 לשעה.
      הערה: התגובה החיסונית נמדד כולל שניהם קונבנציונליות כמו גם נוגדנים רק שרשרת כבדה, אשר נמצאים ביחס שווה כ מחזור3,14.
    11. להסיר את הפתרון נוגדן. ולשטוף את כל טוב עם 0.2 מ של PBS-T שלוש פעמים.
    12. להוסיף 100 µL של מצע peroxidase הדפסות כסף אל הבאר, דגירה בטמפרטורת החדר עד האינטנסיביות של שתי הנקודות הריכוז הגבוה ביותר חייב להיות רווי, אשר בדרך כלל לוקח 5-10 דקות.
    13. להוסיף 100 µL של חומצה גופרתית 0.1 M בכל טוב כדי לעצור את התגובה.
    14. למדוד את ספיגת כל הבאר-450 nm שימוש בקורא צלחת.
    15. להתוות את ספיגת כמו ריכוז פונקציה.
  6. סיבוכים ניטור ופוטנציאליים אלפקה
    1. ודא אלפקה המתאים ניטור לאורך כל ההליך.
      הערה: ההליכים אינן צפויות לגרום תופעות לוואי משמעותיות. בעלי חיים רווחה ובריאות צריך לפקח מדי יום על ידי אנשי האחזקה ו/או מחקר במהלך האכלת והשקיית. כל חיה עם תחלואה טבעית unalleviated המושרה בניסוי, או ספונטנית חייב להתייחס על ההערכה על-ידי השירותים הוטרינריים עם treatment(s) מסופקים לפי הצורך, עד ההומני, במידת הצורך.
      השלכות אפשריות המשויך דם ורידי הם דימום, נקיפה, שטף דם. בעלי החיים צריך לפקח על לקיחת הדם פוסט 20 דקות לחפש הסימנים של דימום. הלחץ הנוסף באתרים אמור לשמש. אם הדימום לא מפסיק, וטרינר צריך ליצור קשר.
      ההשלכות שלילית פוטנציאליים אחרים הקשורים זריקות ודימום כוללים גרנולומה היווצרות דלקת. היווצרות גרנולומה לא צפויה, לא נצפתה ב אוניברסיטת קנטאקי. דלקת באתר ההזרקה (אדמומיות או נפיחות) יכול להתרחש, צריך להביא את תשומת הלב של וטרינר. הגלישה הייצור מייצג נפח משמעותי פוטנציאלי של הדם, בעלי החיים צריך לפקח על מנת להבטיח כי הם יציבים ופעיל לאחר איסוף דם.
      אנפילקסיס ותגובות פירוגני הם שני ככל הנראה שלילית התוצאות החמורות, אך הם נצפו לעתים רחוקות מאוד. אם זה היה להתרחש, אנפילקסיס להתרחש זמן קצר לאחר זריקות אנטיגן, לידי עלייה טמפרטורה רקטלית, חולשה, הקאות, בעיות נשימה, ו/או שלשולים. טמפרטורה רקטלית יכולה להיות במעקב אחרי כל זריקה כדי לזהות כל עלייה בטמפרטורת הגוף. אם אלו מזוהים להודיע וטרינר מיד ליעוץ. בנוסף, "קראש ערכת חירום" (למשל, אפינפרין, סטרואידים ותרופות אנטי היסטמין) מוכן תוך התייעצות עם רופא וטרינר צריך להיות זמין לטיפול החשודים יש תגובה נגדית.

2. מטהר את לימפוציטים לבנייה ספריית נוגדן מחשבים בודדת

  1. לאסוף 50 מ של דם שלושה עד חמישה ימים לאחר הזריקה האחרונה (ראה צעד 1.4).
    הערה: עיבוד מהיר של דם ובידוד של RNA חשוב להשיג ספרייה מתאים בגודל15,3, אשר חשוב מאוד להצלחת panning.
  2. לדלל 15 מ"ל של הדם שנאספו עם 5 מ של PBS.
  3. לנצל את צינור ההפרדה לימפוציט לבודד דם היקפיים לימפוציטים (PBLs) על ידי צפיפות צנטריפוגה מעבר צבע על פי הצעות נוספות ואיכותיות.
    התראה: הוראות היצרן מציינים כי ניתן להשתמש עד 25 מ של דם, אבל זה ייתכן להרוות את המערכת ולמנוע בקבלת תכשיר לימפוציט נקי.
  4. הוסף 5 מ של PBS prechilled עד 4 ° C כדי למידה.
  5. ספין כעשרים דקות ב x 800 גרם ב 4 º C.
  6. לשטוף פעמיים על-ידי הוספת 5 מ של PBS prechilled עד 4 ° C כדי למידה ואחריו את צנטריפוגה כעשרים דקות ב x 800 גרם ב 4 º C.
  7. בודד הכולל RNA באמצעות מערכת ספין עמודות בהתבסס, על פי הוראות היצרן. Homogenize התאים מאת vertexing מאגר המתאים, החלה על מערכת ביופולימרים-גיזום. השתמש מספר מתאים של מיני או מקסי-עמודות בהתאם לתא קלט.
  8. לסנתז cDNA באמצעות רוורס טרנסקריפטאז על ידי שילוב של µg 10 של RNA עם שילוב של 0.1 µg של Oligo (dT) תחל 12-18.
  9. צור ספריה bacteriophage באמצעות שיטות הוקמה4. פעולה זו כרוכה שיבוט עם אנזימי הגבלה לתוך pMES4 וקטור התצוגה phage ולאחריו הביטוי של הקדמי התמזגו עם ג ' ין השלישי phage filamentous לייצור של הפתרון phage.

3. תחום יחיד נוגדן פאנינג

  1. לייצר אנטיגן זיקה צלחות באמצעות משטח הלוחיות 96-ובכן שטופלו. לדלל µg 0.25 של אנטיגן במאגר סודיום קרבונט 100 מ מ, pH 9.0. להוסיף 100 µL של פתרון זה מכל קידוח, דגירה בין לילה ב 4 º C. מעיל שתי בארות לכל אנטיגן. להכין ריק פקד טוב מצופה קרבונט מאגר בלבד.
    הערה: צלחות יכול להיות מיוצר ומאוחסן לשבוע עד אחד ב 4 ° C אם יבוצעו מספר סיבובים של בחירה. בנוסף, שיטה זו משתמשת במסלול הקליטה הישירה, אשר אינה דורשת תיוג בעוד שיטות אחרות להשתמש biotinylation או סוגים אחרים של תיוג אסטרטגיות.
  2. דגירה בן לילה את הצלחת. היפוך להסיר את התוכן של הבארות. ולשטוף שלוש פעמים עם 0.1 מ"ל של PBS-טי
  3. לחסום את הבארות על-ידי הוספת מ 0.1 ל BSA (20 מ"ג/מ"ל) ב- PBS המקננת את הצלחת. בשביל 2 h בטמפרטורת החדר.
  4. לשטוף את הצלחת שלוש פעמים עם PBS-T ולאחריו שלוש פעמים עם PBS. אנטיגנים יכולים גם להיות covalently מתויג, שבשימוש במערכות לכידת כמו, לדוגמה, streptavidin/ביוטין מערכות.
  5. מראש פנקו הפתרון phage (100 µL) עם 100 µL של 40 מ"ג/מ"ל BSA ב- PBS על פלטפורמה רוטטת בטמפרטורת החדר למשך 30 דקות.
  6. הוסף הפתרון phage אנטיגן מצופה בארות דגירה עם עצבנות עדין עבור 2 h בטמפרטורת החדר. השתמש בארות מרובים על מנת להבטיח סך של 1011 phage עבור כל אנטיגן.
  7. למחוק את phage לא מאוגד על-ידי היפוך ולאחר מכן לשטוף הבארות חמש פעמים עם 200 µL של PBS-T ולאחריו חמש פעמים עם PBS.
  8. Elute את phage המאוגד על-ידי הוספת 0.1 מ"ל של 0.25 מ"ג/מ"ל טריפסין PBS ו המקננת למשך 30 דקות בטמפרטורת החדר על פלטפורמת רוטטת-700 סל ד.
  9. להעביר את הפתרון בקבוקון המכיל 5 µL של 4 מ"ג/מ"ל 4-benzenesulfonyl פלואוריד hydrochloride(AEBSF) פתרון כדי להרוות טריפסין פעילות.
  10. לגדול TG1 phage התצוגה תאים המוסמכת ב 37 ° C עם לרעוד עד OD600 = 0.5.
  11. להוסיף 50 µL של eluted phage 3 מ"ל של תאי TG1.
  12. דגירה ב 37 ° C ללא רועד למשך 30 דקות.
  13. להוסיף 7 מ ל LB מדיה בתוספת 100 µg/mL אמפיצילין, 2% גלוקוז.
  14. לנער בן לילה ב 37 º C.
    הערה: כדי להשיג את הנוגדנים מחשבים בודדת מגוונת ביותר, שיבוטים יכול להיות וסודרו, נבדק עבור המאפיינים הרצויים, מנוצל אחרי סיבוב אחד של גלילה רציפה. כדי להשיג הזיקה הגבוהה נוגדנים מחשבים בודדת, שני סיבובים של גלילה רציפה צריך להיות מנוצל.
  15. צלחת החיידקים לאחר גידול לילה על פלטות אגר LB בתוספת 100 µg/mL אמפיצילין, 2% גלוקוז. מספר סידורי דילולים תצטרך להיבדק, מתחיל עם שני דילולים, ציפוי µL 100 של 1/10,000 ו- 1/100,000 דילולים.
  16. דגירה את הצלחת בן לילה ב 37 º C.
  17. לבחור את המושבות, לחסן הבארות של צלחת 96-ובכן סטרילי המכיל 100 µL של 2XYT עם 100 אמפיצילין µg/mL, 2% גלוקוז 10% v/v גליצרול לכל טוב.
  18. דגירה בין לילה ב 37 ° C ללא רועד.
  19. למחרת, לנער-170 סל ד ב 37 מעלות צלזיוס למשך 60 דקות.
  20. הסר את 2 µL של המדיה לתוך המבחנות. הפתרון הנותרים יכולים להיות השאירה בצלחת המאוחסנים ב 4 מעלות צלזיוס למשך 1-2 ימים או קפוא ו המאוחסן ב- 80 ° C לשימוש מאוחר יותר.
  21. לבצע PCR תגובה באמצעות תחל מתאים וקטור מנוצל. עבור pMES4, PCR הקרנת הסרט תחל שימושים חיוביים שיבוטים מחזיתות האתר שיבוט מרובים הם CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC ו GGTGGTGTGAGGAGACGGTGACCTG. לנצל את תנאי הרכיבה המתאים עבור פולימראז בשימוש, של הטמפרטורה מחזק של 57 ° C, ו 30 מחזורים.
  22. לנתח את תגובת ה-PCR על-ידי הפעלת ג'ל agarose 1% (w/v). מושבות הם חיוביים יש מחשבים בודדת נוגדן ג'ין מוסיף ~ 500 bp. ודא כי חיובי שיבוטים הם 20-50% מכלל המדגם.
    הערה: שיטה זו מספקת אמצעי שיבוט בחירה וניתוח שניתן לבצע במעבדות מחקר רוב. לחלופין, הדור הבא רצפי יכול להיות מיושם ומספק אלגוריתמית המאפשרים סטטיסטי וניתוח השוואתי16.
  23. לחסן את השיכפולים חיובי מהצלחת לתוך צינורות טריים המכיל 7 מ ל LB עם 100 אמפיצילין µg/mL.
  24. לגדול עם טלטול נלון ב 37 º C.
  25. לבצע miniprep של התרבות להשיג DNA פלסמיד.
  26. רצף חיובי שיבוטים שימוש בתקן רצף פריימר pEX-Rev (CAGGCTTTACACTTTATGCTTCCGGC).
  27. לבצע ניתוח חישובית ברצפי נוגדן מחשבים בודדת המתקבלת. ודא כי יש codons אין עצירה או מסגרת משמרות.
  28. לסווג את רצפי וכתוצאה מכך דמיון והמגוון. הרצפים המזוהים שוב ושוב סביר להיות זיקה גבוהה מחייב רצפים, במיוחד לאחר שני סיבובים של בחירה.
  29. אקספרס הנוגדן מחשבים בודדת באמצעות זן הביטוי נגזר BL21 של הגליל א. זירוז הביטוי באמצעות התוספת של IPTG, גדל בן לילה-22 מעלות צלזיוס.
  30. לטהר הנוגדן מחשבים בודדת באמצעות קיבוע המתכת כרומטוגרפיית זיקה (IMAC).
  31. אמת כריכת אנטיגן נוגדן/מחשבים בודדת וזמינותו האינטראקציה הישירה כגון נפתחים, יליד בג'ל או אליסה.
  32. ודא ביצועים נוגדן ספציפי ליישום מחשבים בודדת, כרצונכם לניסוי מסוים.

Representative Results

פרוטוקול המובאת כאן היה מנוצל ליצירת מחשבים בודדת נוגדנים נגד מגוון רחב של חלבונים אנטיגניים. אנטיגנים חמש נוצלו לכל אלפקה. ניטור מערכת החיסון עולה כי הרוב המכריע של אנטיגנים הראו תגובה חזקה בהתחלה שלושה שבועות (איור 1). גלישות ייצור ובנייה ספריה לאחר כ- 6 שבועות נותן האיזון הטוב ביותר עבור בעלי החיים זה יש מספר אנטיגנים מוזרק. שני סיבובים של גלילה רציפה היו לבצע עבור כל אנטיגן, מבודד מושבות מוקרן (איור 2). רצף של מושבות חיובי לזהות מחשבים בודדת מגוונות רצפי נוגדנים אנטיגנים שונים. לקבלת דוגמאות, שלושה ייחודי שיבוטים היו מבודד אנטיגן הפניה מלטוז מחייב חלבון (MBP) (איור 3 א). כפי לעתים קרובות נצפית, הנוגדנים מחשבים בודדת להכיל רצף משמעותי גיוון CDR3 משתנה מאוד אורך (איור 3). תכונות אלה חשובים במיוחד אינטראקציות אנטיגן נוגדן/מחשבים בודדת כפי שניתן לראות את התייחסות מחשבים בודדת נוגדן/CX3CL1 מורכבים17 (איור 3B).

הרוב המכריע של רצפי נוגדן באורך מלא מחשבים בודדת יכולה להיות הביע וטיהרו -1-10 mg/L של תרבות (איור 4A). בגלל המגוון CDR3 באורך, נוגדנים שונים מחשבים בודדת הצג קל משקל מולקולרי. אישור של איגוד ישירה וביצועים ספציפיות היישום היא קריטית. לדוגמה, לאחר שני סיבובים של הבחירה נגד אנטיגן B, פאנל של מחשבים בודדת היו נוגדנים מזוהה (איור 2). מספר רצפים זהים אותרו, הנוגדן מחשבים בודדת והופק מטוהרים. זה היה לאחר מכן נבדק באמצעות משיכה ישירה למטה עם אנטיגן זיקה שרף, הראה למינון חזקים מחייב (איור 4B). חשוב לציין, הנוגדן מחשבים בודדת הראה לא מחייב לשלוט שרף. נתונים אלה מדגימים של אינטראקציה ישירה מחייב, ואחד זה גם מתאים זיקה לכידת בתבניות נפתחים והן מבוססות על אליסה.

Figure 1
איור 1 : ניטור המערכת החיסונית נציג של שני אנטיגנים שונים מציג משמעותי ספציפי התגובה החיסונית אנטיגנים שונים של אותה חיה. אנטיגנים רבים מראים תגובה חזקה מוקדם ככל כשלושה שבועות לאחר חיסון, החל הרוב מראה תגובה מקסימלי לאחר שישה שבועות. שישה שבועות גם מאפשר זיקה ההבשלה, זה הזמן המומלץ עבור ייצור בליד ובידוד B-cell. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 : אישור מבוססי ה-PCR של שיבוטים חיובי. תחל span של MCS של וקטור pMES4, ומייצרת שיבוט nanobody חיובי של אמפליקון ~ 500 bp (המסומנים *). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3 : אנטיגן ספציפי רצפי האר אלפקה מחשבים בודדת נוגדן גיוון. יישור (A) של מחשבים בודדת בחר נוגדן רצפי מבודדת כדי MBP עם 4XT1 נוגדנים מחשבים בודדת של הפניה, עם מסגרת ואזורים שקובעים משלימים את החסר (Kabat) מסומן להלן. (B) המבנה של אלפקה מחשבים בודדת נוגדן 4XT1 קשור CX3CL1 (PDB 4XT1), הדגשת תפקיד קריטי CDR משתנה לולאות באיגוד אנטיגן ספציפי. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4 : טיהור ובדיקת נוגדנים מחשבים בודדת. (א) מרחביות עמודים של נוגדנים מחשבים בודדת IMAC מטוהרים, השוואה בין מחשבים בודדת מגוונות נוגדנים. משקל מולקולרי שונה הם בעיקר בשל אורך בדרגות שונות של הלולאה CDR3. רמות שונות של ביטוי גם הן נצפו, עם מיעוט של נוגדנים מחשבים בודדת מראה עניים התשואות של חלבון מטוהרים. (B) אימות של כריכת ישירה זיקה אנטיגן נפתחים. איגוד נוגדנים חזקים למינון מחשבים בודדת הוא ציין שרף מצמידים אנטיגן אבל לא עם שליטה שרף. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Discussion

כאמור, זיקה גבוהה וספציפיות של נוגדנים מחשבים בודדת, בשילוב עם שלהם ביטוי נתיישב ויציבות, להפוך אותם ריאגנטים אידיאלי עבור היישומים במחקר ביו-רפואי, כמו ריאגנטים ביוכימיים קריטיים, כלי אבחון, או סוכני18. עבור יישומים מסחריים, ישנם רכוש הקשור רוחני בעיות כי יש לקחת בחשבון. בנוסף, ניתן לתכנן מחשבים בודדת נוגדנים להכיל סמני ספציפי או תגיות זה יכול לשמש עיתונאים מבחני הסלולר או בכל אבחון. המפתח שימושים אלה הוא היכולת לייצר מחשבים בודדת ספציפי נוגדנים כנגד האנטיגנים של עניין. שיטה מתואר כאן כדי לייצר נוגדנים מחשבים בודדת באמצעות אלפקות, אשר מייצר תגובה חיסונית חזקה נגד מגוון רחב של חלבונים אנטיגניים. לשיקולים הקשורים לטיפול בבעלי חיים ותאימות לתקנות מתוארים. אלה הם המפתח להצלחה בחלק זה של התהליך.

ישנן אסטרטגיות אחרות לייצור נוגדנים מחשבים בודדת אינם מחייבים את החיסונים, אך במקום זאת להשתמש בספריות semisynthetic עם מערכות שונות עבור בחירה ואופטימיזציה איטרטיביים של הזיקות19,20 . עם זאת, היתרון של שימוש בספריות שמקורם מן החי לחסן היא היכולת לבודד אמינה מאוד מועשר, מגוונת, ואהדה גבוהה מחשבים בודדת נוגדנים. בנוסף, לא רק רצף משמעותי וריאציות שנצפו, אבל רוב מוחלט של נוגדנים ספציפיים מחשבים בודדת מבודד היו ייחודיים הוספות ומחיקות, בפרט CDR3.

תחום נוסף, יחיד נוגדנים יכול להיות מיוצר באמצעות תהליך פשוטה הדורשת רק קטן זריקות אנטיגן, ואחרי תהליך זה, החיות שאפשר יהיה להחזיר את העדר. ראוי לציין, החיה ניתן להשתמש בחופשיות לייצור סיבים, אך לא ייכללו לשימוש כמו בשר (שרשרת המזון האנושית) עקב השימוש של בדיקת אנטיגנים, אדג'וונט שאושרו-ה-FDA לייצור נוגדנים מחשבים בודדת. כאשר ההליך הושלם, בעלי החיים צריך להיות במעקב במשך שבוע, בהתחשב וטרינרי בבחינת גמר, יכול להיות חזרה לחווה שלהם הביתה או נחה במשך שישה חודשים לפני סבב נוסף של ייצור נוגדנים מחשבים בודדת.

Disclosures

ד"ר Whiteheart, הרש ב אוניברסיטת קנטאקי, פועלים מגרעין המרכז לרפואה מולקולרית מייצרת נוגדנים מחשבים בודדת באלפקה כשירות בתשלום-על.

Acknowledgments

עבודה זו נתמכה על ידי מכוני הבריאות הלאומיים (P30GM103486).

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
חיסונים של האלפקות (<em>לאמה pacos</em>) עם חלבונים אנטיגניים וייצור נוגדנים תחום יחיד אנטיגן ספציפי
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter