Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Иммунизации альпаки (лама pacos) с белков антигенов и производства антиген специфические антитела одного домена

doi: 10.3791/58471 Published: January 26, 2019

Summary

Метод для производства антител одного домена из альпаки, включая иммунизацию, сбора крови, изоляция B-клетки и выбор описан.

Abstract

В этой рукописи метод для иммунизации Альпака и использования методов молекулярной биологии для производства одного домена антиген специфические антитела описано и продемонстрировано. Верблюдовых, альпак и Лам, стали ценным ресурсом для биомедицинских исследований, поскольку они производят Роман тип тяжелые цепи только антитела, которые могут использоваться для производства антител одного домена. Потому что иммунная система является очень гибкой, одного домена антитела можно сделать много различных белков антигенов, и даже различные конформации антигена, с очень высокой степенью конкретности. Эти особенности, среди прочего, сделать одного домена антитела бесценным инструментом для биомедицинских исследований. Метод для производства антител одного домена из альпаки сообщается. Протокол для иммунизации, сбора крови и B-клетки изоляции описан. B-клетки используются для строительства иммунизированной библиотеки, которая используется в выборе конкретных одного домена антитела через панорамирование. Предполагаемые конкретные одного домена антитела, полученные через панорамирование подтверждаются выпадающее, ELISA, или гель сдвиг анализов. Результате антител одного домена может использоваться либо непосредственно, либо как часть инженерных реагента. Использование одного домена антитела и один домен на основе антител регентов включают структурные, биохимические, сотовой, in vivo и терапевтического применения. Одного домена антитела могут производиться в больших количествах как рекомбинантных белков прокариот выражение систем, очищаются и использоваться напрямую или могут быть спроектированы содержат конкретные маркеры или теги, которые могут использоваться в качестве репортеров в сотовых исследования или Диагностика.

Introduction

Альпаки и другие члены семьи животноводческие, стали популярным источником для создания антител для биомедицинских исследований1,2,3. Верблюдовых имеют уникальный иммунной системы в том, что они производят нормальных антител, а также тяжелые цепи только антитела, которые позволяют производство гораздо меньше одного домена антитела, сохраняя при этом высокую специфичность и высоким сродством. Таким образом животноводческие антитела обеспечивают универсальный реагента, полезная для различных целей. Здесь описан метод для иммунизации Альпака и производят антитела одного домена для различных белков антигенов. Эти антитела могут быть произведены в верблюдовых через относительно простой процесс, который требует только иммунизации через малые инъекции целевого белка (антиген) и дро крови4. Впоследствии строительство библиотеки, M13 Фаговые дисплей5 и панорамирование против антигена рекомбинантных6 используется для изолировать и производят антитела один домен с желаемыми характеристиками. Потому что процесс пользуется властью Фаговые технологии отображения, пять или более антигены могут быть одновременно использованы на животное, тем самым уменьшая количество животных, используемых и связанные с этим расходы.

Типичный млекопитающих антител или иммуноглобулины являются большие молекулы, состоящие из двух видов цепей (2 тяжелых цепей и 2 легкие цепи), которые связаны друг с другом через дисульфидными облигаций. Эти антитела относительно велики, экспонирование молекулярным весом ~ 140-190 кДа более обильные IgG видов от людей, мышей, коз и кроликов. Из-за их участием Субблок структуры, высокой молекулярной массой и дисульфидными облигаций иммуноглобулины может быть довольно сложной для производства в больших количествах, что делает их высокой стоимости. В 1990-х годов было обнаружено, что верблюдовых, которая включает в себя верблюдов, Лам и альпак сделать, помимо млекопитающих типичные иммуноглобулинов, роман форме иммуноглобулина, который проще в структуры, обладающие только тяжелые цепи7. Эти уникальные верблюдовые антитела обладают же возможность конкретно привязать инородных веществ с высоким сродством, но состоят только из одного белка цепи8. Кроме того животноводческие антител может быть экспериментально усечен даже меньше единицы VHH-фрагмент, также называется однодоменным антитела9. Из-за их малого размера одного домена антитела являются полезными для широкого круга применения биомедицинских исследований и доступны из различных научных и коммерческих источников1,10. Исключение, как представляется, быть Западный blotting, поскольку чаще всего одного домена антитела направлены против зависимых epitopes конформации, который обычно теряются под денатурируя условия, используемые в западной помарки.

Так как они состоят из одной полипептидной цепи, конкретные одного домена антитела могут быть выбраны и легко производятся в больших количествах как рекомбинантных белков в бактериях. Одного домена антитела также может быть генетически содержат конкретные маркеры или теги, которые могут использоваться как «репортер групп» для диагностики заболеваний11. Эта простота манипуляции, в сочетании с их гибкостью использования делает одного домена антитела важным ресурсом для исследователей в университетах и в других местах.

Как часть национальных институтов здравоохранения поддерживает ядро, существующие методы были адаптированы для производства антител одного домена из альпаки3,4. Альпаки имеют значительные преимущества в обоих легкость обработки относительно крупных животноводческих членов семьи, а также доступность. Альпаки широко выращиваются для волокна и мясо и таким образом могут быть получены на региональном уровне Альпака местных фермеров, которые могут быть определены через свои веб-сайты или через государственные заводчик ассоциации. Доступны две породы альпак, Сури и Huacaya. Huacaya являются более распространенными и были использованы для этого протокола, но протокол в целом применимы к любой породы и также более широко применяться для других верблюдовых.

Protocol

Все процедуры с альпаки были выполнены в соответствии с протоколами (2017-2627 и 2018-2925) утвержденных Университета Кентукки институциональный уход животных и использование Комитет (IACUC).

1. поколение Альпака антиген специфические антитела

  1. Альпака обработки и общие соображения
    1. Получите соответствующие институциональные и/или регулирующие одобрение.
    2. Получить взрослых альпак, менее чем в 10 лет возраста с телом состоянии балл по крайней мере 3.0 (шкала 1-5)12. Потому что они стадо животных, дом не менее двух, но предпочтительно трех животных вместе.
      Примечание: Мужчины, рекомендуется, потому что, в целом, они имеют более даже темперамент и легче работать с.
    3. Проверьте состояние здоровья животных через ветеринарной экспертизы, включая обзор диеты, жилье, вакцинации и паразит Управление программы13. Убедитесь, что животные находятся в курсе соответствующих местных географического региона, на основе профессиональных рекомендаций ветеринарной вакцинации. Разработать программу управления экто - и endoparasite в консультации с ветеринаром, на основе анализа истории стадо происхождения и13конкретных местных условий.
    4. Акклиматизироваться на по крайней мере одну неделю, включая подготовку Холтер и подверженности сдержанность.
    5. 4 мл пробы крови для получения сыворотки для использования в качестве элемента предварительной иммунизации (см. шаг 1.4). Sera заморозить и хранить при температуре-20 ° C в 0,5 мл аликвоты.
      Примечание: В это время дополнительные крови могут быть приняты для анализа полной клеток крови (CBC) для мониторинга состояния первоначального здоровья животных.
  2. Подготовка антигена
    1. Подготовить очищенный протеин антигенов в фосфат амортизированное saline (PBS) или HEPES-амортизированное saline (ХБС) и сосредоточиться на ≥1 мг/мл. Приблизительно 3 мг белка требуется полный протокол, включая иммунизацию, панорамирование и подтверждения клонов.
      Примечание: Верблюдовые антитела отображать высокая специфичность и избирательности против белков антигенов, но обычно не очень хорошо подходят для неструктурированных белков или пептидные антигены, которые обычно неструктурированные.
    2. Создание чистоты антигена, с чистотой > 90% желаемого. Используйте аналитический метод как SDS-PAGE.
      ОСТОРОЖНОСТЬЮ: Значительное загрязнение с другими белками может привести к проблемам во время выбора где одного домена антитела могут быть изолированы от загрязнений, вместо того, чтобы целевого белка.
    3. Готовить замороженные аликвоты антиген, который содержит в общей сложности 100 мкг антигена. 50 мкл 2 мг/мл препарата является идеальным. 1 мг/мл 100 мкл является наиболее разбавленный раствор белка, подходит для иммунизации. В качестве альтернативы если антиген не может пройти замораживания/оттаивания и известно для быть стабильным в долгосрочной перспективе решение, он может храниться при 4 ° C.
      Примечание: Чтобы убедиться, что антиген может пройти цикл замораживания/оттаивания, теста, которую следует отказаться от 20 мкл Алиготе антигена в тонкой стеной ПЦР-пробирку и оснастки, замороженные в жидком азоте. Оттепель трубки, выполняют высокая скорость центрифугирования и проверить количественные восстановления путем сравнения поглощения УФ-вид до и после замораживания или запустив геля SDS-PAGE. Если это возможно, антиген должен также испытываться для сохранения биологической активности. Если цикл оттаивания замораживание успешно, оставшиеся антигена является оснастки заморожены в 100 мкл аликвоты и хранятся при температуре-80 ° C. Если имеются проблемы с циклом замораживания/оттаивания, протокол может быть повторен с добавлением до 20% глицерина.
  3. Иммунизация
    1. Смешайте до пяти антигенам, 200 мкг каждая, с адъювантом в окончательном объеме между 300-1000 мкл. Адъювант должны составлять ≥50% от окончательного объема с использованием воды в качестве разбавителя.
      Примечание: Если буфер, используйте HEPES, швабры или глицин. РН между 5 и 6 часто оказалась более благоприятным, чем строго нейтральной. Избегайте поливалентная ионы фосфата или цитрат, так как они могут спровоцировать коагуляции.
    2. Подстригать волосы альпаки с Электрические ножницы, в шаблоне полумесяц вдоль основания его шеи от плеча к плечу подвергать в регионах, прилегающих к носовой лимфатических узлов.
    3. Удерживая альпаки шею, медленно внедрять антигена подкожно вдоль основания шеи вблизи бант лимфатических узлов с помощью иглой 22 G. Выполните пять инъекции ~ 200 мкл (или меньше) ~ 5 см друг от друга.
      Примечание: Животные должны сдерживаться второго сотрудника во время инъекции. Инъекций и кровотечение альпак призывает к осторожности, поскольку они склонны к ногами, не только из-за, но боком. Имея животные близко друг к другу, в группе, во время процедур является оптимальным. Учитывая, что они являются стадо животных, они спокойнее в группе и менее сильный сдержанность необходима во время процедур.
    4. Мониторинг животных для инъекций пост ~ 20 мин для признаков анафилаксии (см. шаг 1.6). Монитор для локализованные воспаление на инъекции еженедельно, который не ожидается при использовании рекомендуемых адъюванта. Убедитесь, что утечки крови от места инъекции не является чрезмерным.
    5. Выполните пять последующих повышение инъекции еженедельно с использованием 100 мкг каждая антигена в смеси. Стрижки волос на участках инъекции могут потребоваться каждую неделю в зависимости от сезона. Осенью и зимой волос животных может быстро расти.
  4. Рисунок крови
    1. Клип и лечить сайт коллекции с алкоголем тампоны.
    2. Нежно сдерживать животное с шеи, состоявшейся в вертикальном положении и прямой.
      Примечание: Животные могут удерживаться вручную, как показано в видео. Если возможно, использовать Альпака желоба сдерживать альпак во время кровотечения и инъекции может облегчить обработку. Чтобы использовать парашют Альпака, haltered альпак привели в лоток и сдержанной с шеи баров и ремни с быстрой релизы. Доступны версии Альпака желоба от коммерческих поставщиков.
    3. Используя брюшные проекцию поперечного отростка позвонка как ориентир, загородить Вену, применяя давление просто медиальной вентральной процесса.
      Примечание: Существует без собственный югулярной борозды в взрослых Альпака. Яремной вены находятся под защитой брюшной прогнозы поперечной позвоночного процессов. Этот толстой кожи (например, 1 см толщиной, «борьба плита» над средней 1/3 шеи у самцов) и мускулатура шеи делает его трудно визуализировать или пальпировать яремной сам. Впоследствии использование позвоночных достопримечательности является наиболее полезные показатели югулярной местоположения.
    4. Вставьте иглу под углом 45° слегка медиальной (~ палец ширина) к проекции к центру шеи. Манипулировать иглы до потоки крови.
      Примечание: Яремной вены и сонной артерии находятся близко друг к другу. Венозная кровь может быть довольно красного цвета, но все еще темнее, чем артериальной крови. После завершения сбора, давление должно применяться к сайт для 0,5-1 мин (или дольше, если доступ к сонной артерии) до тех пор, пока заверил гемостаз.
    5. Рисование 4-10 мл крови для аналитических целей. Использовать 1,5 дюйма, иглы 20 G обычно в сочетании с соответствующего размера шприца или пробирки. Используйте лаванды Топ K2ЭДТА трубы для сбора цельной крови, когда очищать лимфоцитов. Используйте золото Топ сыворотки разделение трубы (BD), когда сбор крови для производства сыворотки.
    6. Нарисуйте 50-100 мл крови для производственных целей. Используйте дополнительные вливания 12-дюймовый расширение установлено с 19-20 G крылатый «бабочка» настой.
      Примечание: Расширение набора конфигурации позволяет помощник для заполнения нескольких пробирки, позволяя venipuncturist сосредоточиться на стабилизацию коллекции иглы. Добавление инфузионный набор рассчитан потенциал движения животного (процедура 3-5 мин) и обеспечивает комфортную рабочую дистанцию для операторов.
  5. Иммунной наблюдения
    1. Три-четыре дня после 3rd и 5й инъекции, выполните небольшой тест кровоточить от каждого животного для получения сыворотки для тестирования. Заморозить и хранить sera в 0,5 мл аликвоты. Получение дополнительных крови в то же время для мониторинга состояния здоровья животного, как обсуждалось выше.
    2. Подтвердите наличие антиген специфические антитела, ELISA, используя sera, полученные из теста кровоточит в точках времени предварительно иммунной, три недели и пять недель. Это лучше всего взять окончательного выпуска за обрез, в то время как все еще растет титр антител.
    3. Генерировать антигена сродство пластины с помощью поверхности обработанной 96-луночных пластины. Разбавьте 0,1 мкг антигена в 100 мм карбонат натрия буфера, рН 9,0. Добавить 100 мкл раствора в каждой скважине и инкубировать на ночь при 4 ° C. Десять разведений каждого антигена тестируются в двух экземплярах. Пустой элемент управления хорошо подготовлен, покрытый карбонат только буфера.
    4. После ночи инкубации, инвертировать пластину удалить содержимое скважин и мыть три раза с 0,1 мл PBS, 0.1% 20 анимации (PBS-T).
    5. Блокировать скважин, добавляя 0,1 мл (5 мг/мл) BSA в PBS-T и инкубации пластину за 1 ч при комнатной температуре.
    6. Промойте пластины три раза с PBS-T закупорить промывочного раствора в скважину и удаляя промывочный раствор путем инверсии пластины.
    7. Подготовка два раза серийных разведений 0,3 мл каждый из предварительно иммунитета и иммунной сыворотки в буфере PBS-T с помощью начального разбавления 1/100 и до 1/102, 400.
    8. 100 мкл каждого разведения к скважинам и позволяют Проинкубируйте втечение 2 ч при комнатной температуре.
    9. Удаление сыворотки из каждой скважины и мыть с 0,2 мл PBS-t три раза.
    10. Инкубировать каждый хорошо с 0,1 мл HRP-конъюгированных коза анти ламы IgG антител при разбавлении топографической за 1 час.
      Примечание: Иммунный ответ измеряется включает в себя как обычных, а также тяжелые цепи только антитела, которые присутствуют в примерно равные показатели в обращении3,14.
    11. Удалить раствор антител и мыть каждый хорошо с 0,2 мл PBS-t в три раза.
    12. 100 мкл пероксидазы Хромогенный субстрат в колодец и инкубации при комнатной температуре до тех пор, пока интенсивность двух высоких точек концентрации насыщения, которые обычно занимает 5-10 мин.
    13. Добавьте 100 мкл 0,1 М серной кислоты в каждой скважине для остановки реакции.
    14. Измерение поглощения каждой скважины на 450 Нм, с помощью пластины читателя.
    15. Участок поглощения как функция концентрации.
  6. Альпака мониторинга и потенциальные осложнения
    1. Обеспечить надлежащие Альпака, мониторинг во всей процедуре.
      Примечание: Процедуры не ожидается вызывать серьезные неблагоприятные последствия. Здоровья и благополучия животных должен контролироваться ежедневно животноводства и/или исследований персонала во время кормления и поения. Любое животное с unalleviated экспериментально индуцированной или спонтанных естественных заболеваемости должны передаваться для оценки ветеринарных служб с место, предоставляет в соответствующих случаях, до гуманного эвтаназии, при необходимости.
      Потенциальные негативные последствия, связанные с кровопускания являются кровотечение, ушибы и гематомы. Животные должны быть проверены на 20 мин пост крови обратить искать признаки кровотечения. Следует использовать дополнительное давление на сайтах. Если кровотечение не прекращается, ветеринар должен быть контакт.
      Другие потенциальные негативные последствия, связанные с инъекциями и кровотечение включают формирование гранулемы и воспаления. Гранулема формирования не предполагается и не наблюдалось в университете Кентукки. Инъекции сайте воспаления (покраснение или припухлость) может произойти и должно быть обращено внимание ветеринара. Обрез производства представляет собой потенциально значительный объем крови, и животные должны контролироваться заверить, что они являются стабильными и активной после забора крови.
      Анафилаксия и пирогенных ответы являются двумя наиболее вероятно серьезные негативные последствия, но очень редко соблюдаются. Если это происходит, анафилаксия произойдет вскоре после инъекции антигена и проявляется увеличением ректальной температуры, слабость, рвота, проблемы с дыханием или диарея. Ректальной температуры может отслеживаться после каждой инъекции для обнаружения любого увеличения температуры тела. Если они признаются, уведомите ветеринар немедленно для консультации. Кроме того аварийный «Crash комплект» (например, адреналин, кортикостероиды и антигистаминный препарат) подготовила в консультации с ветеринаром должны быть доступны для лечения животных, подозреваются неблагоприятные реакции.

2. Очищение лимфоцитов для одного домена антитела библиотека строительства

  1. Соберите 50 мл крови три-пять дней после последней инъекции (см. шаг 1.4).
    Примечание: Быстрая обработка крови и изоляции РНК имеет важное значение для получения подходящей библиотеки размер15,3, что является очень важным для успеха панорамирование.
  2. Развести 15 мл с 5 мл PBS собранной крови.
  3. Используйте трубу разделения лимфоцитов изолировать лимфоцитов периферической крови (PBLs), плотность градиентного центрифугирования согласно производит предложения.
    ОСТОРОЖНОСТЬЮ: Инструкции производителя указывают, что до 25 мл крови могут быть использованы, но это может насытить системы и предотвращения получения чистой лимфоцитов препарат.
  4. Добавьте 5 мл PBS, prechilled до 4 ° C до ПБЛ.
  5. Спина на 20 мин в 800 x g при 4 ° C.
  6. Мыть два раза, добавив 5 мл PBS, prechilled до 4 ° C до ПБЛ последующим центрифугированием на 20 мин в 800 x g при 4 ° C.
  7. Изолируйте всего РНК с помощью спин столбца на основе системы, согласно инструкциям производителя. Однородный клетки, vertexing в соответствующий буфер и применяя систему измельчения биополимера. Используйте соответствующее количество мини и макси столбцы, основанные на ячейку ввода.
  8. Синтез cDNA, с помощью обратной транскриптазы, объединяя 10 мкг РНК с сочетанием 0,1 мкг Oligo (dT) 12-18 грунтовки.
  9. Создания библиотеки бактериофага, используя установленные методы4. Это включает клонирование с энзимами ограничения в Фаговые отображения векторных pMES4 следуют выражение insert сливается с Джин III нитчатые ФАГ для производства раствора ФАГ.

3. одного домена антитела панорамирование

  1. Производят антигена сродство пластины с помощью поверхности обработанной 96-луночных пластины. Разбавьте 0,25 мкг антигена в 100 мм карбонат натрия буфера, рН 9,0. Добавить 100 мкл этого решения в каждой скважине и инкубировать на ночь при 4 ° C. Герб две скважины на антиген. Подготовьте пустой элемент управления хорошо, покрытый карбонат только буфера.
    Примечание: Пластины могут быть произведены и хранятся до одной недели при температуре 4 ° C, если будет выполнено несколько раундов выделения. Кроме того этот метод использует Прямая абсорбция, которая не требует маркировки в то время как другие методы используют biotinylation или другие виды маркировки стратегии.
  2. Инкубируйте пластину на ночь. Инвертировать удалить содержимое скважин и мыть три раза с 0,1 мл PBS-t.
  3. Блокировать скважин, добавляя 0,1 мл BSA (20 мг/мл) в PBS и инкубации пластину для 2 ч при комнатной температуре.
  4. Вымойте тарелку три раза с PBS-T следуют три раза с PBS. Антигены могут также ковалентно помечены и используется в системах улавливания таких, к примеру, стрептавидина/биотина систем.
  5. Предварительно лечения Бактериофаг решение (100 мкл) с 100 мкл 40 мг/мл BSA в PBS на вибрирующей платформе при комнатной температуре за 30 мин.
  6. Добавьте решение фага к антигену покрытием скважин и проинкубируйте с нежным агитации за 2 ч при комнатной температуре. Используйте несколько скважин с целью обеспечить в общей сложности 1011 Фаговые для каждого антигена.
  7. Отказаться от несвязанных фага, инверсии, а затем вымыть колодцы пять раз с 200 мкл PBS-T, а затем пять раз с PBS.
  8. Элюировать привязанного фага, добавив 0,1 мл 0,25 мг/мл трипсина в PBS и инкубировать в течение 30 мин при комнатной температуре на вибрирующей платформе 700 об/мин.
  9. Решение передать флакон с 5 мкл 4 мг/мл 4-benzenesulfonyl фторид hydrochloride(AEBSF) решения для утоления активности трипсина.
  10. Расти TG1 Фаговые дисплей сведущие клетки при 37 ° C при встряхивании до од600 = 0.5.
  11. Добавьте 50 мкл eluted Фаговые 3 мл TG1 клеток.
  12. Инкубируйте при 37 ° C без встряхивания в течение 30 мин.
  13. Добавление 7 мл LB СМИ, дополняется 100 мкг/мл ампициллин, 2% раствор глюкозы.
  14. На ночь погрозит 37 ° C.
    Примечание: Для получения самых различных антител одного домена, клоны можно виртуализировать, тестирование на желаемые свойства и использовать после одного раунда панорамирования. Для получения высоких сродства антител одного домена, следует использовать два раунда панорамирование.
  15. Пластина бактерии, после ночи роста на плитах агара LB дополнена 100 мкг/мл ампициллин, 2% раствор глюкозы. Несколько серийных разведений нужно будет испытываться, начиная с двух растворов, покрытие 100 мкл 1/10 000 и 1/100 000 разведениях.
  16. Инкубировать пластину на ночь при 37 ° C.
  17. Выберите колоний и прививать скважин стерильные 96-луночных пластины, содержащей 100 мкл 2XYT с 100 мкг/мл ампициллин, 2% раствор глюкозы 10% v/v глицерина в хорошо.
  18. Инкубируйте на ночь при 37 ° C без встряхивания.
  19. Следующий день, поколебать на 170 об/мин при 37 ° C 60 мин.
  20. Удалите 2 мкл СМИ в ПЦР-пробирки. Оставшийся раствор может оставил в пластине и хранить при 4 ° C для 1-2 дней или замороженных и температуре-80 ° C для последующего использования.
  21. Выполняйте реакции PCR с праймерами для вектора использованы. Для pMES4 скрининг PCR праймеров использует положительных клоны, которые обрамляют несколько клонирования сайта являются CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC и GGTGGTGTGAGGAGACGGTGACCTG. Используйте Велоспорт соответствующие условия для полимеразы, отжига температура 57 ° C и 30 циклов.
  22. Анализ реакции PCR, запустив гель агарозы 1% (w/v). Колоний, которые являются положительными у одного домена антитела гена вставки ~ 500 bp. обеспечить позитивные клоны 20-50% выборки.
    Примечание: Этот метод предоставляет средства для клона, отбора и анализа, которые могут быть выполнены в большинстве исследовательских лабораториях. Кроме того секвенирование нового поколения может быть применен и обеспечивает большие наборы данных, которые позволяют статистической и сравнительный анализ16.
  23. Прививать положительные клоны от пластины в свежие пробирки, содержащие 7 мл фунтов с 100 мкг/мл ампициллина.
  24. Расти с встряхивания для ночлега на 37 ° C.
  25. Выполните алкалический на культуру для получения плазмида ДНК.
  26. Последовательность положительных клоны с использованием стандарта последовательность праймера pEX-Rev (CAGGCTTTACACTTTATGCTTCCGGC).
  27. Выполните Вычислительный анализ на антитела последовательности одного домена. Убедитесь, что есть нет стоп-кодонов или смены кадра.
  28. Классифицируйте последовательности для подобия и разнообразия. Последовательности, которые неоднократно идентифицируются, скорее всего, будет высоким сродством привязки последовательности, особенно после двух раундов выделения.
  29. Экспресс антител одного домена, с помощью BL21-производные выражение штамм E. катушки. Побудить выражение путем добавления ИПТГ, растущих на ночь в 22 ° C.
  30. Очищение антитела один домен, с использованием иммобилизованных металла аффинной хроматографии (ИАЦ).
  31. Проверка одного домена антитела/antigen привязки с помощью прямого взаимодействия пробирного как выпадающее, родной гель-электрофорез, или ELISA.
  32. Проверьте производительность антитела один домен приложения, необходимые для конкретного эксперимента.

Representative Results

Протокола, представленные здесь, была использована для создания одного домена антитела против ряда белков антигенов. Пяти антигенам использовались за Альпака. Иммунные мониторинг указал, что большинство антигенов показал начала надежный ответ на три недели (рис. 1). Кровоточит производство и строительство библиотеки после примерно шесть недель дает наилучший баланс для животных, имеют несколько антигенов вводили. Два раунда панорамирование были выполнены для каждой антигена и изолированные колонии экранированные (рис. 2). Последовательность положительных колоний выявлены антитела последовательности различных одного домена для различных антигенов. Для примеров три уникальных клоны были изолированы для ссылки антигена мальтоза привязки белка (MBP) (рис. 3A). Как часто отмечалось, антител одного домена содержат значительные последовательности разнообразия и высоко переменной длины CDR3 (рис. 3). Эти возможности особенно важны в один домен антитела/antigen взаимодействия как в ссылку одного домена антитела/CX3CL1 комплекс17 (рис. 3B).

Большинство из полнометражных один домен антитела последовательностей можно выразил и очищенная на 1-10 мг/Л культуры (рис. 4A). В силу разнообразия CDR3 длиной различные одного домена антитела показывают небольшие различия в молекулярном весе. Подтверждение о прямой привязки и производительности конкретного приложения имеет решающее значение. Например после двух раундов выделения против антигена B, группа одного домена антитела были определены (рис. 2). Были выявлены несколько идентичных последовательностей, и антитела один домен был подготовлен и очищается. Затем была протестированы через прямой тянуть вниз с антигена сродство смолы и показал надежную дозозависимый привязки (рис. 4B). Важно отметить, что одного домена антитела показал не привязки для управления смолы. Эти данные свидетельствуют о прямой привязки взаимодействия и один, который хорошо подходит для захвата сходства в раскрывающемся списке и на основе ELISA форматах.

Figure 1
Рисунок 1 : Представитель иммунной наблюдения двух различных антигенов, показывая значительные специфического иммунного ответа на различные антигены в то же самое животное. Многие антигены показывают надежный ответ через три недели после начала иммунизации, с большинством показаны максимальные ответ после шести недель в кратчайшие сроки. Шесть недель также позволяет для созревания близость и рекомендуемое время для производства обрез и B-клетки изоляции. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 : На основе ПЦР подтверждение позитивного клонов. Праймеры охватывают MCS pMES4 вектора, и позитивные наночастицы клон производит ампликон ~ 500 bp (отмеченные *). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3 : Антиген специфические последовательности выделить Альпака одного домена антитела разнообразия. (A) выравнивание выберите один домен антитела последовательности изолированных к MBP с ссылкой одного домена антитела 4XT1, рамки и взаимодополняемости определение регионов (Kabat) ниже. (B) структура Альпака одного домена антитела 4XT1 привязан к CX3CL1 (PDB 4XT1), подчеркивая важнейшую роль переменной CDR петли в привязке специфического антигена. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4 : Очистка и проверка одного домена антител. (A) SDS-PAGE IMAC очищенного однодоменная антител, сравнивая различные одного домена антитела. Различных молекулярных масс, главным образом из-за различной длины CDR3 цикла. Также наблюдаются различные уровни выражения, с меньшинством антител одного домена, показаны плохие урожаи очищенный протеин. (B) проверка прямой привязки с помощью сродство антигена раскрывающемся списке. Надежные дозозависимый одного домена антитела связывая наблюдается с антигеном в сочетании смолы, но не с управления смолы. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Discussion

Как отмечалось, высокое сродство и специфичность антител одного домена, в сочетании с их легким выражение и стабильности, делают их идеальным реагентов для приложений в биомедицинских исследований, как критические биохимические реагенты, диагностические средства, или терапевтические18. Для коммерческих приложений есть некоторые вопросы, касающиеся интеллектуальной собственности, которые должны быть рассмотрены. Кроме того одного домена антитела могут быть спроектированы содержат конкретные маркеры или теги, которые могут использоваться в качестве репортеров в клеточном анализов или диагностики. Ключ для этих целей является способность производить конкретные один домен антител против антигенов интерес. Описан метод здесь производить антитела одного домена с помощью альпак, который производит надежные иммунный ответ против широкий спектр белков антигенов. Описываются вопросы для обработки животных и соответствия нормативным требованиям. Они являются ключевыми для успеха в этой части процесса.

Есть другие стратегии для производства одного домена антитела, которые не требуют иммунизации, но вместо этого использовать полусинтетические библиотеки с различными системами для отбора и итеративной оптимизации сходства19,20 . Однако преимущество использования библиотек, производный от привитых животных является способность надежно изолировать антитела высоко обогащенного, разнообразной и высокоспецифичные одного домена. Кроме того, не только наблюдаются значительные последовательности вариации, но значительное большинство конкретных одного домена антитела изолированные уникальный вставок и удалений, особенно в CDR3.

Кроме того, одного домена антитела могут быть произведены через простой процесс, который требует только малые инъекции антигена и после этого процесса, животные могут быть возвращены в стадо. Следует отметить животное может свободно использоваться для производства волокна, но должны быть исключены из использования как мясо (человека пищевой цепи) за счет использования теста антигены и не FDA утвержденных адъювант для производства антител одного домена. Когда процедура завершена, животных должны контролироваться на одну неделю, учитывая ветеринарный экзамен и затем можно вернуть их домой ферме или отдыхал за шесть месяцев до очередной раунд антител одного домена.

Disclosures

DRS. Whiteheart и Hersh в университете Кентукки и работать ядро в центре молекулярной медицины, которая производит антитела один домен в Альпака как плату за службу.

Acknowledgments

Эта работа была поддержана национальных институтов здравоохранения (P30GM103486).

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
Иммунизации альпаки (<em>лама pacos</em>) с белков антигенов и производства антиген специфические антитела одного домена
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter