Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Imunização de alpaca (Lama pacos) com antígenos da proteína e a produção de anticorpos de domínio único antígeno-específicas

doi: 10.3791/58471 Published: January 26, 2019

Summary

Um método para a produção de anticorpos de domínio único de alpacas, incluindo imunização, coleta de sangue, célula B isolamento e seleção é descrito.

Abstract

Neste manuscrito, um método para a imunização de alpaca e o uso de métodos de biologia molecular para produzir anticorpos antígeno-específicos de domínio único é descrito e demonstrado. Camelídeos, como as alpacas e lhamas, tornaram-se um recurso valioso para a investigação biomédica desde que eles produzem um tipo de romance de anticorpo somente cadeia pesado, que pode ser usado para produzir anticorpos de domínio único. Porque o sistema imunológico é altamente flexível, anticorpos de domínio único podem ser feitos a muitos antígenos diferentes da proteína e até mesmo diferentes conformações do antígeno, com um alto grau de especificidade. Esses recursos, entre outros, fazem anticorpos único domínio uma ferramenta inestimável para a investigação biomédica. Relata-se um método para a produção de anticorpos de domínio único de alpacas. Um protocolo para imunização, coleta de sangue e células B isolamento é descrito. As células-B são utilizadas para a construção de uma biblioteca imunizada, que é usada na seleção de anticorpos específicos de domínio único através de garimpar. Anticorpos de putativo específico único domínio obtidos via panorâmica são confirmados pelo suspenso, ELISA, ou ensaios de gel-turno. Os anticorpos resultantes de domínio único então podem ser usados diretamente ou como parte de um reagente de engenharia. As utilizações de domínio único anticorpo e regentes de domínio único anticorpo-baseado incluem aplicações estruturais, bioquímicas, celulares, in vivo e terapêuticas. Anticorpos de domínio único podem ser produzidos em grandes quantidades, como proteínas recombinantes em sistemas de expressão procarióticos, purificado e usado diretamente ou pode ser projetada para conter marcadores específicos ou tags que podem ser usados como repórteres em estudos celulares ou em diagnósticos.

Introduction

Alpacas e outros membros da família camelid, tornaram-se uma fonte popular para a geração de anticorpos para pesquisa biomédica1,2,3. Camelídeos têm um exclusivo sistema imunológico em que eles produzem anticorpos normais, bem como da cadeia pesada anticorpos único que permitem a produção de anticorpos muito menores de domínio único, mantendo a alta especificidade e afinidade elevada. Assim, anticorpos camelid fornecem um versátil reagente útil para uma variedade de propósitos. Um método para imunizar alpaca e produzir anticorpos de domínio único para uma variedade de antígenos da proteína é descrito aqui. Estes anticorpos podem ser produzidos em camelídeos através de um processo relativamente simples que requer apenas a imunização através de pequenas injeções da proteína alvo (antígeno) e um empate de sangue4. Posteriormente, a construção de biblioteca, de exposição do fago M135 e panning contra o antígeno recombinante6 é usado para isolar e produzir anticorpos de domínio único com as características desejadas. Porque o processo aproveita o poder da tecnologia de exibição do fago, cinco ou mais antígenos podem ser utilizados simultaneamente por animal, reduzindo assim o número de animais utilizados e custos associados.

Típico dos mamíferos anticorpos ou imunoglobulinas são moléculas grandes, que consiste de dois tipos de correntes (2 correntes pesadas e 2 cadeias leves), que estão ligados entre si através de ligações de bissulfeto. Estes anticorpos são relativamente grandes, exibindo pesos moleculares de ~ 140-190 kDa para as espécies mais abundantes de IgG de seres humanos, ratos, cabras e coelhos. Devido à sua estrutura multi subunidade, alto peso molecular e ligações de bissulfeto, imunoglobulinas podem ser bastante desafiadoras para produzir em grandes quantidades, tornando seu custo elevado. Na década de 1990, foi descoberto que, além da imunoglobulina tipo típico dos mamíferos, uma nova forma de imunoglobulina que é mais simples na estrutura, possuindo apenas pesadas correntes7camelídeos, que inclui camelos, lhamas e alpacas fazem. Estes anticorpos camelid exclusivo possuem a mesma capacidade de vincular especificamente substâncias estranhas com alta afinidade, mas só são feitos de uma proteína de cadeia8. Além disso, anticorpos camelid podem ser truncados experimentalmente para um fragmento de unidade a VHH ainda menor, também chamado de um domínio único anticorpo9. Devido ao seu pequeno tamanho, único domínio anticorpos são úteis para uma ampla gama de aplicações de investigação biomédica e estão disponíveis em uma variedade de fontes acadêmicas e comerciais1,10. Uma exceção parece ser mancha ocidental desde que anticorpos único domínio mais frequentemente são direcionados contra epítopos dependente de conformação, que geralmente são perdidos nas condições desnaturação usadas em borrões ocidentais.

Uma vez que eles são constituídos por uma cadeia única de polipeptídeos, anticorpos específicos de domínio único podem ser selecionados e facilmente produzidos em grandes quantidades como proteínas recombinantes em bactérias. Anticorpos de domínio único também podem ser geneticamente modificados para conter marcadores específicos ou tags que podem ser usados como "grupos de repórter" para o diagnóstico de doenças11. Esta facilidade de manipulação, juntamente com sua flexibilidade de uso produz anticorpos de domínio único um recurso importante para pesquisadores em universidades e em outros lugares.

Como parte de um National Institutes of Health apoiado núcleo, os métodos existentes foram adaptados para produzir anticorpos de domínio único de alpacas3,4. Alpacas têm vantagens significativas em ambos facilidade de manuseio em relação ao maior camelid familiares bem como acessibilidade. Alpacas são amplamente levantadas para fibra e carne e, portanto, podem ser obtidos regionalmente os agricultores locais da alpaca, que podem ser identificados através de seus sites ou através de associações de criadores do estado. Existem duas raças de alpacas, Suri e Huacaya. Huacaya são mais comuns e foram usados para este protocolo, mas o protocolo é geralmente aplicável para qualquer raças e também mais amplamente aplicáveis aos outros camelídeos.

Protocol

Todos os procedimentos com os alpacas foram realizados em conformidade com os protocolos (2627-2017 e 2018-2925) aprovados pelo cuidado institucional do Animal e uso Comité (IACUC) da Universidade de Kentucky.

1. geração de anticorpos antígeno-específicos Alpaca

  1. Manipulação de alpaca e considerações gerais
    1. Obter aprovação institucional e/ou regulamentar adequada.
    2. Obter alpacas adultos, menos de 10 anos de idade com um corpo condição Pontuação de pelo menos 3.0 (escala 1-5)12. Porque eles são animais de rebanho, abrigar um mínimo de dois, mas de preferência três animais juntos.
      Nota: Os machos são recomendados porque, em geral, eles têm um temperamento mais mesmo e são mais fáceis de trabalhar com.
    3. Verificar o estado de saúde dos animais através de um exame veterinário, incluindo a revisão de alimentação, habitação, vacinação e de programas de controle de parasita13. Certifique-se de que os animais são actualizados com vacinação apropriada ao local é uma região geográfica com base nas recomendações de veterinárias profissionais. Desenvolva um programa de controle de ecto - e endoparasite em consulta com um veterinário, baseado em uma revisão da história do rebanho de origem e às condições locais específicas13.
    4. Aclimatação pelo menos uma semana, incluindo treinamento da cabeçada e exposição a contenção.
    5. Recolher uma amostra de sangue de 4 mL para obter o soro para uso como um controle de pre-imunização (veja etapa 1.4). Congelar os soros e armazenar a-20 ° C em alíquotas de 0,5 mL.
      Nota: Neste momento, o sangue adicional pode ser tomada para uma análise completa do glóbulo (CBC) monitorar o status de saúde inicial dos animais.
  2. Preparação do antígeno
    1. Preparar antígenos de proteína purificada em tampão fosfato salino (PBS) ou solução salina tampão HEPES (HBS) e concentrar a ≥ 1 mg/mL. Cerca de 3 mg de proteína é necessária para o protocolo completo, incluindo a imunização, garimpando e confirmação dos clones.
      Nota: Anticorpos de camélidos exibem alta especificidade e seletividade contra antígenos da proteína, mas são geralmente não adequados para as proteínas não-estruturadas ou antígenos peptídeos que são geralmente não-estruturados.
    2. Pureza do antígeno, com pureza > 90% desejado. Utilizam um método analítico como o SDS-PAGE.
      Atenção: Contaminação significativa com outras proteínas pode causar problemas durante a seleção onde anticorpos único domínio podem ser isolados para contaminantes, ao invés da proteína alvo.
    3. Prepare alíquotas congeladas do antígeno que contém um total de 100 µ g de antígeno. 50 µ l de uma preparação de 2 mg/mL é ideal. 100 µ l de 1 mg/mL é a solução mais diluída de proteína apropriada para imunização. Alternativamente, se o antígeno não pode sofrer congelamento/descongelamento e é conhecido por ser estável em longo prazo de solução, pode ser armazenado a 4 ° C.
      Nota: Para garantir que o antígeno pode sofrer um ciclo de congelamento/descongelamento, teste que uma alíquota de 20 µ l do antígeno deve ser dispensada em uma fina parede tubo do PCR e snap congelado em nitrogênio líquido. Descongelar o tubo, realizar centrifugação de alta velocidade e verifique se a recuperação quantitativa, comparando a absorção UV/VIS, antes e depois do congelamento ou executando um gel de SDS-PAGE. Se for possível, o antígeno também deve ser testado para a manutenção da atividade biológica. Se o ciclo de degelo de congelamento for bem-sucedida, o antígeno restante é pressão congelado em 100 alíquotas µ l e armazenado a-80 ° C. Se houver problemas com o ciclo de congelamento/descongelamento, o protocolo pode ser repetido com a adição de até 20% glicerol.
  3. Imunização
    1. Misture até cinco antígenos, 200 µ g cada, com adjuvante em um volume final de entre 300 a 1.000 µ l. Os adjuvantes devem constituir ≥ 50% do volume final utilizando a água como o diluente.
      Nota: Se a reserva for necessária, use HEPES, MOPS ou glicina. Um pH entre 5 e 6, muitas vezes provou para ser mais favorável do que o estritamente neutra. Evite polivalentes íons como fosfato ou citrato, uma vez que podem provocar coagulação.
    2. Apare pelos de alpaca com tosquiadeiras elétricas, em forma de lua crescente, ao longo da base do seu pescoço de ombro para ombro para expor as regiões adjacentes para os linfonodos do arco.
    3. Segurando o alpaca pelo pescoço, lentamente injete o antígeno por via subcutânea ao longo da base do pescoço perto dos linfonodos arco usando uma agulha 22g. Realizar cinco injeções de ~ 200 µ l (ou menos) ~ 5 centímetros distante.
      Nota: Os animais devem ser imobilizados por outro membro do pessoal durante as injeções. Injetando e sangramento alpacas pede cautela já que eles são propensos a dar pontapés, não só por trás, mas para os lados. Ter os animais próximos uns dos outros, em um grupo, durante os procedimentos é ideal. Dado que eles são animais de rebanho, eles são mais calmos, em um grupo e menos forte contenção é necessária durante os procedimentos.
    4. Monitorar os animais para a injeção de post ~ 20 min para sinais de anafilaxia (ver passo 1.6). Monitor para inflamação localizada dos locais de injeção semanal, que não é esperado ao usar o adjuvante recomendado. Certifique-se de que o vazamento de sangue do local da injeção não é excessivo.
    5. Realize cinco injeções estimulando subsequentes usando semanalmente 100 µ g de cada antígeno na mistura. Corte de cabelo dos locais de injeção pode ser necessário semanalmente, dependendo da época. No outono e no inverno, o cabelo dos animais pode crescer rapidamente.
  4. Sangue de desenho
    1. Clip e desinfectar o site coleção com cotonetes de álcool.
    2. Contenha o animal delicadamente com o pescoço mantido ereto e reto.
      Nota: Os animais podem ser imobilizados manualmente, como demonstrado no vídeo. Se disponível, usar de um para-quedas da alpaca para conter os alpacas durante o sangramento e injeções podem facilitar a manipulação. Para usar um para-quedas da alpaca, haltered alpacas são levados o para-quedas e contidos com barras de pescoço e cintas com lançamentos rápidos. Versões da calha da alpaca estão disponíveis a partir de fornecedores comerciais.
    3. Usando a projeção ventral do processo transverso das vértebras como um marco, obstrua a veia aplicando pressão apenas medial ao processo ventral.
      Nota: Não há nenhum sulco jugular distinto em adultos da alpaca. As veias jugulares são protegidas por projeções ventrais dos processos vertebrais transversais. Esta pele grossa (por exemplo, com 1 cm de espessura de "disputam placa" a 1/3 médio do pescoço em machos) e a musculatura do pescoço torna difícil visualizar ou palpar a veia jugular em si. Posteriormente, o uso dos marcos vertebrais é os indicadores mais útil para a localização na jugular.
    4. Introduza a agulha em um ângulo de 45° ligeiramente medial (~ dedo de largura) para a projeção em direção ao centro do pescoço. Manipule a agulha até que o sangue flui.
      Nota: A veia jugular e carótida são próximos uns dos outros. Sangue venoso pode ser bastante vermelho na cor, mas é ainda mais escuro do que o sangue arterial. Após a coleta, pressão deve ser aplicada ao site para 0,5-1 min (ou mais, se a carótida é acessada) até hemostasia é assegurada.
    5. Desenho 4-10 mL de sangue para fins analíticos. Utilize um 1,5 polegadas, agulha 20g tipicamente em conjunto com uma seringa de tamanho apropriada ou o tubo de coleta de sangue. Utilize tubos de EDTA top K2lavanda para coletar o sangue total quando purificando os linfócitos. Utilize tubos de separação do soro superior ouro (BD) ao coletar o sangue para a produção de soro.
    6. Desenhe 50-100 mL de sangue para fins de produção. Use uma extensão adicional de 12 polegadas de infusão definida com um conjunto de infusão de 19 e 20 G alado "borboleta".
      Nota: Uma configuração do conjunto de extensão permite um assistente preencher vários tubos de colheita de sangue, permitindo que o venipuncturist se concentrar em estabilizar a agulha da coleção. A adição do conjunto de infusão acomoda movimento potencial do animal (procedimento de 3-5 min) e dá uma confortável distância de trabalho para os operadores.
  5. Imunológico de monitoramento
    1. Três a quatro dias após o 3rd e 5th injeções, realize um pequeno teste sangramento de cada animal para obter o soro para testes. Congelar e armazenar o sera em alíquotas de 0,5 mL. Obter amostras de sangue adicional ao mesmo tempo para monitorar a saúde do animal, como discutido acima.
    2. Confirme a presença de anticorpos antígeno-específicos por ELISA usando os soros obtidos de teste sangra em pontos de tempo pre-imune, três semanas e cinco semanas. É melhor tomar um sangramento no final, enquanto o título de anticorpo continua a aumentar.
    3. Gere placas de afinidade de antígeno usando placas de 96 poços superficiais tratadas. Dilua a 0,1 µ g de antígeno em tampão de carbonato de sódio de 100 mM, pH 9.0. Adicione 100 µ l da solução a cada poço e incubar durante a noite a 4 ° C. Dez diluições de cada antígeno são testadas em duplicado. Um controle em branco bem está preparado que é revestido com tampão carbonato somente.
    4. Após a incubação durante a noite, inverter a placa para remover o conteúdo dos poços e lavar três vezes com 0,1 mL de PBS, 0.1% Tween 20 (PBS-T).
    5. Bloquear os poços adicionando 0,1 mL de BSA (5 mg/mL) em PBS-T e incubar a placa por 1h à temperatura ambiente.
    6. Lave a placa 3 vezes com PBS-T pipetagem da solução de lavagem dentro do poço e removendo a solução de lavagem por inversão da placa.
    7. Preparar diluições em série dupla de 0,3 mL de cada um dos soros imunes e pre-imunes em tampão PBS-T usando uma diluição inicial de 1/100 e até 1/102, 400.
    8. Adicionar 100 µ l de cada diluição nos poços e permitir a incubar durante 2 h à temperatura ambiente.
    9. Retire o soro de cada poço e lave com 0,2 mL de PBS-T três vezes.
    10. Incube-cada um com 0,1 mL de anticorpo de IgG antilhama conjugado HRP cabra a uma diluição de 1: 20.000 por 1h.
      Nota: A resposta imune medida inclui ambos convencionais, bem como da cadeia pesada apenas anticorpos que estão presentes em proporções aproximadamente iguais em circulação3,14.
    11. Remover a solução de anticorpo e lavar cada bem com 0,2 mL de PBS-T três vezes.
    12. Adicionar 100 µ l de substrato cromogênico peroxidase para o bem e incubar a temperatura ambiente até que a intensidade dos dois pontos mais altos de concentração tornam-se saturaram, que normalmente leva 5-10 min.
    13. Adicione 100 µ l de ácido sulfúrico de 0,1 M a cada poço para parar a reação.
    14. Medir a absorvância de cada poço a 450 nm, utilizando um leitor de placa.
    15. Traça a absorvância como uma concentração de função.
  6. Complicações potenciais e acompanhamento de alpaca
    1. Certifique-se de alpaca adequada acompanhamento durante todo o procedimento.
      Nota: Os procedimentos não são esperados para causar efeitos adversos significativos. Saúde e bem-estar animal devem ser monitoradas diariamente pelo pessoal de criação e/ou investigação durante a alimentação e abeberamento. Qualquer animal com unalleviated induzida experimentalmente, ou espontânea morbidade natural deve ser encaminhado para a avaliação de serviços veterinários com treatment(s) fornecido conforme o caso, até eutanásia humana, se necessário.
      Potenciais consequências negativas associadas com flebotomia são sangramento, hematomas e hematoma. Os animais devem ser monitorados para 20 min post de sangue olhar para os sinais de hemorragia. Pressão adicional sobre os sites deve ser usado. Se o sangramento não parar, um veterinário deve ser contatado.
      Outras consequências negativas potenciais associadas com injeções e sangramento incluem inflamação e formação de granuloma. Formação de granuloma não é esperada e não tem sido observada na Universidade de Kentucky. Inflamação do local de injeção (vermelhidão ou inchaço) pode ocorrer e deve ser levada ao conhecimento de um veterinário. O sangramento de produção representa um potencial significativo volume de sangue, e os animais devem ser monitorados para garantir que eles são estáveis e ativo após a coleta de sangue.
      Anafilaxia e respostas pirogênicas são as duas consequências adversas graves mais prováveis, mas muito raramente são observadas. Se isso ocorrer, anafilaxia ocorreria logo após as injeções do antígeno e manifestar-se por um aumento na temperatura retal, fraqueza, vômitos, problemas respiratórios e/ou diarreia. Temperatura retal pode ser monitorada após cada injecção para detectar qualquer aumento na temperatura corporal. Se estas são reconhecidas, notificar um veterinário imediatamente para uma consulta. Além disso, um Kit de emergência"Crash" (por exemplo, epinefrina, corticosteroides e anti-histamínico) elaborado em consulta com um veterinário deve estar disponível para tratar de animais suspeitados de ter uma reação adversa.

2. purificação linfócitos para construção de biblioteca do domínio único anticorpo

  1. Colete 50 mL de sangue de três a cinco dias após a última injecção (ver passo 1.4).
    Nota: Processamento rápido de sangue e isolamento do RNA são importantes para obter um adequado biblioteca tamanho15,3, que é muito importante para o sucesso de garimpar.
  2. Diluem-se 15 mL de sangue coletado com 5 mL de PBS.
  3. Utilize um tubo de separação de linfócitos para isolar linfócitos do sangue periférico (PBLs) por centrifugação gradiente de densidade de acordo com sugestões de fabrica.
    Atenção: As instruções do fabricante indicam que, até 25 mL de sangue pode ser usada, mas isto pode saturar o sistema e impedir a obtenção de uma preparação de linfócitos limpo.
  4. Adicione 5 mL de PBS prechilled a 4 ° C, a ABP.
  5. Rotação por 20 min a 800 x g a 4 ° C.
  6. Lave duas vezes com a adição de 5 mL de PBS prechilled a 4 ° C, a ABP seguido de centrifugação por 20 min a 800 x g a 4 ° C.
  7. Isole o RNA total usando um sistema de rotação-coluna com base, de acordo com as instruções do fabricante. Homogeneizar as células por vertexing buffer apropriado e aplicar em um sistema de trituração de biopolímero. Use um número adequado de mini ou maxicolunas com base na célula de entrada.
  8. Sintetiza o cDNA usando o transcriptase reverso, combinando a 10 µ g de RNA com uma mistura de 0,1 µ g de Oligo (dT) primeiras demão de 12-18.
  9. Gere uma biblioteca de bacteriófago usando métodos estabelecidos4. Isto envolve clonagem com enzimas de restrição para o fago exibição vector pMES4 seguido pela expressão do inserto fundido ao gene III do fago filamentoso para a produção da solução do fago.

3. único domínio anticorpo panorâmica

  1. Produzir placas de afinidade de antígeno usando placas de 96 poços superficiais tratadas. Dilua a 0,25 µ g de antígeno em tampão de carbonato de sódio de 100 mM, pH 9.0. Adicione 100 µ l desta solução a cada poço e incubar durante a noite a 4 ° C. Casaco dois poços por antígeno. Prepare um controle em branco bem que é revestido com tampão carbonato somente.
    Nota: Placas podem ser produzidas e armazenadas por até uma semana, a 4 ° C, se várias rodadas de seleção serão executadas. Além disso, este método utiliza absorção direta, que não exige a rotulagem enquanto outros métodos usam biotinylation ou outros tipos de estratégias de rotulagem.
  2. Incube a placa durante a noite. Inverter para remover o conteúdo dos poços e lavar três vezes com 0,1 mL de PBS-T.
  3. Bloquear os poços adicionando 0,1 mL de BSA (20 mg/mL) em PBS e incubar a placa por 2h, à temperatura ambiente.
  4. Lave a placa 3 vezes com PBS-T, seguido por três vezes com PBS. Antígenos também podem ser ligado covalentemente rotulados e usados em sistemas de captura como, por exemplo, sistemas de biotina/estreptavidina.
  5. Pré-tratamento da solução do fago (100 µ l) com 100 µ l de 40 mg/mL BSA em PBS sobre uma plataforma vibratória em temperatura ambiente por 30 min.
  6. Adicione a solução do fago ao antígeno revestido poços e incubar com agitação suave para 2 h à temperatura ambiente. Use vários poços para garantir um total de 1011 fago para cada antigénio.
  7. Descartar o fago desvinculado por inversão e depois lavar os poços cinco vezes com 200 µ l de PBS-T, seguido por cinco vezes com PBS.
  8. Eluir o fago encadernado pela adição de 0,1 mL de tripsina 0,25 mg/mL de PBS e incubar durante 30 min à temperatura ambiente na plataforma vibratória a 700 rpm.
  9. Transferi a solução para um frasco contendo 5 µ l de solução de hydrochloride(AEBSF) de fluoreto de benzenesulfonyl-4 de 4 mg/mL de saciar a atividade de tripsina.
  10. Grow TG1 fago exibir células competentes a 37 ° C, com agitação até OD600 = 0,5.
  11. Adicione 50 µ l de eluted do fago para 3 mL de células TG1.
  12. Incube a 37 ° C, sem agitação por 30 min.
  13. Adicione 7 mL de mídia LB suplementada com 100 ampicilina µ g/mL, 2% de glicose.
  14. Agitar durante a noite a 37 ° C.
    Nota: Para obter os mais diversos anticorpos de domínio único, clones podem ser sequenciados, testados para propriedades desejadas e utilizados depois de uma rodada de garimpar. Para obter a maior afinidade de anticorpos de domínio único, devem utilizar-se duas rodadas de garimpar.
  15. As bactérias da placa depois de crescimento durante a noite em placas de ágar LB suplementado com 100 ampicilina µ g/mL, 2% de glicose. Várias diluições em série precisa ser testado, começando com duas diluições, chapeamento 100 µ l de 1/10.000 e 1/100.000 diluições.
  16. Incubar a placa durante a noite a 37 ° C.
  17. Escolha as colônias e inocular os poços de uma placa de 96 poços estéril contendo 100 µ l de 2XYT com 100 ampicilina µ g/mL, 2% de glicose, glicerol 10% v/v por bem.
  18. Incube a 37 ° C durante a noite sem tremer.
  19. No dia seguinte, agite a 170 rpm a 37 ° C por 60 min.
  20. Retire 2 µ l dos meios de comunicação em cadeia da polimerase. O restante da solução pode ser deixado no prato e armazenada a 4 ° C para 1-2 dias ou congelado e armazenado a-80 ° C para uso posterior.
  21. Realize a reação de PCR utilizando primers adequados para a vetor utilizado. Para pMES4, triagem de PCR primers de usos de clones positivos que ladeiam o local múltiplo do clonagem é CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC e GGTGGTGTGAGGAGACGGTGACCTG. Utilize o ciclismo condições adequadas para a polimerase utilizada, uma temperatura do recozimento de 57 ° C e 30 ciclos.
  22. Analise a reação de PCR executando um gel de agarose 1% (p/v). Colônias que são positivas têm inserções de gene único domínio anticorpo de ~ 500 BP certifique-se que clones positivos são 20-50% da amostra.
    Nota: Este método fornece um meio para clone, seleção e análise que pode ser executada na maioria dos laboratórios de pesquisa. Alternativamente, sequenciamento de nova geração pode ser aplicado e fornece grandes conjuntos de dados que permitem a análise estatística e comparativa16.
  23. Inocule os clones positivos da placa para tubos frescos contendo 7 mL de LB com ampicilina 100 de µ g/mL.
  24. Crescer com a tremer durante a noite a 37 ° C.
  25. Execute um miniprep da cultura para obter DNA de plasmídeo.
  26. Sequência de clones positivos, usando o padrão de sequenciamento cartilha pEX-Rev (CAGGCTTTACACTTTATGCTTCCGGC).
  27. Realizar análise computacional em sequências de anticorpos resultantes do domínio único. Certifique-se que existem não códons de parada ou quadro muda.
  28. Classifica as sequências resultantes por similaridade e diversidade. As sequências que são repetidamente identificadas são mais prováveis de serem sequências de ligação de alta afinidade, particularmente após duas rodadas de seleção.
  29. Expressar o anticorpo único domínio usando uma estirpe de expressão BL21-derivado de bobina E.. Induzir a expressão através da adição de IPTG, crescendo durante a noite a 22 ° C.
  30. Purifica o anticorpo de domínio único usando cromatografia de afinidade de metal imobilizado (IMAC).
  31. Valide a ligação de anticorpo/antigénio único domínio usando um ensaio de interação direta como eletroforese em gel de pull-down, nativo, ou ELISA.
  32. Verificar o desempenho de anticorpo específico do aplicativo único domínio, como desejado para o experimento específico.

Representative Results

O protocolo aqui apresentado foi utilizado para gerar o único domínio os anticorpos contra uma variedade de antígenos da proteína. Cinco antígenos foram utilizados por alpaca. Monitoramento imune indicou que a maioria dos antígenos mostrou início de resposta robusta em três semanas (Figura 1). Sangramentos de produção e construção de biblioteca após aproximadamente seis semanas dá o melhor equilíbrio para os animais que têm vários antígenos injetados. Duas rodadas de garimpar foram executadas para cada antígeno e isoladas colônias exibido (Figura 2). Sequenciamento de colônias positivos identificado sequências de anticorpos diversos domínio único para os antígenos diferentes. Para obter exemplos, três clones originais foram isolados para o antigénio de referência Maltose ligação proteína (MBP) (Figura 3A). Como é frequentemente observado, os anticorpos de domínio único contêm sequência significativa diversidade e altamente variável comprimento CDR3 (Figura 3). Estas características são particularmente importantes nas interações de anticorpo/antigénio de domínio único como visto na referência domínio único anticorpo/CX3CL1 complexo17 (Figura 3B).

A maioria das sequências de anticorpo completos no domínio único pode ser expressas e purificada no 1-10 mg/L de cultura (Figura 4A). Devido à diversidade de comprimento CDR3, anticorpos diferentes único domínio mostram ligeira variação no peso molecular. Confirmação de ligação directa e desempenho de aplicativo específico é fundamental. Por exemplo, depois de duas rodadas de seleção contra o antígeno B, um painel de domínio único anticorpos foram identificados (Figura 2). Várias sequências idênticas foram identificadas, e o anticorpo de domínio único foi produzido e purificado. Em seguida foi testado através de tração direta para baixo com resina de afinidade do antígeno e mostrou robusta Associação dose-dependente (Figura 4B). Importante, o anticorpo de domínio único não mostrou nenhuma ligação para controlar a resina. Estes dados demonstram uma interação de ligação directa e que é bem adequado para captura de afinidade em formatos baseados em ELISA e suspenso.

Figure 1
Figura 1 : Monitoramento imune representativo dos dois antígenos distintos mostrando significativa resposta imune específica a antígenos distintos no mesmo animal. Muitos antígenos mostram resposta robusta logo em três semanas após iniciar a imunização, com a maioria apresentando resposta máxima após seis semanas. Seis semanas também permite a maturação de afinidade e é o tempo recomendado para a produção sangrar e isolamento de células B. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : Confirmação de PCR-baseados de clones positivos. As primeiras demão abrangem os MCS do vetor pMES4, e um clone de nanobody positivo produz um amplicon de ~ 500 bp (marcados com *). Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Sequências de antígeno-específicas destacam a diversidade de anticorpos de domínio único da alpaca. (A) alinhamento de sequências de anticorpo de Selecione único domínio isolado para MBP com uma referência domínio único anticorpo 4XT1, com estrutura e regiões determinante de complementaridade (Kabat) destacadas abaixo. (B) estrutura de alpaca domínio único anticorpo 4XT1 acoplado a CX3CL1 (PDB 4XT1), enfatizar o papel crítico da variável CDR loops na ligação de antígeno específico. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4 : Purificação e validação de anticorpos único domínio. (A) SDS-PAGE de anticorpos de domínio único do IMAC purificado, comparando os anticorpos diversos domínio único. Diferentes pesos moleculares são principalmente devido à variação de comprimento do loop CDR3. Diferentes níveis de expressão são também observados, com uma minoria de anticorpos de domínio único, mostrando rendimento pobre de proteína purificada. (B) verificação da vinculação direta usando uma afinidade de antígeno suspenso. Ligação de anticorpo robusto dose-dependente e único domínio é observada com resina acoplados do antígeno, mas não com resina de controle. Clique aqui para ver uma versão maior desta figura.

Discussion

Como observado, a alta afinidade e especificidade dos anticorpos de domínio único, combinado com sua expressão facile e estabilidade, fazem-los reagentes ideais para as aplicações na investigação biomédica, como reagentes bioquímicos críticos, ferramentas de diagnóstico, ou agentes terapêuticos18. Para aplicações comerciais, existem alguns problemas relacionado ao intelectual propriedade que deve ser considerado. Além disso, os anticorpos de domínio único podem ser modificados para conter marcadores específicos ou tags que podem ser usados como repórteres em celulares ensaios ou no diagnóstico. A chave para estes usos é a capacidade de produzir anticorpos específicos de domínio único contra os antígenos de interesse. Um método é descrito aqui para produzir anticorpos único domínio usando alpacas, que produz uma resposta imune robusta contra uma grande variedade de antígenos da proteína. Considerações para manuseio de animal e conformidade normativa são descritas. Estas são a chave para o sucesso nesta parte do processo.

Existem outras estratégias para a produção de anticorpos de domínio único que não exigem a imunização, mas em vez disso, use bibliotecas semi-sintéticos com sistemas diferentes para a selecção e optimização iterativa de afinidades19,20 . No entanto, a vantagem de usar bibliotecas derivadas animais imunizados é a capacidade de isolar confiantemente anticorpos altamente enriquecido, diversificada e alta afinidade de domínio único. Além disso, não só são observadas variações de sequência significativa, mas uma maioria significativa de anticorpos específicos de domínio único isolado tinha exclusivas inserções e exclusões, particularmente em CDR3.

Além disso, o único domínio anticorpos podem ser produzidos através de um processo simples que exige apenas pequenas injeções do antígeno e após este processo, os animais podem ser devolvidos ao rebanho. Digno de nota, o animal pode ser usado livremente para a produção de fibra, mas deve ser excluído do uso como carne (cadeia alimentar) devido ao uso do teste de antígenos e não-FDA adjuvante aprovado para a produção de anticorpos de domínio único. Quando o procedimento é concluído, os animais deve ser monitorados por uma semana, dado a um exame final do veterinário e então podem ser retornou a sua casa de lavoura ou descansou durante seis meses antes de uma nova rodada de produção de anticorpos de domínio único.

Disclosures

Os Drs Whiteheart e Hersh são da Universidade de Kentucky e operam um núcleo no centro de Medicina Molecular que produz anticorpos único domínio em alpaca como uma taxa de serviço.

Acknowledgments

Este trabalho foi financiado pelo National Institutes of Health (P30GM103486).

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
Imunização de alpaca (<em>Lama pacos</em>) com antígenos da proteína e a produção de anticorpos de domínio único antígeno-específicas
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter