Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Immunizzazione di Alpaca (Lama pacos) con gli antigeni della proteina e la produzione di anticorpi di dominio singolo antigene-specifiche

doi: 10.3791/58471 Published: January 26, 2019

Summary

Un metodo per la produzione di anticorpi di singolo dominio da alpaca, compreso immunizzazione, raccolta del sangue, delle cellule di B isolamento e selezione è descritto.

Abstract

In questo manoscritto, un metodo per l'immunizzazione di alpaca e l'uso di metodi di biologia molecolare per produrre gli anticorpi antigene-specifiche singolo dominio è descritto e dimostrato. Camelidi, quali alpaca e lama, sono diventate una risorsa preziosa per la ricerca biomedica poiché producono un nuovo tipo di anticorpo sola catena pesante, che può essere utilizzato per produrre anticorpi di singolo dominio. Perché il sistema immunitario è altamente flessibile, anticorpi di singolo dominio possono avvenire a molti antigeni differenti della proteina e anche diverse conformazioni dell'antigene, con un elevato grado di specificità. Queste caratteristiche, tra gli altri, fanno gli anticorpi singolo dominio uno strumento prezioso per la ricerca biomedica. Un metodo per la produzione di anticorpi di singolo dominio da alpaca è segnalato. Un protocollo di immunizzazione, raccolta del sangue e l'isolamento della B-cellula è descritto. Le B-cellule sono utilizzate per la costruzione di una libreria immunizzata, che viene utilizzata nella selezione di anticorpi specifici singolo dominio tramite panning. Anticorpi di dominio singolo specifico presunto ottenuti tramite panning sono confermati dal menu a tendina, ELISA, o analisi gel-spostamento. Gli anticorpi di singolo dominio risultante quindi possono essere utilizzati direttamente o come parte di un reagente ingegnerizzato. Gli usi di anticorpo di singolo dominio e dominio singolo anticorpo-basato regents includono applicazioni strutturali, biochimiche, cellulari, in vivo e terapeutiche. Anticorpi di singolo dominio possono essere prodotti in grandi quantità come proteine ricombinanti in sistemi di espressione procariotici, purificato e utilizzati direttamente oppure possono essere progettati per contenere specifici marcatori o tag che possono essere utilizzati come reporter in studi cellulari o in diagnostica.

Introduction

Alpaca e altri membri della famiglia camelide, sono diventati una fonte popolare per la generazione di anticorpi per la ricerca biomedica1,2,3. Camelidi hanno un sistema immunitario unico in quanto producono anticorpi normali così come catene pesanti soli anticorpi che permettono la produzione di anticorpi di singolo dominio molto più piccoli, pur mantenendo alta specificità e ad alta affinità. Così, camelide anticorpi forniscono un reagente versatile utile per una varietà di scopi. Qui è descritto un metodo per immunizzare alpaca e produrre anticorpi di singolo dominio ad una varietà di antigeni della proteina. Questi anticorpi possono essere prodotti in camelidi tramite un processo relativamente semplice che richiede solo l'immunizzazione tramite piccole iniezioni di proteina bersaglio (antigene) e un pareggio di sangue4. Successivamente, la costruzione della libreria, M13 phage display5 e panning contro l' antigene ricombinante6 viene utilizzato per isolare e produrre anticorpi di singolo dominio con le caratteristiche desiderate. Poiché il processo si avvale della potenza della tecnologia di visualizzazione dei fagi, cinque o più antigeni possono essere utilizzati contemporaneamente per animale, riducendo così il numero di animali utilizzati e le relative spese.

Tipica dei mammiferi anticorpi o immunoglobuline sono molecole di grandi dimensioni costituito da due tipi di catene (2 catene pesanti e 2 catene leggere), che sono collegati tra loro attraverso legami bisolfurico. Questi anticorpi sono relativamente grandi, che esibiscono i pesi molecolari di ~ 140-190 kDa per la specie più abbondante di IgG da esseri umani, topi, capre e conigli. A causa della loro struttura multi-unità secondaria, ad alto peso molecolare e legami bisolfurico, immunoglobuline possono essere piuttosto impegnative per produrre in grandi quantità, rendendo il loro costo elevato. Negli anni novanta, si è scoperto che rendono camelidi, che comprende cammelli, lama e alpaca, oltre l'immunoglobulina di tipo mammifero tipico, una forma novella dell'immunoglobulina che è più semplice nella struttura, che possiede solo pesanti catene7. Questi anticorpi unico camelide possiedono la stessa capacità di legare specificamente sostanze estranee con alta affinità ma sono solo costituiti da una proteina catena8. Inoltre, gli anticorpi camelide possono essere troncati sperimentalmente in un frammento di unità la VHH ancora più piccolo, chiamato anche un dominio singolo anticorpo9. A causa del loro di piccola dimensione, singolo dominio anticorpi sono utili per una vasta gamma di applicazioni di ricerca biomedica e sono disponibili da una varietà di fonti accademiche e commerciale1,10. Un'eccezione sembra essere macchiarsi occidentale poiché singolo dominio anticorpi più spesso sono diretti contro epitopi dipendente di conformazione, che solitamente si perdono in condizioni di denaturante utilizzato in Western blot.

Poiché essi sono costituiti da una catena polipeptidica singola, anticorpi specifici singolo dominio possono essere selezionati e facilmente prodotta in grandi quantità come proteine ricombinanti in batteri. Anticorpi di singolo dominio possono anche essere geneticamente modificate per contenere specifici marcatori o tag che possono essere utilizzati come "gruppi di reporter" per la diagnosi di malattie11. Questa facilità di manipolazione accoppiato con la loro flessibilità d'uso rende anticorpi di singolo dominio una risorsa importante per i ricercatori alle università e altrove.

Come parte di un National Institutes of Health supportato core, metodi esistenti sono stati adattati per produrre gli anticorpi di singolo dominio da alpaca3,4. Alpaca presentano vantaggi significativi in entrambi la maneggevolezza rispetto più grandi membri della famiglia camelide, così come l'accessibilità. Alpaca sono ampiamente sollevati per fibra e carne e così possono essere ottenuti regionalmente da agricoltori locali alpaca, che possono essere identificati attraverso i loro siti Web o attraverso associazioni di allevatori di stato. Due razze di Alpaca sono disponibili, Suri e Huacaya. Huacaya sono più comune e sono stati utilizzati per questo protocollo, ma il protocollo è generalmente applicabile a due razze e più ampiamente applicabile anche ad altri camelidi.

Protocol

Tutte le procedure con gli alpaca sono state eseguite secondo protocolli (2627-2017 e 2018-2925) approvati dall'Università del Kentucky istituzionale Animal Care ed uso Committee (IACUC).

1. generazione di anticorpi antigene-specifiche Alpaca

  1. Gestione degli Alpaca e considerazioni generali
    1. Ottenere approvazione istituzionale e/o regolamentazione appropriata.
    2. Ottenere gli alpaca adulti, meno di 10 anni di età con un corpo condizione Punteggio di almeno 3,0 (scala 1-5)12. Perché sono animali del gregge, casa un minimo di due, ma preferibilmente tre animali insieme.
      Nota: I maschi sono raccomandati perché, in generale, hanno un temperamento più uniforme e sono più facili da lavorare con.
    3. Controllare lo stato di salute degli animali attraverso una visita veterinaria, ivi compresa la revisione della dieta, alloggio, vaccinazione e parassita controllo programmi13. Assicurarsi che gli animali siano aggiornati con le vaccinazioni appropriate alla regione geografica locale sulla base delle raccomandazioni veterinarie professionale. Sviluppare un programma di controllo di ecto - ed endoparassiti in consultazione con un veterinario sulla base di una revisione della storia dell'allevamento di origine e condizioni locali specifiche13.
    4. Acclimatare per almeno una settimana, compresa la formazione di cavezza e l'esposizione a ritenuta.
    5. Raccogliere un campione di sangue di 4 mL per ottenere siero per uso come un controllo di pre-immunizzazione (Vedi punto 1.4). I sieri di congelare e conservare a-20 ° C in aliquote di 0,5 mL.
      Nota: In questo momento, sangue addizionale può essere assunto per un'analisi completa delle cellule del sangue (CBC) monitorare lo stato di salute iniziale degli animali.
  2. Preparazione dell'antigene
    1. Preparare gli antigeni di proteina purificata in tampone fosfato salino (PBS) o soluzione salina tamponata HEPES (HBS) e concentrarsi a ≥ 1 mg/mL. Circa 3 mg di proteina è necessaria per il protocollo completo, compresi l'immunizzazione, il panning e la conferma dei cloni.
      Nota: Gli anticorpi camelide visualizzano alta specificità e selettività contro gli antigeni della proteina ma sono generalmente non adatti per le proteine non strutturate o antigeni peptidici che sono generalmente non strutturati.
    2. Determinare la purezza dell'antigene, con purezza > 90% desiderato. Utilizzare un metodo analitico come SDS-PAGE.
      Attenzione: Significativa contaminazione con altre proteine può portare a problemi durante la selezione dove il singolo dominio anticorpi possono essere isolati di contaminanti, piuttosto che la proteina dell'obiettivo.
    3. Preparare aliquote congelate dell'antigene che contiene un totale di 100 µ g di antigene. 50 µ l di una preparazione di 2 mg/mL è l'ideale. 100 µ l di 1 mg/mL è la soluzione più diluita di proteina adatta per l'immunizzazione. In alternativa, se l'antigene non può subire gelo/disgelo ed è conosciuto per essere stabile a lungo termine soluzione, esso può essere conservato a 4 ° C.
      Nota: Per garantire che l'antigene può subire un ciclo di congelamento/scongelamento, prova che un'aliquota di 20 µ l dell'antigene dovrebbe essere erogata in una sottile parete provetta PCR e snap congelati in azoto liquido. Scongelare il tubo, centrifugazione ad alta velocità di eseguire e verificare il recupero quantitativo confrontando assorbimento UV/VIS prima e dopo il congelamento, oppure eseguendo un gel di SDS-PAGE. Se fattibile, l'antigene deve essere testato anche per il mantenimento dell'attività biologica. Se il ciclo Disgelo ha esito positivo, l'antigene restante è snap congelati in aliquote di 100 µ l e conservati a-80 ° C. Se ci sono problemi con il ciclo di congelamento/scongelamento, il protocollo può essere ripetuto con l'aggiunta di fino a 20% glicerolo.
  3. Immunizzazione
    1. Mescolare fino a cinque antigeni, 200 µ g ciascuno, con adiuvante in un volume finale di tra 300 a 1.000 µ l. L'adiuvante dovrebbe costituire ≥ 50% del volume finale utilizzando l'acqua come diluente.
      Nota: Se il buffer è necessario, utilizzare HEPES, MOPS o glicina. Un pH compreso tra 5 e 6 ha spesso dimostrato di essere più favorevole di rigorosamente neutrale. Evitare gli ioni polivalenti come fosfato o citrato, poiché essi possono provocare la coagulazione.
    2. Tagliare i capelli di alpaca con tagliatori elettrici, a forma di falce di luna lungo la base del suo collo da spalla a spalla per esporre le regioni adiacenti ai linfonodi prua.
    3. Tenendo l'alpaca per il collo, iniettare lentamente l'antigene sottocute lungo la base del collo vicino i linfonodi di prua utilizzando un ago 22 G. Eseguire cinque iniezioni di ~ 200 µ l (o meno) ~ 5 cm di distanza.
      Nota: Gli animali devono essere immobilizzati da un secondo membro del personale durante le iniezioni. L'iniezione e sanguinamento Alpaca invita alla prudenza, poiché essi sono inclini a calci, non solo da dietro, ma lateralmente. Avendo gli animali vicino a vicenda, in un gruppo, durante le procedure è ottima. Dato che sono animali del gregge, che sono più calmi in un gruppo e ritenuta meno forza è necessaria durante le procedure.
    4. Monitorare gli animali per ~ 20 minuti dopo l'iniezione per segni di anafilassi (vedere punto 1.6). Monitor per infiammazione localizzata presso i siti di iniezione settimanale, che non è previsto quando si utilizza l'adiuvante consigliato. Garantire che la perdita di sangue dal sito di iniezione non è eccessiva.
    5. Eseguire cinque iniezioni d'amplificazione successive settimanale utilizzando 100 µ g di ogni antigene nella miscela. Ritaglio dei capelli presso i siti di iniezione può essere richiesto ogni settimana a seconda della stagione. In autunno e in inverno, i capelli degli animali possono crescere rapidamente.
  4. Prelievo di sangue
    1. Clip e disinfettare il sito di raccolta con tamponi imbevuti di alcool.
    2. Trattenere l'animale delicatamente con il collo tenuto in posizione verticale e dritto.
      Nota: Gli animali possono essere immobilizzati manualmente, come dimostrato nel video. Se disponibile, utilizzare un scivolo di alpaca per trattenere gli alpaca durante lo spurgo e iniezioni possono facilitare la gestione. Per utilizzare un scivolo di alpaca, alpaca haltered sono portati nello scivolo e trattenuti con collo bar e cinghie con sganci rapidi. Versioni dello scivolo alpaca sono disponibili dai fornitori commerciali.
    3. Tramite la proiezione ventrale del processo trasverso delle vertebre come un punto di riferimento, occludere la vena applicando pressione appena mediale al processo ventrale.
      Nota: Non c'è nessun solco giugulare distinto in alpaca adulto. Le vene giugulari sono protetti da proiezioni ventrale dei processi vertebrali trasversale. Questa pelle spessa (ad es., 1 cm di spessore "piastra di combattimento" sopra il medio 1/3 del collo nei maschi) e la muscolatura del collo rende difficile visualizzare o palpare la vena giugulare stessa. Successivamente, l'uso di punti di riferimento vertebrale è gli indicatori più utili per posizione giugulare.
    4. Inserire l'ago con un'angolazione di 45° leggermente mediale (~ dito larghezza) per la proiezione verso il centro del collo. Manipolare l'ago fino a quando il sangue scorre.
      Nota: La vena giugulare e la carotide sono vicino a vicenda. Sangue venoso può essere abbastanza rosso in colore ma è ancora più scuro di sangue arterioso. Seguito della raccolta, la pressione deve essere applicato al sito per 0,5-1 min (o più se la carotide è letta) fino a quando non è assicurata l'emostasi.
    5. Disegnare 4-10 mL di sangue per scopi analitici. Utilizzare un 1,5 pollici, ago 20 G in genere in combinazione con un'apposita siringa dimensione o tubo di raccolta sangue. Utilizzare provette con EDTA di lavanda K2migliori per la raccolta del sangue intero quando i linfociti di purificazione. Utilizzare tubi di separazione del siero superiore oro (BD) quando si raccolgono il sangue per la produzione di siero.
    6. 50-100 mL di sangue per la produzione di disegnare. Utilizzare una prolunga infusione supplementare di 12 pollici con un set di infusione di 19-20 G alato "farfalla".
      Nota: Un'estensione Imposta configurazione permette un assistente riempire più tubi di raccolta sangue, permettendo il venipuncturist di concentrarsi sulla stabilizzazione l'ago di raccolta. L'aggiunta del set di infusione può ospitare movimento potenziale dell'animale (procedura di 3-5 min) e dà una distanza di lavoro confortevole per gli operatori.
  5. Immunitario monitoraggio
    1. Tre o quattro giorni dopo il 3rd e 5th iniezioni, eseguire un piccolo test sanguinare da ogni animale per ottenere sieri per il test. Congelare e conservare i sieri in aliquote da 0,5 mL. Ottenere campioni di sangue aggiuntivi allo stesso tempo per monitorare la salute dell'animale, come discusso in precedenza.
    2. Confermare la presenza di anticorpi antigene-specifiche da ELISA usando i sieri ottenuti da test sanguina a intervalli di tempo pre-immuni, tre settimane e cinque settimane. È meglio prendere un salasso finale, mentre il titolo dell'anticorpo è ancora in aumento.
    3. Generare piastre di affinità dell'antigene con superficie trattate piastre da 96 pozzetti. Diluire 0,1 µ g dell'antigene in tampone carbonato di sodio di 100 mM, pH 9.0. Aggiungere 100 µ l della soluzione ad ogni pozzetto e incubare per una notte a 4 ° C. Dieci diluizioni di ogni antigene vengono testate in duplicato. Un controllo in bianco è ben preparato che è rivestito con tampone di carbonato solo.
    4. Dopo l'incubazione overnight, capovolgere la piastra per rimuovere il contenuto dei pozzetti e lavare tre volte con 0,1 mL di PBS, 0.1% Tween 20 (PBS-T).
    5. Bloccare i pozzetti aggiungendo 0,1 mL di BSA (5 mg/mL) in PBS-T e incubare la piastra per 1 h a temperatura ambiente.
    6. Lavare la piastra tre volte con PBS-T pipettaggio la soluzione di lavaggio nel pozzo e poi rimuovendo la soluzione di lavaggio per l'inversione della piastra.
    7. Preparare diluizioni seriali di 0,3 mL ciascuno dei sieri pre-immuni e immuni in tampone PBS-T utilizzando una diluizione iniziale di 1/100 e fino a 1/102, 400.
    8. Aggiungere 100 µ l di ciascuna diluizione ai pozzetti e lasciare per incubare per 2 ore a temperatura ambiente.
    9. Rimuovere il siero da ogni pozzetto e lavare con 0,2 mL di PBS-T tre volte.
    10. Incubare ogni bene con 0,1 mL di anticorpo di IgG anti-llama capra HRP-coniugato ad una diluizione di 1: 20,000 per 1 h.
      Nota: La risposta immunitaria misurata include entrambi convenzionali così come catene pesanti soli anticorpi, che sono presenti in proporzioni approssimativamente uguali in circolazione3,14.
    11. Rimuovere la soluzione di anticorpo e lavare ogni bene con 0,2 mL di PBS-T tre volte.
    12. Aggiungere 100 µ l di substrato cromogenico perossidasi nel pozzetto e incubare a temperatura ambiente fino a quando l'intensità dei due punti più alti di concentrazione hanno diventare saturi, che prende di solito 5-10 min.
    13. Aggiungere 100 µ l di acido solforico 0,1 M a ciascun pozzetto per arrestare la reazione.
    14. Misurare l'assorbanza di ciascun pozzetto a 450 nm utilizzando un lettore di piastra.
    15. Tracciare l'assorbanza come una concentrazione di funzione.
  6. Complicazioni potenziali e di monitoraggio di Alpaca
    1. Garantire alpaca appropriato monitoraggio durante tutta la procedura.
      Nota: Le procedure non dovrebbero causare effetti avversi significativi. Salute e benessere degli animali devono essere monitorati quotidianamente da allevamento e/o ricerca personale durante l'alimentazione e l'abbeveraggio. Qualsiasi animale con unalleviated sperimentalmente indotto o spontaneo naturale morbosità deve essere denunciati per la valutazione di servizi veterinari con trattamenti forniti a seconda dei casi, fino a humane eutanasia, se necessario.
      Potenziali conseguenze negative associate a flebotomia sono sanguinamento, ecchimosi ed ematoma. Gli animali devono essere monitorati per 20 min post prelievo di sangue cercare segni di sanguinamento. Ulteriori pressioni sui siti dovrebbero essere usato. Se il sanguinamento non si ferma, un veterinario deve essere contattato.
      Altre potenziali conseguenze negative associate con iniezioni e sanguinamento includono infiammazione e formazione di granuloma. Formazione del granuloma non è previsto e non è stato osservato presso l'Università del Kentucky. L'infiammazione del sito di iniezione (arrossamento o gonfiore) potrebbe verificarsi e dovrebbe essere portato all'attenzione di un veterinario. L'emorragia di produzione rappresenta un volume di sangue potenzialmente importanti, e gli animali devono essere monitorati per assicurare che sono stabili e attivi dopo la raccolta del sangue.
      Anafilassi e pirogene risposte sono le due più probabili gravi conseguenze negative, ma sono osservate molto raramente. Se dovesse verificarsi, anafilassi si verificano poco dopo le iniezioni di antigene e manifestarsi con un aumento della temperatura rettale, debolezza, vomito, problemi respiratori, o diarrea. Temperatura rettale può essere monitorata dopo ogni iniezione per rilevare eventuali aumenti della temperatura corporea. Se questi sono riconosciuti, notificare un veterinario immediatamente per una consultazione. Inoltre, un "Crash Kit di emergenza" (ad es., adrenalina, corticosteroidi e antistaminico) elaborata in consultazione con un veterinario dovrebbe essere disponibile a curare gli animali ritenuti sospettati di avere una reazione avversa.

2. purificazione di linfociti per singolo dominio anticorpo costruzione della libreria

  1. Raccogliere 50 mL di sangue tre-cinque giorni dopo l'ultima iniezione (Vedi punto 1.4).
    Nota: Elaborazione rapida di sangue e l'isolamento di RNA è importante ottenere una libreria adatta dimensioni15,3, che è molto importante per il successo di panning.
  2. Diluire 15 mL di sangue prelevato con 5 mL di PBS.
  3. Utilizzare un tubo di separazione del linfocita per isolare i linfociti periferici del sangue (PBLs) mediante centrifugazione in gradiente di densità in base ai suggerimenti di produce.
    Attenzione: Le istruzioni del produttore indicano che fino a 25 mL di sangue può essere utilizzato, ma questo può saturare il sistema e impedire di ottenere una preparazione pulita del linfocita.
  4. Aggiungere 5 mL di PBS prechilled a 4 ° C di PBL.
  5. Girare per 20 min a 800 x g a 4 ° C.
  6. Lavare due volte con l'aggiunta di 5 mL di PBS prechilled a 4 ° C a PBL seguita da centrifugazione per 20 min a 800 x g a 4 ° C.
  7. Isolare gli RNA totale usando un sistema di rotazione-colonna basata, secondo le istruzioni del produttore. Omogeneizzare le cellule mediante dispositivi nel buffer appropriato e applicazione a un sistema di triturazione di biopolimero. Utilizzare un numero adeguato di mini o maxi-colonne in base alla cella di input.
  8. Sintetizzare cDNA usando il transcriptase combinando 10 µ g di RNA con un mix di 0.1 µ g di Oligo (dT) primers di 12-18.
  9. Generare una libreria di batteriofago utilizzando metodi stabiliti4. Si tratta di clonazione con enzimi di restrizione nel phage display vettoriale pMES4 seguito dall'espressione dell'inserto fusa al gene III del fago filamentoso per la produzione della soluzione dei fagi.

3. singolo dominio anticorpo Panning

  1. Prodotti antigene affinità piastre con superficie trattata piastre da 96 pozzetti. Diluire 0,25 µ g dell'antigene in tampone carbonato di sodio di 100 mM, pH 9.0. Aggiungere 100 µ l di questa soluzione in ogni pozzetto e incubare per una notte a 4 ° C. Cappotto due pozzi per l'antigene. Preparare un controllo vuoto ben che è rivestito con tampone di carbonato solo.
    Nota: Piastre possono essere prodotto e immagazzinati per fino a una settimana a 4 ° C se più cicli di selezione verranno eseguite. Inoltre, questo metodo utilizza assorbimento diretto che non richiede etichettatura mentre altri metodi utilizzano biotinylation o altri tipi di strategie di etichettatura.
  2. Incubare la piastra durante la notte. Inverti per rimuovere il contenuto dei pozzetti e lavare tre volte con 0,1 mL di PBS-T.
  3. Bloccare i pozzetti aggiungendo 0,1 mL di BSA (20 mg/mL) in PBS e incubare la piastra per 2 h a temperatura ambiente.
  4. Lavare la piastra tre volte con PBS-T seguita da tre volte con PBS. Antigeni possono essere anche covalentemente etichettati e utilizzati nei sistemi di cattura come, ad esempio, sistemi di streptavidina/biotina.
  5. Pre-trattare la soluzione dei fagi (100 µ l) con 100 µ l di 40 mg/mL BSA in PBS su una pedana vibrante a temperatura ambiente per 30 min.
  6. Aggiungere la soluzione di fago all'antigene pozzetti rivestiti con e incubare con movimentazione delicata per 2 h a temperatura ambiente. Utilizzare pozzi multipli al fine di garantire un totale di 1011 dei fagi per ogni antigene.
  7. Scartare il fago non associato di inversione e quindi lavare i pozzetti 5 volte con 200 µ l di PBS-T seguita da cinque volte con PBS.
  8. Eluire il fago associato aggiungendo 0,1 mL di tripsina 0,25 mg/mL in PBS e incubare per 30 min a temperatura ambiente sulla piattaforma vibra a 700 rpm.
  9. Trasferire la soluzione in un flaconcino contenente 5 µ l di soluzione di hydrochloride(AEBSF) di 4 mg/mL 4-benzenesulfonyl fluoruro per placare l'attività della tripsina.
  10. Crescere a 37 ° C con agitazione fino OD600 le celle competenti TG1 phage display = 0,5.
  11. Aggiungere 50 µ l del fago eluito a 3 mL di cellule del TG1.
  12. Incubare a 37 ° C senza agitare per 30 min.
  13. Aggiungere 7 mL di LB media completati con ampicillina di 100 µ g/mL, 2% di glucosio.
  14. Agitare una notte a 37 ° C.
    Nota: Per ottenere i più diversi anticorpi di singolo dominio, cloni possono essere sequenziati, testati per proprietà desiderate e utilizzati dopo il primo turno di panning. Per ottenere la più alta affinità degli anticorpi di singolo dominio, dovrebbero essere utilizzati due turni di panning.
  15. Piastra i batteri dopo la crescita durante la notte su piastre di agar LB completati con ampicillina di 100 µ g/mL, 2% di glucosio. Diluizioni seriali diversi dovrà essere testato, a partire con due diluizioni, placcatura 100 µ l di 1/10.000 e 1/100.000 diluizioni.
  16. Incubare la piastra durante la notte a 37 ° C.
  17. Scegli le colonie e inoculare i pozzetti di una piastra a 96 pozzetti sterile contenenti 100 µ l di 2XYT con 100 µ g/mL ampicillina, 2% di glucosio, glicerolo 10% v/v per pozzetto.
  18. Incubare per una notte a 37 ° C senza agitazione.
  19. Il giorno successivo, agitare a 170 giri/min a 37 ° C per 60 min.
  20. Rimuovere 2 µ l di media in provette per PCR. La soluzione rimanente può essere lasciata nel piatto e conservata a 4 ° C per 1-2 giorni o congelata e conservata a-80 ° C per un uso successivo.
  21. Eseguire la reazione di PCR utilizzando primers appropriato per il vettore utilizzato. Per pMES4, lo screening di PCR dei cloni positivi usi primer che fiancheggiano i polylinker è CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC e GGTGGTGTGAGGAGACGGTGACCTG. Utilizzare ciclismo condizioni appropriate per la polimerasi utilizzata, una temperatura di annealing di 57 ° C e 30 cicli.
  22. Analizzare la reazione di PCR mediante l'esecuzione di un gel di agarosio 1% (p/v). Colonie che sono positivi hanno dominio singolo anticorpo gene inserti di ~ 500 BP. Accertarsi che i cloni positivi sono 20-50% del campione.
    Nota: Questo metodo fornisce un mezzo per clone, selezione e analisi che possono essere eseguite nella maggior parte dei laboratori di ricerca. In alternativa, sequenziamento di nuova generazione possa essere applicato e fornisce grandi set di dati che consentono l'analisi statistica e comparativa16.
  23. Inoculare i cloni positivi dalla piastra in fresche provette contenenti 7 mL di LB con ampicillina di 100 µ g/mL.
  24. Crescere con l'agitazione per una notte a 37 ° C.
  25. Eseguire un miniprep sulla cultura per ottenere il DNA del plasmide.
  26. Sequenza di cloni positivi utilizzando lo standard di sequenziamento primer pEX-Rev (CAGGCTTTACACTTTATGCTTCCGGC).
  27. Eseguire analisi computazionale sulle sequenze di anticorpo risultante singolo dominio. Assicurarsi che non ci sono nessun codoni di stop o telaio si sposta.
  28. Classificare le sequenze risultanti per somiglianza e diversità. Le sequenze che vengono ripetutamente identificate sono più probabile di essere sequenze di legame ad alta affinità, particolarmente dopo due turni di selezione.
  29. Esprimere l'anticorpo di singolo dominio utilizzando un ceppo BL21-derivato espressione di E. bobina. Indurre l'espressione attraverso l'aggiunta di IPTG, crescendo durante la notte a 22 ° C.
  30. Purificare l'anticorpo di singolo dominio mediante cromatografia di affinità immobilizzata di metallo (IMAC).
  31. Convalidare l'associazione di anticorpi e antigeni di singolo dominio usando un'analisi di interazione diretta come l'elettroforesi del gel di pull-down, nativo, o ELISA.
  32. Verificare le prestazioni di anticorpo specifico dell'applicazione singolo dominio, come desiderato per l'esperimento specifico.

Representative Results

Il protocollo qui presentato è stato utilizzato per generare anticorpi di singolo dominio contro una gamma di antigeni della proteina. Cinque gli antigeni sono stati utilizzati per ogni alpaca. Monitoraggio sistema immunitario hanno indicato che la maggior parte degli antigeni ha mostrato inizio risposta robusta a tre settimane (Figura 1). Sbavature di produzione e costruzione della libreria dopo circa sei settimane dà il miglior equilibrio per gli animali che hanno più antigeni iniettati. Due turni di panning erano eseguite per ogni antigene e isolate colonie proiettato (Figura 2). Ordinamento di colonie positive ha identificato diversi dominio singolo anticorpo sequenze per gli antigeni differenti. Per esempi, tre cloni unici sono stati isolati per l'antigene di riferimento maltosio Binding Protein (MBP) (Figura 3A). Come è osservato frequentemente, gli anticorpi di singolo dominio contengono sequenza significativa diversità e altamente variabile CDR3 lunghezza (Figura 3). Queste caratteristiche sono particolarmente importanti nelle interazioni antigene/anticorpo di singolo dominio come visto nel riferimento singolo dominio anticorpo/CX3CL1 complesso17 (Figura 3B).

La maggior parte delle sequenze di Full-Length dominio singolo anticorpo può essere espresso e purificata a 1-10 mg/L di cultura (Figura 4A). A causa della diversità di lunghezza CDR3, anticorpi di singolo dominio diverso mostrano lieve variazione nel peso molecolare. Conferma di binding diretto e le prestazioni dell'applicazione specifici è fondamentale. Ad esempio, dopo due turni di selezione contro l'antigene B, un pannello di singolo dominio gli anticorpi erano identificati (Figura 2). Più sequenze identiche sono state identificate, e l'anticorpo di dominio singolo è stato prodotto e purificato. È stato quindi testato via tiro diretto verso il basso con resina di affinità di antigene e hanno mostrato il grippaggio di robusta dose-dipendente (Figura 4B). D'importanza, l'anticorpo di singolo dominio ha mostrato alcuna associazione per il controllo della resina. Questi dati dimostrano un'interazione diretta associazione e uno che è adatto per l'acquisizione di affinità in formati basati su ELISA e menu a tendina.

Figure 1
Figura 1 : Monitoraggio immuni rappresentativi di due antigeni distinti risultati significativa specifica risposta immunitaria agli antigeni distinti nello stesso animale. Molti antigeni mostrano risposta robusta già tre settimane dopo l'inizio della vaccinazione, con la maggior parte mostrando la risposta massima dopo sei settimane. Sei settimane permette maturazione di affinità anche ed è il tempo consigliato per la produzione sanguinare e isolamento della B-cellula. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 : Basata sulla PCR conferma dei cloni positivi. Primer occupare il MCS del vettore pMES4 e un clone di nanobody positivo produce un amplicone di ~ 500 bp (contrassegnati con *). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 : Sequenze di antigene-specifiche evidenziare la diversità degli anticorpi di alpaca singolo dominio. (A) allineamento di sequenze di anticorpo Seleziona dominio singolo isolato a MBP con un riferimento singolo dominio anticorpo 4XT1, quadro e regioni dideterminazione (Kabat) evidenziate di seguito. (B) struttura di alpaca dominio singolo anticorpo 4XT1 associato a CX3CL1 (PDB 4XT1), sottolineando il ruolo critico di CDR variabile loop nell'associazione antigene specifico. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4 : Purificazione e convalida degli anticorpi di singolo dominio. (A) SDS-PAGE di IMAC purificato singolo dominio anticorpi, confrontando gli anticorpi diversi singolo dominio. Diversi pesi molecolari sono principalmente dovuti a lunghezza variabile del ciclo CDR3. Diversi livelli di espressione sono stati osservati, con una minoranza degli anticorpi di singolo dominio mostrando scarsa resa della proteina purificata. (B) verifica del binding diretto utilizzando un'affinità di antigene menu a tendina. Grippaggio dell'anticorpo robusta dose-dipendente singolo dominio è osservato con resina antigene-accoppiato ma non con resina di controllo. Clicca qui per visualizzare una versione più grande di questa figura.

Discussion

Come osservato, l'alta affinità e specificità degli anticorpi di singolo dominio, combinato con la loro espressione facile e stabilità, renderli reagenti ideali per le applicazioni nella ricerca biomedica, come critici Reagenti biochimici, strumenti diagnostici, o agenti terapeutici18. Per applicazioni commerciali, ci sono alcune questioni relative alla proprietà intellettuale che devono essere considerate. Inoltre, gli anticorpi di singolo dominio possono essere progettati per contenere specifici marcatori o tag che possono essere utilizzati come reporter in test cellulari o in diagnostica. La chiave per questi usi è la capacità di produrre anticorpi specifici singolo dominio contro gli antigeni di interesse. Un metodo è descritto qui per produrre gli anticorpi di singolo dominio utilizzando gli alpaca, che produce una risposta immunitaria robusta contro un'ampia varietà di antigeni della proteina. Considerazioni per la movimentazione degli animali e la conformità normativa sono descritti. Queste sono la chiave per il successo in questa parte del processo.

Ci sono altre strategie per la produzione di anticorpi di singolo dominio che non richiedono l'immunizzazione, ma invece utilizzano librerie semisintetiche con diversi sistemi per la selezione e l'ottimizzazione iterativa di affinità19,20 . Tuttavia, il vantaggio di utilizzare librerie derivate da animali immunizzati è la capacità di isolare in modo affidabile gli anticorpi altamente arricchito, diversificata e ad alta affinità di singolo dominio. Inoltre, non solo si osservano variazioni di sequenza significativa, ma una maggioranza significativa di anticorpi specifici singolo dominio isolato ha avuto unici inserimenti ed eliminazioni, specialmente nel CDR3.

Più ulteriormente, singolo dominio anticorpi possono essere prodotto tramite un processo semplice che richiede solo piccole iniezioni dell'antigene e dopo questo processo, gli animali possono essere restituiti alla mandria. Di nota, l'animale può essere liberamente utilizzato per la produzione di fibre, ma dovrà essere esclusi dall'uso come carne (catena alimentare umana) dovute all'uso del test di antigeni e non FDA approvato adiuvante per produzione dell'anticorpo di singolo dominio. Una volta completata la procedura, gli animali devono essere monitorati per una settimana, dato un esame veterinario finale e quindi possono essere restituiti nella loro fattoria casa o riposati per sei mesi prima un altro giro di produzione dell'anticorpo di singolo dominio.

Disclosures

D. ssa Whiteheart e Hersh sono presso l'Università del Kentucky e operare un nucleo nel centro per medicina molecolare che produce gli anticorpi di singolo dominio in "Alpaca" come un servizio a pagamento.

Acknowledgments

Questo lavoro è stato supportato dal National Institutes of Health (P30GM103486).

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
Immunizzazione di Alpaca (<em>Lama pacos</em>) con gli antigeni della proteina e la produzione di anticorpi di dominio singolo antigene-specifiche
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter