Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Inmunización de Alpacas (Lama pacos) con antígenos de la proteína y la producción de anticuerpos de dominio único antígeno específico

doi: 10.3791/58471 Published: January 26, 2019

Summary

Un método para la producción de anticuerpos de dominio único de alpacas, incluyendo vacunación, recolección de sangre, células B aislamiento y selección se describe.

Abstract

En este manuscrito, un método para la inmunización de alpaca y el uso de métodos de biología molecular para producir anticuerpos de dominio único antígeno-específica es descrito y demostrado. Camélidos, alpacas y llamas, se han convertido en un recurso valioso para la investigación biomédica ya que producen un nuevo tipo de anticuerpo sólo cadena pesado que puede utilizarse para producir anticuerpos de dominio único. Porque el sistema inmune es altamente flexible, anticuerpos de dominio único se pueden hacer a muchos antígenos proteicos diferentes y hasta diferentes conformaciones del antígeno, con un alto grado de especificidad. Estas características, entre otros, hacen anticuerpos de dominio único una herramienta invaluable para la investigación biomédica. Se divulga un método para la producción de anticuerpos de dominio único de alpacas. Se describe un protocolo para la vacunación, recolección de sangre y aislamiento de células B. Las células de B se utilizan para la construcción de una biblioteca inmunizada, que se utiliza en la selección de anticuerpos de dominio único específico vía panorámica. Anticuerpos de dominio único específico supuesto obtenidos vía panorámica son confirmados por pull-down, ELISA y ensayos de cambio de gel. Los anticuerpos de dominio único que pueden utilizarse directamente o como parte de un reactivo de ingeniería. El uso de anticuerpos de dominio único y regentes basados en anticuerpos de dominio único incluye aplicaciones estructurales, bioquímicas, celulares, en vivo y terapéuticas. Anticuerpos de dominio único se pueden producir en grandes cantidades como proteínas recombinantes en sistemas de expresión procariotas, purificados y utilizados directamente o pueden ser diseñados para contener marcadores específicos o etiquetas que pueden usarse como reporteros en estudios celulares o en diagnóstico.

Introduction

Alpacas y otros miembros de la familia de los camélidos, se han convertido en una fuente popular para generar anticuerpos para investigación biomédica1,2,3. Camélidos tienen un sistema inmunológico único que producen anticuerpos normales así como de la pesado-cadena sólo los anticuerpos que permiten la producción de anticuerpos de dominio único mucho más pequeños, manteniendo alta especificidad y alta afinidad. Anticuerpos de camélidos ofrecen un reactivo versátil útil para una variedad de propósitos. Aquí se describe un método para inmunizar alpaca y producir anticuerpos de dominio único a una variedad de antígenos de la proteína. Estos anticuerpos se pueden producir en camélidos a través de un proceso relativamente sencillo que sólo requiere la inmunización a través de pequeñas inyecciones de la proteína diana (antígeno) y un drenaje de sangre4. Posteriormente, construcción de biblioteca, M13 phage display5 y panorámica frente el antígeno recombinante6 se utiliza para aislar y producir anticuerpos de dominio único con las características deseadas. Porque el proceso toma ventaja del poder de la tecnología de visualización de fagos, cinco o más antígenos se pueden utilizar simultáneamente por animal, reduciendo el número de animales utilizados y los costes asociados.

Típico mamíferos anticuerpos o inmunoglobulinas son moléculas grandes que consisten en dos tipos de cadenas (2 cadenas pesadas y 2 cadenas ligeras), que se unen por enlaces disulfuro. Estos anticuerpos son relativamente grandes, que los pesos moleculares de ~ 140-190 kDa para la especie más abundante de IgG de los seres humanos, ratones, cabras y conejos. Debido a su estructura de multi-subunidades, alto peso molecular y enlaces disulfuro, las inmunoglobulinas pueden ser algo difíciles de producir en grandes cantidades, haciendo su costo alto. En la década de 1990, se descubrió que hacen camélidos, que incluyen camellos, llamas y alpacas, además de la inmunoglobulina de tipo mamífero típico, una forma nueva de la inmunoglobulina que es más simple en estructura, que poseen cadenas pesadas solamente7. Estos anticuerpos únicos camélidos poseen la misma capacidad para atar específicamente sustancias extrañas con alta afinidad, pero sólo se componen de una proteína de cadena8. Además, camélidos anticuerpos pueden truncarse experimentalmente a un fragmento de unidad la VHH aún más pequeño, que también se llama un dominio único anticuerpo9. Debido a su pequeño tamaño, anticuerpos de dominio único son útiles para una amplia gama de aplicaciones de la investigación biomédica y están disponibles en una variedad de fuentes académicas y comerciales1,10. Una excepción parece ser el borrar occidental ya que anticuerpos de dominio único más a menudo dirigidos contra epitopos dependiente de conformación, que generalmente se pierden en las condiciones de desnaturalización en manchas blancas /negras occidentales.

Puesto que se componen de una cadena polipeptídica única, anticuerpos de dominio único específico pueden ser seleccionados y producidos fácilmente en cantidades grandes como proteínas recombinantes en bacterias. Anticuerpos de dominio único también pueden ser genéticamente modificados para contener marcadores específicos o etiquetas que pueden ser utilizadas como "grupos de reportero" para diagnosticar enfermedades11. Esta facilidad de manipulación junto con su flexibilidad de uso hace anticuerpos de dominio único un recurso importante para los investigadores en universidades y otros lugares.

Como parte de un Instituto Nacional de salud base, los métodos existentes se han adaptado a producir anticuerpos de dominio único de alpacas3,4. Alpacas tienen ventajas significativas en tanto facilidad de manejo en relación con los más grandes miembros de la familia camélidos así como accesibilidad. Alpacas se crían extensamente para la fibra y carne y así pueden obtenerse regionalmente de los agricultores locales de alpaca, que pueden ser identificados a través de sus sitios web o a través de asociaciones de criadores de estado. Existen dos razas de alpacas Suri y Huacaya. Huacaya son más comunes y utilizados para este protocolo, pero el protocolo es generalmente aplicable a cualquiera de los dos razas y también más ampliamente aplicable a otros camélidos.

Protocol

Todos los procedimientos con las alpacas fueron realizados según protocolos (2627 2017 y 2018-2925) aprobados por la Universidad de Kentucky institucional cuidado Animal y el Comité uso (IACUC).

1. generación de anticuerpos antígeno específicos Alpaca

  1. Manejo de la alpaca y consideraciones generales
    1. Obtener la aprobación institucional y regulador apropiado.
    2. Obtener alpacas adultas, menos de 10 años de edad con un cuerpo condición puntuación de por lo menos 3.0 (escala 1-5)12. Porque son animales de manada, de la casa un mínimo de dos, pero preferiblemente tres animales juntos.
      Nota: Los machos se recomiendan porque, en general, tienen un temperamento más y son más fáciles de trabajar con.
    3. Comprobar el estado de salud de los animales a través de un examen veterinario incluyendo la revisión de la dieta, vivienda, vacunación y control de parásito programas13. Asegúrese de que los animales estén al día con las vacunas correspondientes a la región geográfica local en base a recomendaciones de veterinarias profesionales. Desarrollar un programa de control de ecto y endoparásitos en consulta con un veterinario basado en una revisión de la historia de la manada de origen y las condiciones locales específicas13.
    4. Aclimatación de por lo menos una semana, incluyendo formación de halter y exposición al sistema de seguridad para.
    5. Recoger una muestra de 4 mL sangre para obtener suero para uso como control de inmunización previa (véase el paso 1.4). Los sueros de congelar y almacenar a-20 ° C en alícuotas de 0.5 mL.
      Nota: En este momento, se puede tomar sangre adicional para que el análisis de células de sangre completo (CBC) supervisar el estado de salud inicial de los animales.
  2. Preparación del antígeno
    1. Preparación de antígenos de la proteína purificada en tampón fosfato salino (PBS) o solución salina tamponada con HEPES (HBS) y concentrado a ≥1 mg/mL. Aproximadamente 3 mg de la proteína es necesaria para el protocolo completo, incluida la inmunización, la panorámica y la confirmación de clones.
      Nota: Anticuerpos de camélidos Mostrar la alta especificidad y selectividad contra antígenos de la proteína pero generalmente no son adecuados para proteínas o antígenos péptidos que son generalmente no estructurados.
    2. Establecer la pureza del antígeno, con pureza > 90% deseado. Utilizar un método analítico como SDS-PAGE.
      PRECAUCIÓN: Contaminación significativa con otras proteínas puede conducir a problemas durante la selección donde se puede aislados contaminantes en lugar de la proteína diana anticuerpos de dominio único.
    3. Preparar alícuotas congeladas de antígeno que contiene un total de 100 μg de antígeno. 50 μl de una preparación de 2 mg/mL es ideal. 100 μl de 1 mg/mL es la solución más diluida de proteína adecuada para la inmunización. Alternativamente, si el antígeno no se someten a congelación/descongelación y se sabe para ser estable a largo plazo de solución, se puede almacenar a 4 ° C.
      Nota: Para asegurar que el antígeno puede someterse a un ciclo de congelamiento/descongelamiento, prueba que una alícuota de 20 μl del antígeno se debe dispensar en un fino pared tubo PCR y el resorte congelado en nitrógeno líquido. Descongelar el tubo, realizar la centrifugación de alta velocidad y verificar la recuperación cuantitativa mediante la comparación de absorción UV/VIS antes y después de la congelación o mediante la ejecución de un gel de SDS-PAGE. Si es posible, el antígeno también debe ser evaluado para la retención de la actividad biológica. Si el ciclo de deshielo de congelamiento es exitoso, el antígeno restante es complemento congelado en alícuotas μl 100 y se almacenó a-80 ° C. Si hay problemas con el ciclo de congelamiento/descongelamiento, el protocolo puede repetirse con la adición de hasta un 20% glicerol.
  3. Inmunización
    1. Mezcla hasta cinco antígenos, 200 μg cada una, con adyuvante en un volumen final de entre 300 a 1.000 μl. El ayudante debe constituir ≥50% del volumen final con agua como diluyente.
      Nota: Si el búfer es necesario, utilice HEPES, fregonas o glicina. Un pH entre 5 y 6 ha demostrado a menudo para ser más favorable que estrictamente neutral. Evitar polivalentes iones como fosfato o citrato, ya que pueden provocar la coagulación.
    2. Recorte el pelo de la alpaca con cortauñas eléctricos, en forma de media luna a lo largo de la base de su cuello de hombro a hombro para exponer a las regiones adyacentes a los ganglios linfáticos de arco.
    3. Sostiene la alpaca por el cuello, inyecte lentamente el antígeno por vía subcutánea a lo largo de la base de la nuca cerca de los nodos de linfa de arco usando una aguja de 22 G. Realizar cinco inyecciones de ~ 200 μl (o menos) ~ 5 cm de separación.
      Nota: Los animales deben ser refrenados por un segundo miembro del personal durante las inyecciones. Inyección y sangrado alpacas requiere precaución ya que son propensos a patadas, no solo desde atrás pero hacia los lados. Tener los animales cerca uno del otro, en un grupo, durante el procedimiento es óptimo. Ya que son animales de manada, son más tranquilos en un grupo y menos vigorosa contención es necesaria durante los procedimientos.
    4. Monitorear los animales para ~ 20 min después de la inyección para detectar signos de anafilaxia (ver paso 1.6). Monitor de inflamación localizada en los sitios de inyección semanal, que no se espera al utilizar el coadyuvante recomendado. Asegúrese de que la fuga de sangre desde el sitio de inyección no sea excesiva.
    5. Realizar cinco inyecciones de refuerzo posterior semanal con 100 μg de cada antígeno en la mezcla. Recorte de pelo en los sitios de inyección pueden requerir semanalmente dependiendo de la temporada. En otoño e invierno, pelo de los animales puede crecer rápidamente.
  4. Sangre de dibujo
    1. Clip y desinfectar el sitio de colección con hisopos de alcohol.
    2. Sujetar al animal suavemente con el cuello sostenido erguido y recto.
      Nota: Los animales pueden ser refrenados manualmente como se muestra en el video. Si está disponible, el uso de un conducto de alpaca para refrenar las alpacas durante el sangrado y las inyecciones pueden facilitar el manejo. Para utilizar un conducto de alpaca, alpacas haltered condujo en el conducto y refrenados con cuello y correas con lanzamientos rápidos. El conducto de alpaca están disponibles de proveedores comerciales.
    3. Usando la proyección ventral de las apófisis transversas de las vértebras como una señal, ocluir la vena aplicando presión justo medial al proceso ventral.
      Nota: No hay ningún surco yugular distinto en alpaca adulto. Las venas yugulares están protegidas por las proyecciones ventrales de los procesos vertebrales transversales. Esta piel gruesa (por ejemplo, 1 cm de espesor "lucha contra la placa" sobre el 1/3 medio del cuello en los machos) y musculatura del cuello hace que sea difícil visualizar o palpar la vena yugular sí mismo. Posteriormente, el uso de hitos vertebrales es los indicadores más útiles de ubicación yugular.
    4. Inserte la aguja en un ángulo de 45° ligeramente medial (~ ancho del dedo) a la proyección hacia el centro del cuello. Manipular la aguja hasta que la sangre fluya.
      Nota: La vena yugular y arteria carótida están cerca uno del otro. Sangre venosa puede ser muy de color roja pero es aún más oscura que la sangre arterial. Después de la colección, se debe aplicar presión al sitio de 0.5-1 minutos (o más si se tiene acceso a la carótida) hasta que se asegura la hemostasia.
    5. Dibujar 4-10 mL de sangre con fines analíticos. Utilizar un 1,5 pulgadas, aguja de 20 G por lo general en conjunción con una jeringa de tamaño apropiado o tubo de la colección de sangre. Utilizar tubos de EDTA tapa K2de lavanda para recoger la sangre cuando los linfocitos de la purificación. Utilizar tubos de separación de suero superior oro (BD) al recoger la sangre para la producción de suero.
    6. Dibujar 50-100 mL de sangre para la producción. Utilice una extensión adicional de 12 pulgadas de infusión con un juego de infusión alado de 19-20 G "mariposa".
      Nota: Una configuración de conjunto de extensión permite un asistente llenar varios tubos de sangre, lo que permite la venipuncturist concentrarse en estabilizar la aguja de la colección. La adición de la infusión acomoda movimiento potencial del animal (procedimiento de 3-5 min) y da una confortable distancia de trabajo para los operadores.
  5. Seguimiento inmunológico
    1. Tres o cuatro días después de la 3rd y 5 inyecciones deth , realizar un sangrado pequeño prueba de cada animal para obtener sueros para pruebas. Congelar y almacenar el suero en alícuotas de 0.5 mL. Obtener muestras de sangre adicional a la vez para monitorear la salud del animal, como hemos comentado anteriormente.
    2. Confirmar la presencia de anticuerpos específicos de antígenos por ELISA usando los sueros obtenidos de la prueba de sangra en momentos pre-inmune, tres semanas y cinco semanas. Es mejor tomar una purga final mientras sigue aumentando el título del anticuerpo.
    3. Generar placas de afinidad antígeno con superficie tratadas placas de 96 pocillos. Diluir 0.1 μg del antígeno en tampón de carbonato de sodio de 100 mM, pH 9.0. Añadir 100 μl de la solución en cada pocillo e incubar durante la noche a 4 ° C. Diez diluciones de cada antígeno se analizan por duplicado. Un control en blanco bien es preparado que está revestida con tampón de carbonato solamente.
    4. Después de la incubación durante la noche, invertir la placa para eliminar el contenido de los pocillos y lavar tres veces con 0,1 mL de PBS, 0,1% Tween 20 (PBS-T).
    5. Bloquean los pozos agregando 0,1 mL de BSA (5 mg/mL) en PBS-T y incubar la placa por 1 h a temperatura ambiente.
    6. Lave la placa tres veces con PBS-T pipetear la solución de lavado en el pozo y la solución de lavado por la inversión de la placa.
    7. Preparar diluciones seriadas dobles de 0,3 mL de cada uno de los sueros previamente inmunes e inmunes en el tampón de PBS-T utilizando una dilución inicial de 1/100 y hasta 1/102, 400.
    8. Añada 100 μl de cada dilución a los pocillos y dejar para incubar por 2 h a temperatura ambiente.
    9. Retire el suero de cada bien y lavar con 0,2 mL de PBS-T tres veces.
    10. Incubar cada uno con 0,1 mL de anticuerpo de IgG anti-llama cabra conjugado con HRP en una dilución de 1: 20.000 para 1 h.
      Nota: La respuesta inmune medida incluye tanto convencionales así como de la pesado-cadena solos anticuerpos, los cuales están presentes en proporciones aproximadamente iguales en circulación3,14.
    11. Retirar la solución de anticuerpo y lavar cada pozo con 0,2 mL de PBS-T tres veces.
    12. Añadir 100 μl de sustrato cromógeno de la peroxidasa al pozo e incubar a temperatura ambiente hasta que la intensidad de los dos puntos de concentración más altos han saturado, que generalmente toma 5-10 minutos.
    13. Añadir 100 μl de ácido sulfúrico de 0,1 M a cada pozo para detener la reacción.
    14. Medir la absorbancia de cada pocillo a 450 nm utilizando un lector de placas.
    15. Represente la absorbancia como una concentración de la función.
  6. Alpaca monitoreo y posibles complicaciones
    1. Asegúrese de alpaca adecuado monitoreo durante todo el procedimiento.
      Nota: Los procedimientos no deben causar efectos adversos significativos. Salud y el bienestar animal deben vigilarse diariamente por el personal de producción o investigación durante la alimentación y riego. Cualquier animal con morbosidad natural inducida experimentalmente o espontánea, unalleviated debe ser referido para la evaluación de servicios veterinarios con tratamientos como adecuados hasta eutanasia humanitaria, si es necesario.
      Potenciales consecuencias adversas asociadas con flebotomía son sangrado, contusión y hematoma. Los animales deben ser supervisados para que 20 min post sorteo de sangre buscar signos de sangrado. Puede usarse la presión adicional en los sitios. Si el sangrado no se detiene, debe contactar un veterinario.
      Otras consecuencias adversas potenciales asociados con las inyecciones y hemorragia incluyen inflamación y formación de granulomas. Formación de granulomas no se espera y no se ha observado en la Universidad de Kentucky. Inflamación del sitio de inyección (enrojecimiento o inflamación) puede ocurrir y debe ser traída a la atención de un veterinario. El sangrado de producción representa un volumen potencialmente significativo de sangre, y los animales deben ser supervisados para asegurarse de que son estables y activos después de la recolección de sangre.
      Anafilaxia y respuestas pirogénicas son las dos consecuencias adversas graves probablemente, pero se observan muy raramente. Si llegara a ocurrir, anafilaxia se produciría poco después de las inyecciones de antígeno y se manifiesta por un aumento en la temperatura rectal, debilidad, vómitos, problemas respiratorios y diarrea. Puede monitorizar temperatura rectal después de cada inyección para detectar cualquier aumento en la temperatura corporal. Si se reconocen, notifique a un veterinario inmediatamente para una consulta. Además, un "Crash Kit de la emergencia" (p. ej., epinefrina, corticosteroides y antihistamínicos) preparado en consulta con un médico veterinario debe estar disponible para tratar a los animales sospechados de tener una reacción adversa.

2. purificación de linfocitos para construcción de biblioteca de anticuerpos de dominio único

  1. Recoger 50 mL de sangre de tres a cinco días después de la última inyección (ver paso 1.4).
    Nota: Rápido procesamiento de la sangre y el aislamiento de ARN es importantes para obtener un tamaño de biblioteca adecuado15,3, que es muy importante para el éxito de la panorámica.
  2. Diluir 15 mL de la sangre recogida con 5 mL de PBS.
  3. Utilizar un tubo de la separación de linfocitos para aislar los linfocitos de sangre periférica (PBL) mediante la centrifugación de gradiente de densidad según sugerencias de la fabrica.
    PRECAUCIÓN: Las instrucciones del fabricante indican que puede utilizarse hasta 25 mL de sangre, pero esto puede saturar el sistema y evitar la obtención de una preparación de linfocitos limpio.
  4. Añadir 5 mL de PBS prechilled a 4 ° C a PBL.
  5. Vuelta por 20 min a 800 x g a 4 ° C.
  6. Lavar dos veces añadiendo 5 mL de PBS prechilled a 4 ° C a PBL seguido por centrifugación durante 20 min a 800 x g a 4 ° C.
  7. Aislar ARN total usando un sistema de centrifugado-columna base, según las instrucciones del fabricante. Homogeneizar las células por vertexing en tampón adecuado y aplicar un sistema de trituración de biopolímero. Utilizar un número adecuado de mini o maxi-columnas en la pila de entrada.
  8. Sintetizar el cDNA utilizando transcriptasa inversa mediante la combinación de 10 μg de ARN con una mezcla de 0.1 μg de Oligo (dT) 12-18 cartillas.
  9. Generar una biblioteca de bacteriófago usando métodos establecidos4. Se trata de clonación con enzimas de restricción en el phage display vector pMES4 seguido de la expresión de la inserción fusionada al gen III de los fagos filamentosos para la producción de la solución de fago.

3. dominio de un solo anticuerpo panorámica

  1. Placas de afinidad producir antígeno con superficie tratan placas de 96 pocillos. Diluir 0,25 μg del antígeno en tampón de carbonato de sodio de 100 mM, pH 9.0. Añadir 100 μl de esta solución en cada pocillo e incubar durante la noche a 4 ° C. Capa dos pozos por antígeno. Preparar un control en blanco bien de que está revestido con tampón de carbonato solamente.
    Nota: Placas pueden ser producidas y almacenadas hasta por una semana a 4 ° C si se realizarán varias rondas de selección. También, este método utiliza la absorción directa que no requiere de etiquetado mientras que otros métodos utilizan Biotinilación u otros tipos de estrategias de etiquetado.
  2. Incube la placa durante la noche. Invertir para eliminar el contenido de los pocillos y lavar tres veces con 0,1 mL de PBS-T.
  3. Bloquean los pozos agregando 0,1 mL de BSA (20 mg/mL) en PBS y incubar la placa por 2 h a temperatura ambiente.
  4. Lave la placa tres veces con PBS-T seguido por tres veces con PBS. Antígenos pueden también covalente etiquetados y utilizados en los sistemas de captura como, por ejemplo, sistemas de biotina/estreptavidina.
  5. Tratamiento previo para la solución de fago (100 μL) con 100 μl de 40 mg/mL de BSA en PBS en una plataforma vibratoria a temperatura ambiente durante 30 minutos.
  6. Añadir la solución de fago al antígeno cubierto pozos e incubar con agitación suave por 2 h a temperatura ambiente. Utilizar múltiples pozos con el fin de asegurar un total de 1011 phage para cada antígeno.
  7. Deseche el fago por inversión y lavar los pocillos 5 veces con 200 μL de PBS-T seguido por cinco veces con PBS.
  8. Eluir el phage enlazado mediante la adición de 0,1 mL de tripsina 0.25 mg/mL en PBS e incubar durante 30 min a temperatura ambiente en la plataforma vibratoria a 700 rpm.
  9. Transferir la solución a una frasco ampolla de 5 μl de solución de hydrochloride(AEBSF) 4 mg/mL 4-Bencenosulfonilo flúor para saciar la actividad de la tripsina.
  10. Crecer TG1 phage display competente las células a 37 ° C con agitación hasta OD600 = 0,5.
  11. Añada 50 μl del fago eluída a 3 mL de las células de TG1.
  12. Incubar a 37 ° C sin agitación durante 30 minutos.
  13. Agregar 7 mL de medio LB con ampicilina de 100 μg/mL, 2% glucosa.
  14. Agitar durante la noche a 37 ° C.
    Nota: Para obtener los más diversos anticuerpos de dominio único, clones secuenciados, probarlo para propiedades deseadas y utilizados después de una ronda de lavado. Para obtener la más alta afinidad de anticuerpos de dominio único, deben utilizarse dos rondas de bateo.
  15. Las bacterias de la placa después de una noche crecimiento en placas de LB agar suplementado con ampicilina de 100 μg/mL, 2% glucosa. Varias diluciones seriadas tendrá que ser probado, a partir de dos diluciones, plateando 100 μl de 1/10.000 y 1/100.000 diluciones.
  16. Incube la placa durante la noche a 37 ° C.
  17. Seleccionar las colonias e inocular los pocillos de una placa de 96 pocillos estéril conteniendo 100 μl de 2XYT con 100 μg/mL ampicilina, 2% glucosa, glicerol 10% v/v por pozo.
  18. Incubar durante una noche a 37 ° C sin agitación.
  19. Al día siguiente, agite a 170 rpm a 37 ° C durante 60 minutos.
  20. Quitar 2 μl del medio en tubos de PCR. La solución restante puede a la izquierda de la placa y almacenada a 4 ° C durante 1-2 días o congelada y almacenada a-80 ° C para su uso posterior.
  21. Realizar la reacción de polimerización en cadena usando las cartillas apropiados para el vector utilizado. PMES4, detección de PCR de clones positivos utiliza cebadores que flanquean el sitio de clonación múltiple es CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC y GGTGGTGTGAGGAGACGGTGACCTG. Utilizar bicicleta las condiciones apropiadas para la polimerasa utilizada, una recocido temperatura de 57 ° C y 30 ciclos.
  22. Analizar la reacción de PCR mediante la ejecución de un gel de agarosa al 1% (p/v). Colonias que son positivas tienen insertos de gene de anticuerpos de dominio único de ~ 500 BP Asegúrese de que los clones positivos son 20-50% de la muestra.
    Nota: Este método proporciona un medio para la copia, selección y análisis que pueden realizarse en laboratorios de investigación más. Alternativamente, secuenciación de próxima generación puede aplicarse y proporciona grandes conjuntos de datos que permiten el análisis estadístico y comparativo16.
  23. Inocular los clones positivos de la placa en frescos tubos con 7 mL de LB con ampicilina 100 de μg/mL.
  24. Crecer con agitación para pasar la noche a 37 ° C.
  25. Realizar una miniprep de la cultura para obtener DNA plasmídico.
  26. La secuencia de clones positivos mediante el estándar secuenciación primer pEX-Rev (CAGGCTTTACACTTTATGCTTCCGGC).
  27. Realizar análisis computacional en secuencias de anticuerpos de dominio único resultante. Asegúrese de que hay no hay codones de parada o cambios de marco.
  28. Clasificar las secuencias resultantes de la similitud y diversidad. Las secuencias que se identifican repetidas veces suelen ser secuencias de unión de alta afinidad, particularmente después de dos rondas de selección.
  29. Expresar los anticuerpos de dominio único usando una cepa BL21-deriva de la expresión de E. bobina. Inducir la expresión a través de la adición de IPTG, creciendo durante la noche a 22 ° C.
  30. Purificar los anticuerpos de dominio único mediante cromatografía de afinidad metálica inmovilizados (IMAC).
  31. Validar la Unión de anticuerpo/antígeno único dominio usando un análisis de interacción directa como electroforesis nativa, abatible, o ELISA.
  32. Comprobar el rendimiento de anticuerpos de dominio específico de la aplicación, como se desee para el experimento específico.

Representative Results

El protocolo presentado aquí fue utilizado para generar anticuerpos de dominio único contra una variedad de antígenos de la proteína. Se utilizaron cinco antígenos por alpaca. Vigilancia inmune indica que la mayoría de los antígenos demostraron principio respuesta robusta en tres semanas (figura 1). Sangrados de la producción y la construcción de la biblioteca después de aproximadamente seis semanas da el mejor balance para los animales tienen múltiples antígenos inyectados. Dos rondas de bateo fueron realizadas para cada antígeno y aisladas colonias proyectadas (figura 2). La secuencia de las colonias positivas había identificado diversos dominio único anticuerpo secuencias para los antígenos diferentes. Por ejemplo, tres únicos clones fueron aislados para el antígeno de referencia maltosa vinculante proteínas (MBP) (Figura 3A). Como se observa con frecuencia, los anticuerpos de dominio único contienen diversidad de secuencia significativa o altamente variable CDR3 longitud (figura 3). Estas características son especialmente importantes en las interacciones antígeno anticuerpo de dominio solo como se ve en la referencia solo dominio anticuerpo/CX3CL1 complejo17 (figura 3B).

La mayoría de las secuencias de anticuerpos de dominio único larga duración puede ser expresada y purificada en 1-10 mg/L de cultivo (Figura 4A). Debido a la diversidad de longitud CDR3, anticuerpos de dominio único diferentes muestran ligera variación en peso molecular. Confirmación de enlace directo y performance específico de las aplicaciones es fundamental. Por ejemplo, después de dos rondas de selección contra el antígeno B, un panel de dominio solo anticuerpos fueron identificados (figura 2). Se identificaron varias secuencias idénticas, y los anticuerpos de dominio único fue producido y purificado. Luego fue había probado mediante extracción directa hacia abajo con la resina de afinidad antígeno y mostró robusto enlace dependiente de la dosis (Figura 4B). Lo importante, los anticuerpos de dominio único no demostraron vinculante para el control de la resina. Estos datos demuestran una interacción directa de la Unión y que está bien adaptado para la captura de afinidad en formato desplegable y basada en ELISA.

Figure 1
Figura 1 : Vigilancia inmune representativas de dos antígenos diferentes que muestran la significativa respuesta inmune específica a antígenos distintos en el mismo animal. Muchos antígenos muestran una robusta respuesta tan pronto como tres semanas después de comenzar la inmunización, con la mayoría que muestran respuesta máxima después de seis semanas. Seis semanas también permite la maduración de la afinidad y es el tiempo recomendado para la purga de la producción y el aislamiento de células B. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Confirmación basada polimerización en cadena de los clones positivos. Imprimaciones abarcan el MCS del vector pMES4, y un clon nanobody positiva produce un amplicón de ~ 500 bp (marcados con *). Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Secuencias específica de antígeno destacan diversidad de anticuerpos de dominio único alpaca. (A) alineación de seleccionar dominio único anticuerpo secuencias aisladas a MBP con un solo dominio referencia anticuerpo 4XT1, con marco y regiones determinantes de complementariedad (Kabat) destacadas a continuación. (B) estructura de alpaca 4XT1 de anticuerpos de dominio único limitado a CX3CL1 (PDB 4XT1), destacando el papel fundamental de CDR variable bucles en el atascamiento del antígeno específico. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 : Purificación y validación de anticuerpos de dominio único. (A) SDS-PAGE de anticuerpos de dominio único IMAC purificada, comparación de anticuerpos de dominio único diversos. Distintos pesos moleculares son principalmente debido a la diversa duración del bucle CDR3. También se observan diferentes niveles de expresión, con una minoría de anticuerpos de dominio único con bajos rendimientos de proteína purificada. (B) verificación de enlace directo con afinidad antígeno hacia abajo. Unión de anticuerpos robusto dominio único dependiente de la dosis se observa con la resina de acoplamiento antígeno pero no con resina de control. Haga clic aquí para ver una versión más grande de esta figura.

Discussion

Como se señaló, la alta afinidad y especificidad de anticuerpos de dominio único, combinado con su fácil expresión y estabilidad, hacen reactivos ideal para las aplicaciones en la investigación biomédica, como reactivos bioquímicos críticos, herramientas de diagnóstico, o agentes terapéuticos18. Para aplicaciones comerciales, hay alguna propiedad intelectual relacionados con las cuestiones que debe considerarse. Además, anticuerpos de dominio único pueden ser diseñados para contener marcadores específicos o etiquetas que pueden usarse como reporteros en ensayos celulares o en el diagnóstico. La clave para estos usos es la capacidad de producir anticuerpos de dominio único específicos contra los antígenos de interés. Un método se describe aquí para producir anticuerpos de dominio único con alpacas, que produce una respuesta inmune robusta contra una amplia variedad de antígenos de la proteína. Se describen las consideraciones para el manejo de animales y el cumplimiento. Estas son clave para el éxito en esta parte del proceso.

Hay otras estrategias para la producción de anticuerpos de dominio único que no requieren la vacuna, pero en su lugar, utilice las bibliotecas semisintéticas con diferentes sistemas para la selección y optimización iterativo de afinidades19,20 . Sin embargo, la ventaja de usar bibliotecas derivadas animales vacunados es la capacidad de aislar confiablemente anticuerpos de dominio único altamente enriquecido, diversa y alta afinidad. Además, no sólo se observan variaciones de secuencia significativa, pero una mayoría significativa de anticuerpos de dominio único específico aislado tenía únicas inserciones y canceladuras, particularmente en CDR3.

Dominio adicional, solo los anticuerpos se pueden producir mediante un proceso sencillo que sólo requiere pequeñas inyecciones del antígeno y después de este proceso, los animales pueden devolverse a la manada. De nota, el animal puede utilizar libremente para la producción de fibra, pero debe excluirse del uso como carne (cadena de alimento humana) debido al uso de la prueba de antígenos y adyuvantes aprobados FDA no para la producción de anticuerpos de dominio único. Cuando haya completado el procedimiento, los animales deben ser supervisados para una semana, dado un examen veterinario y luego pueden ser regresó a su hogar granja o descansados durante seis meses antes de otra ronda de producción de anticuerpos de dominio único.

Disclosures

Los doctores Whiteheart y Hersh en la Universidad de Kentucky y funcionan un núcleo en el centro de Medicina Molecular que produce anticuerpos de dominio único en alpaca como un cargo por servicio.

Acknowledgments

Este trabajo fue financiado por los institutos nacionales de salud (P30GM103486).

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
Inmunización de Alpacas (<em>Lama pacos</em>) con antígenos de la proteína y la producción de anticuerpos de dominio único antígeno específico
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter