Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Alpaka (Lama Paços) Protein antijenleri ve antijen spesifik tek etki alanı antikor üretimi ile bağışıklama

doi: 10.3791/58471 Published: January 26, 2019

Summary

Alpaka üzerinden tek etki alanı antikor üretimi için bir yöntem, aşılama, kan toplanması, B-hücre izolasyon ve seçimi de dahil olmak üzere tanımlanır.

Abstract

Bu makale, Alpaka bağışıklama ve antijen spesifik tek etki alanı antikor üretmeye moleküler biyoloji yöntemlerin kullanımı için bir yöntem açıklanan ve gösterdi. Tek etki alanı antikor üretmek için kullanılan ağır salt zinciri antikor roman türü ürettikleri bu yana Devegiller, alpakalar ve llamas, gibi Biyomedikal araştırmalar için değerli bir kaynak haline gelmiştir. Bağışıklık sistemi son derece esnek olduğundan, tek etki alanı antikorlar için birçok farklı protein antijenleri ve hatta farklı biçimler antijen, özgüllük çok yüksek bir derece ile yapılabilir. Bu özellikler, diğerlerinin yanı sıra, tek etki alanı antikorlar Biyomedikal araştırmalar için paha biçilmez bir araç olun. Alpaka üzerinden tek etki alanı antikor üretimi için bir yöntem bildirilmektedir. Bağışıklama, kan toplama ve B-hücre izolasyon için bir protokol açıklanmıştır. B-hücreleri kaydırma üzerinden belirli tek etki alanı antikorlar seçiminde kullanılan aşılı bir kütüphane yapımı için kullanılır. Kaydırma yolu ile elde edilen sözde belirli tek etki alanı antikorlar açılan tarafından teyit ELISA veya jel-shift deneyleri. Ortaya çıkan tek etki alanı antikorlar, daha sonra doğrudan veya bir mühendislik reaktif bir parçası olarak kullanılabilir. Tek etki alanı antikor ve tek etki alanı vekiller antikor tabanlı kullanır yapısal, biyokimyasal, hücresel, içinde vivo ve tedavi uygulamaları içerir. Rekombinant proteinler prokaryotik ifade sistemlerinde, saf ve doğrudan kullanılan veya belirli işaretçileri veya hücresel çalışmaları ya da gazetecilere olarak kullanılan Etiketler içerecek şekilde tasarlanmış tek etki alanı antikorlar büyük miktarlarda üretilmektedir Tanılama.

Introduction

Alpakalar ve Devegiller ailesinin diğer üyeleri Biyomedikal araştırma1,2,3için antikorlar oluşturmak için popüler bir kaynağı haline gelmiştir. Devegiller ürettikleri hem normal antikor hem de ağır zinciri tek antikorları yüksek özgüllük ve yüksek afinite korurken daha küçük tek etki alanı antikor üretimini sağlayan benzersiz bir bağışıklık sistemi sahip. Böylece, Devegiller antikorlar çok yönlü reaktif çok çeşitli amaçlar için yararlı sağlar. Alpaka bağışıklık ve tek etki alanı antikorlar antijenleri protein çeşitli üretmek için bir yöntem burada açıklanmıştır. Bu antikorlar Devegiller sadece küçük iğne ile bağışıklama hedef protein (antijen) ve bir kan berabere4gerektirir nispeten basit bir süreci ile üretilmektedir. Daha sonra kütüphane inşaat, M13 fajının ekran5 ve karşı rekombinant antijen6 panning ayırmak ve istenen özelliklere sahip tek etki alanı antikor üretmek için kullanılır. İşleminin fajının ekran teknolojisi olanaklarından aldığından, beş veya daha fazla antijenleri aynı anda hayvan yararlı olabilir, böylece hayvan sayısını azaltmak kullanılan ve maliyetleri ilişkili.

Tipik memeli antikorlar veya immünoglobulinler disülfür bağları ile birbirine bağlanmış zincirler (2 ağır zincirleri ve 2 hafif zincirleri), iki tür oluşan büyük moleküllerdir. Bu antikorlar nispeten büyük, moleküler ağırlık ~ 140-190 sergilenmesi kDa daha bol IgG türler insanlar, fareler, keçi ve tavşan için. Onların çok alt birim yapısı, yüksek molekül ağırlıklı ve disülfür bağları nedeniyle immünglobulin yüksek maliyet yapım büyük miktarlarda üretmek için oldukça zor olabilir. 1990 's, deve, kaç Lama ve alpaka içerir Devegiller, yanı sıra tipik memeli türü immünglobulin, bir roman formu sadece ağır zincir7sahip yapısında daha basit immünglobulin yapmak keşfedilmiştir. Bu benzersiz Devegiller antikorlar özellikle yabancı maddelerin yüksek afinite ile bağlamak için aynı yeteneğine sahip ama sadece bir protein zinciri8üretilmiştir. Ayrıca, Devegiller antikorlar deneysel bir tek etki alanı antikor9olarak da adlandırılan bir daha da küçük birim VHH parçası için kesilmiş. Kendi küçük boyutu nedeniyle tek etki alanı antikorlar Biyomedikal araştırma uygulamaları geniş bir yelpazesi için yararlıdır ve akademik ve ticari kaynakları1,10çeşitli kullanılabilir. Bir özel durum tek etki alanı antikorlar daha sık genellikle Batı lekesi kullanılan denaturing koşullar altında kaybolur conformation bağımlı epitopları karşı yönlendirilmektedir beri Western Blot gibi görünüyor.

Onlar tek polipeptid zinciri yapılır beri belirli tek etki alanı antikorlar seçili ve kolayca bakterilerde rekombinant proteinler olarak büyük miktarlarda üretilen. Tek etki alanı antikorlar da belirli işaretleri, "muhabir grupları olarak" hastalıkları11tanılamak için kullanılabilir etiketler yoksa genetik olarak. Kullanım esnekliği ile birleştiğinde manipülasyon bu kolaylığı tek etki alanı antikorlar üniversiteler ve başka bir yerde araştırmacılar için önemli bir kaynak yapar.

Bir Ulusal Sağlık Enstitüleri parçası çekirdek desteklenen gibi mevcut yöntemler tek etki alanı antikorlar alpaka3,4üretmek için uyarlanmıştır. Alpaka işleme erişilebilirlik yanı sıra daha büyük Devegiller aile üyeleri göre her iki kolaylığı önemli avantajları var. Alpaka lif ve et için yaygın olarak yetiştirilir ve böylece bölgesel devlet damızlık dernekler veya kendi web siteleri aracılığıyla tespit eden yerel alpaka çiftçilerin elde edilebilir. Alpaka iki doğurmak are elde edilebilir, Suri ve Huacaya. Huacaya daha sık görülür ve bu iletişim kuralı için kullanılan, ancak genellikle her iki doğurmak için uygulanabilir ve ayrıca diğer Devegiller daha yaygın olarak uygulanabilir protokolüdür.

Protocol

Alpaka ile tüm yordamları Kentucky Üniversitesi Kurumsal hayvan bakım ve kullanım Komitesi (IACUC) tarafından onaylanmış protokollerini (2017-2627 ve 2018-2925) uygun olarak gerçekleştirilmiştir.

1. nesil antijen spesifik alpaka antikorlar

  1. Alpaka kullanım ve genel konuları
    1. Uygun kurumsal ve/veya Düzenleyici onay almak.
    2. Yetişkin alpaka, elde bir vücut yaş 10 yıldan az puanı en az 3.0 (ölçek 1-5)12durumu. Sürüyü hayvanlar oldukları için en az iki ama tercihen üç hayvanlar birlikte ev.
      Not: Genel olarak, onlar daha da bir mizaç ve çalışmak daha kolay çünkü erkekler tavsiye edilir.
    3. Hayvanlar bir veteriner açmasıyla diyet, konut, aşı ve parazit kontrol programları13Dergisi'nin de dahil olmak üzere sağlık durumunu denetleyin. Hayvanlar güncel aşılar profesyonel veteriner önerilerini esas alarak yerel coğrafi bölge için uygun olduğundan emin olun. Bir ecto - ve endoparasite kontrol programı üzerinde bir inceleme-sürünün kökenli ve belirli yerel koşullara13tarihinin dayalı bir veteriner danışarak geliştirmek.
    4. En az bir hafta yular eğitim ve kısıtlama için pozlama da dahil olmak üzere, parkenizin.
    5. Bir öncesi bağışıklama denetim olarak kullanmak için serum elde etmek için 4 mL kan örneği toplamak (bkz. Adım 1.4). Sera donma ve 0.5 mL aliquots-20 ° C'de depolayın.
      Not: Şu anda ek kan hayvanların ilk sağlık durumunu izlemek tam kan hücresi (CBC) analiz için alınabilir.
  2. Antijen hazırlık
    1. Saf protein antijenleri fosfat tamponlu tuz çözeltisi (PBS) veya HEPES arabelleğe alınmış serum fizyolojik (HBS) hazırlamak ve ≥1 mg/mL konsantre. Yaklaşık 3 mg protein bağışıklama, kaydırma ve onay klonların dahil olmak üzere tam protokolü için gereklidir.
      Not: Devegiller antikorları yüksek özgüllük ve seçicilik protein antijenlere karşı görüntüler ancak genellikle pek iyi yapılandırılmamış proteinler veya genel olarak yapılandırılmamış olan peptid antijenleri için uygundur.
    2. Antijen saflık, saflık ile kurmak > % 90'ı istenen. SDS-sayfa gibi bir analitik yöntem kullanmaktadır.
      Uyarı: Diğer proteinler ile önemli kirlilik nereye tek etki alanı antikorlar hedef protein yerine kirletici için ayrılmış olabilir seçim sırasında sorunlara yol açabilir.
    3. Donmuş aliquots antijen 100 µg toplam içerir antijen hazırla. 2 mg/mL hazırlık 50 µL idealdir. 1 mg/ml 100 µL en seyreltik protein aşılama için uygun bir çözümdür. Antijen donma/çözülme tabi olamaz ve çözüm uzun vadede istikrarlı olduğu bilinmektedir, alternatif olarak, bu 4 ° C'de saklanabilir
      Not: Antijen bir donma/çözülme döngüsü geçirmek için emin olmak için test 20 µL aliquot antijen bir ince kalmaması PCR tüp ve sıvı azot içinde donmuş ek duvarlı. Tüp çözülme, yüksek hızlı aralıklarla gerçekleştirmek ve nicel kurtarma UV/VIS emme önce ve sonra donma karşılaştırarak veya bir SDS-sayfa jel çalıştırarak doğrulayın. Mümkünse, antijen da biyolojik aktivitesi saklama için test edilmelidir. Donma çözülme döngüsü başarılı kalan antijen 100 µL aliquots içinde donmuş ve-80 ° C'de depolanan ek ise, Donma/çözülme döngüsü ile ilgili sorunlar varsa, iletişim kuralı % 20 ilavesi ile tekrar edilebilir gliserol.
  3. Bağışıklama
    1. En çok beş antijenleri, 200 µg her, karışımı bir son hacmi 300-1000 µL arasında adjuvan ile. Adjuvan eritici su kullanarak son hacmi ≥50% oluşturmaktadır.
      Not: Arabellek gerekli ise, HEPES, bezleri veya glisin kullanın. 5 ve 6 arasında bir pH kez daha kesinlikle tarafsız daha olumlu olduğunu kanıtlamıştır. Koagülasyon sebep olabilir bu yana polivalan iyonları fosfat veya sitrat, gibi kaçının.
    2. Hilal ay desen omuz onun boynundan yay lenf düğümlerine bitişik bölgeler ortaya çıkarmak için omuz için taban boyunca elektrik makası ile alpaka'nın saç kesme.
    3. Alpaka boynundan tutarak, yavaş yavaş boyun 22 G iğne kullanarak yay lenf düğümleri yakınlarında Bankası boyunca subkutan antijen enjekte et. Beş enjeksiyonları ~ 200 µL (veya daha az) gerçekleştirmek ~ 5 cm arayla.
      Not: Hayvanlar enjeksiyonlar sırasında ikinci bir personel tarafından ölçülü. Onlar sadece arkadan yan tekme için eğilimli değildir ancak olduğundan enjekte ve alpaka kanama için dikkatli çağırır. İşlemler sırasında bir grup, hayvanlarda, birbirlerine yakın olan en uygunudur. Onlar sürünün hayvanlar olduğunu göz önüne alındığında, onlar bir grupta daha sakin ve daha az güçlü kısıtlama işlemler sırasında gereklidir.
    4. Hayvanlar anafilaksi belirtileri ~ 20 dk sonrası enjeksiyon için izlemek (bkz. Adım 1.6). Haftalık, enjeksiyon sitelerdeki yerelleştirilmiş iltihap için monitör önerilen adjuvan kullanırken beklenen değil. Kan sızıntısı enjeksiyon sitesinden aşırı olmadığından emin olun.
    5. Beş sonraki artırma enjeksiyonları haftalık 100 µg her antijen karışımı kullanarak gerçekleştirin. Saç enjeksiyon sitelerdeki kırpma haftalık mevsime bağlı olarak gerekli olabilir. Sonbahar ve kış, hayvanların saç hızla büyüyebilir.
  4. Kan çizim
    1. Küçük ve alkol bezlerden koleksiyonu sitesiyle dezenfekte.
    2. Hayvan yavaşça dik düzenlenen boyun ve düz tut.
      Not: Hayvanlar el ile videoda gösterildiği gibi hakim. Varsa, bir alpaka oluğu alpaka kanama sırasında dizginlemek için kullanın ve iğne kullanımı kolay olabilir. Bir alpaka paraşüt kullanmak için alpaka haltered oluk led ve boyun bar ve kayışları ile hızlı bültenleri ile ölçülü. Alpaka oluğu ticari satıcıları tarafından sağlanan sürümleridir.
    3. Ventral projeksiyon vertebra enine sürecinin bir dönüm noktası kullanarak, damar ventral işlemi sadece orta basınç uygulayarak doldurmak.
      Not: Yetişkin alpaka hiçbir farklı şah karık olduğunu. Şah damarları enine vertebra süreçleri ventral projeksiyonlar tarafından korunmaktadır. Bu kalın deri (örneğin, 1 cm kalınlığında "Orta 1/3'ü erkek boynundan plaka kavga") ve boyun kas yapar zor görselleştirmek veya juguler ven muayene et. Daha sonra vertebra yerlerinden şah konum için en yararlı göstergeleri kullanımıdır.
    4. İğne biraz medial bir 45 ° açıyla yerleştirin (~ parmak genişliği) merkeze doğru projeksiyon boyun için. İğne kadar kan akışı işlemek.
      Not: Juguler ven ve karotid arter birbirine yakın vardır. Venöz kan oldukça kırmızı renkte olabilir ama hala arteriyel kan koyu. Koleksiyonda, basınç uygulanabilir site 0.5-1 için min (veya daha uzun boyun arterine eriştiyseniz) kadar hemostaz güvence altına alınmıştır.
    5. 4-10 mL kan analitik amaçlı çizin. 1,5 inç, 20 G iğne genellikle birlikte bir uygun ölçekli şırınga ya da kan toplama tüp ile kullanmaktadır. Lavanta üst K2EDTA tüpler tam kan lenfositleri arındırıcı zaman toplamak için kullanmak. Altın top serum ayrılık tüpler (BD) kan serum üretim için toplarken kullanmaktadır.
    6. 50-100 mL kan üretim amaçları için çizin. 19-20 G kanatlı "kelebek" infüzyon kümesi ile bir ek 12-inç infüzyon uzantısını kullanır.
      Not: Bir uzantısı küme yapılandırması birden fazla kan toplama tüpler, venipuncturist koleksiyon iğne sabitleme üzerinde odaklanmaya izin doldurmak bir yardımcı sağlar. İnfüzyon seti hayvan (3-5 dk yordam) potansiyel hareketi barındırır ve rahat bir çalışma mesafesi operatörleri için verir.
  5. İzleme bağışıklık
    1. 3-4 gün sonra 3rd ve 5inci enjeksiyonları, her hayvan testleri için sera elde etmek için küçük bir test kenar taşması gerçekleştirin. Dondurma ve sera 0.5 mL aliquots içinde saklayın. Ek kan örneklerini hayvan sağlığını izlemek için aynı zamanda yukarıda da açıklandığı gibi almak.
    2. Antijen spesifik antikor ELISA testi kanamaları önceden bağışıklık, üç haftalık ve beş hafta zaman noktalarda elde edilen sera kullanarak tarafından varlığını doğrulamak. Antikor titresi artıyor son kenar taşması al en iyisidir.
    3. Antijen benzeşme tabak yüzey işlem görmüş 96-şey plakaları kullanarak oluşturun. 100 mM sodyum karbonat tampon pH 9.0 antigen 0.1 µg sulandırmak. Her şey için çözüm 100 µL ekleyin ve bir gecede 4 ° C'de kuluçkaya Her antijen on dilutions yinelenen test edilmektedir. Boş bir denetim de karbonat arabellek ile kaplı hazırlanır.
    4. Gecede kuluçka sonra kuyuları içeriğini kaldırmak ve üç kez PBS, % 0.1 0.1 mL ile yıkamak için plaka ters ara 20 (PBS-T).
    5. BSA (5 mg/mL) 0.1 mL PBS-T ekleyerek ve oda sıcaklığında 1 h plaka kuluçka kuyuları engelleyin.
    6. Üç kez PBS-T ile tabak yıkama çözüm kuyunun içine pipetting ve plaka INVERSION tarafından yıkama çözüm kaldırarak yıkayın.
    7. İki kat seri dilutions 0.3 ml her PBS-T tampon 1/100 ve ilâ başlangıç dilüsyonu kullanılarak önceden bağışıklık ve bağışıklık sera hazırlamak 1/102, 400.
    8. Her seyreltme 100 µL wells için ekleyin ve oda sıcaklığında 2 h için kuluçkaya için.
    9. Serum her kuyudan çıkarın ve PBS-T 0.2 mL ile üç kez yıkayın.
    10. Her kuluçkaya HRP Birleşik keçi Anti-Lama IgG antikor 1:20,000 1 h için seyreltme, 0.1 mL ile iyi.
      Not: Ölçülen bağışıklık yanıtı dolaşım3,14yaklaşık olarak eşit oranları mevcut ağır zinciri tek antikorlar yanı sıra geleneksel hem de içerir.
    11. Antikor çözümü kaldırmak ve her yıkama PBS-T 0.2 mL ile üç kez iyi.
    12. Kuyuya chromogenic peroksidaz substrat 100 µL ekleyin ve iki en yüksek konsantrasyon nokta yoğunluğunu doymuş olmak kadar genellikle 5-10 dk alır oda sıcaklığında kuluçkaya.
    13. 100 µL 0.1 M sülfürik asitin reaksiyonu durdurmak için her şey için ekleyin.
    14. 450 her kuyuda absorbans ölçmek bir plaka okuyucu kullanarak nm.
    15. Absorbans bir işlev konsantrasyon çiz.
  6. Alpaka izleme ve potansiyel komplikasyonlar
    1. Uygun alpaka yordam kontrolü sağlamak.
      Not: Yordamlar önemli olumsuz etkilere neden beklenmiyor. Her gün hayvan refahı ve sağlık hayvancılık ve/veya araştırma personeli tarafından besleme ve sulama sırasında izlenmelidir. Herhangi bir hayvan unalleviated deneysel olarak kaynaklı veya kendiliğinden doğal morbidite ile değerlendirme için veteriner hizmetleri tarafından sağlanan gerektiği kadar insancıl ötenazi, treatment(s) ile gerekirse sevk edilmelidir.
      Kanama, morarma ve hematom flebotomi ile ilişkili olası olumsuz sonuçları vardır. Hayvanlar için 20 dk sonrası kan alımı kanama belirtileri için bakmak takip edilmelidir. Ek basınç sitelerinde kullanılmalıdır. Kanama durmuyor eğer a hayvan hastalıklarıyla ilgili başvurulması gerekir.
      Enjeksiyonları ve kanama ile ilgili diğer olası olumsuz sonuçları Granülom oluşumu ve inflamasyonu içerir. Granülom oluşumu değil beklenen ve Kentucky Üniversitesi gözlenen değil. Enjeksiyon Makinası iltihabı (kızarıklık veya şişlik) meydana gelebilir ve bir veteriner dikkatine getirilmelidir. Kan potansiyel olarak önemli bir birim üretim taşma payı temsil eder ve hayvanlar onlar istikrarlı ve etkin kan toplandıktan sonra sağlamak için takip edilmelidir.
      Anafilaksi ve pyrogenic yanıt-e doğru iki büyük olasılıkla ciddi olumsuz sonuçları vardır, ama çok nadiren gözlenir. Bu ortaya çıkacaksa, anafilaksi antijen enjeksiyonu kısa bir süre sonra oluşacak ve rektal ısı, halsizlik, kusma, solunum sorunları, ve/veya ishal bir artış gösterdi. Rektal sıcaklığı vücut sıcaklığında herhangi bir artış tespit etmek için her enjeksiyon sonra izlenebilir. Eğer bunlar tanınan a hayvan hastalıklarıyla ilgili bir danışma için hemen haber verin. Ayrıca, bir acil durum "Crash istişare ile a hayvan hastalıklarıyla ilgili hazırlanan Kit" (örneğin, epinefrin, kortikosteroidler ve antihistaminik) olumsuz bir tepki şüpheli hayvanları tedavi kullanılabilir olması gerekir.

2. arındırıcı lenfositler tek etki alanı antikor Kütüphane yapımı için

  1. 50 mL kan 3-5 gün sonra son enjeksiyon (bkz: adım 1.4) toplamak.
    Not: Kan hızlı işleme ve yalıtım RNA'ın kaydırma başarısı için çok önemli olduğu bir uygun kütüphane boyutu15,3, elde etmek önemlidir.
  2. Toplanan kan 15 mL 5 mL de PBS ile sulandırmak.
  3. Periferik kan lenfositleri (PBLs) tarafından yoğunluk gradient Santrifüjü üretmektedir öneriler göre ayırmak için bir lenfosit ayrılık tüp kullanmaktadır.
    Uyarı: Üretici yönergelerine en çok 25 mL kan kullanılabilir, ancak bu sistem doyurmak ve temiz lenfosit hazırlık alma önlemek gösterir.
  4. PBS PBL 4 ° c prechilled 5 mL ekleyin.
  5. Vasıl 800 x g 4 ° C'de 20 dk için spin
  6. 5 mL vasıl 800 x g 4 ° C'de 20 dk aralıklarla takip PBL 4 ° c prechilled PBS de ekleyerek iki kez yıkamak
  7. Toplam RNA bir spin-sütun tabanlı sistemi kullanarak üreticinin yönergelerine göre ayır. Vertexing uygun arabellek ve biyopolimer parçalama bir sisteme uygulama tarafından hücreleri lunaparkçı. Mini veya maxi-sütunları giriş hücreyi temel alarak uygun sayıda kullanın.
  8. Ters transkriptaz RNA'ın 10 µg Oligo (dT) 0.1 µg bir karışımı ile 12-18 astar birleştirerek kullanma cDNA sentez.
  9. Kurulan yöntemleri4kullanarak bir bakteriyofaj kitaplığı oluşturun. Bu gen III. ipliksi fajının fajının çözüm üretimi için erimiş INSERT ifadesinin ardından fajının görüntü vektör pMES4 içine enzimleri ile klonlama içerir.

3. tek etki alanı antikor kaydırma

  1. Antijen benzeşme tabak yüzey işlem görmüş 96-şey plakaları kullanarak üretmek. 100 mM sodyum karbonat tampon pH 9.0 antigen 0,25 µg sulandırmak. Her şey için bu çözümün 100 µL ekleyin ve bir gecede 4 ° C'de kuluçkaya Antijen başına iki kuyu kat. Karbonat arabellek ile kaplı bir boş denetim iyi hazırlamak.
    Not: Tabak üretilen ve seçimin birden fazla mermi gerçekleştirilecek bir hafta 4 ° C'de depolanmış. Ayrıca bu yöntem hangi does değil istemek başka yöntemler biotinylation veya başka türleri stratejileri etiketleme kullanırken etiketleme doğrudan emme kullanır.
  2. Plaka gecede kuluçkaya. Kuyuları içeriğini kaldırmak ve üç kez PBS-T. 0.1 mL ile yıkamak için ters çevir
  3. PBS BSA (20 mg/mL) 0.1 mL ekleyerek ve oda sıcaklığında 2 h plaka kuluçka kuyuları engelleyin.
  4. Plaka üç kez PBS-T ardından üç kez PBS ile yıkayın. Antijenleri Ayrıca kovalent etiketli ve yakalama sistemleri gibi örneğin, streptavidin/biotin sistemleri kullanılır.
  5. Feyc çözüm (100 µL) önceden 40 mg/mL BSA PBS, oda sıcaklığında 30 dk için titreşimli bir platformda 100 µL ile tedavi.
  6. Antijen fajının çözümü wells kaplı ve oda sıcaklığında 2 h için nazik ajitasyon ile kuluçkaya ekleyin. Birden çok kuyu 1011 fajının her antijen için toplam sağlamak için kullanın.
  7. İlişkisiz fajının INVERSION tarafından atın ve sonra wells beş kez PBS-t beş kez PBS ile ardından 200 µL ile yıkayın.
  8. İlişkili fajının PBS ve 700 RPM titreşimli platformunda oda sıcaklığında 30 dk için kuluçka 0.25 mg/mL tripsin 0.1 mL ekleyerek elute.
  9. Çözüm 4 mg/mL 4-benzenesulfonyl florür hydrochloride(AEBSF) çözüm tripsin aktivite gidermek için 5 µL içeren bir flakon aktarın.
  10. 37 ° C'de OD600 kadar sallayarak ile TG1 fajının ekran yetkili hücrelerin büyümesine 0,5 =.
  11. Eluted fajının 50 µL TG1 hücreleri için 3 mL ekleyin.
  12. 37 ° C'de 30 dk sallayarak olmadan kuluçkaya.
  13. 7 mL 100 µg/mL ampisilin, % 2 glikoz ile desteklenmiş LB medya ekleyin.
  14. Gecede 37 ° C'de sallamak
    Not: En farklı tek etki alanı antikorlar elde etmek için klonlar sıralı, istenen özelliklerde test ve panning bir turdan sonra kullanılmıştır. En yüksek benzeşimi tek etki alanı antikorlar elde etmek için kaydırma iki tur kullanılması gereken.
  15. Gecede büyüme LB ağar kaplamalar üzerinde 100 µg/mL ampisilin, % 2 glikoz ile desteklenmiş sonra bakteri plaka. Birkaç seri dilutions test edilecek gerekir iki dilutions ile başlayan, 1/10.000 ve 1 100 µL kaplama/100.000 dilutions.
  16. Gecede 37 ° C'de plaka kuluçkaya
  17. Kolonilerin almak ve 2XYT 100 µg/mL ampisilin, % 2 glikoz, % 10 v/v gliserol iyi başına 100 µL içeren steril bir 96-şey plaka kuyu aşılamak.
  18. Gecede 37 ° C'de sallayarak olmadan kuluçkaya.
  19. Ertesi gün, 60 dk 37 ° C'de 170 rpm'de sallamak.
  20. Medya 2 µL PCR tüpler içine kaldırın. Kalan çözüm plaka yaptı ve 4 ° C'de 1-2 gün boyunca depolanan veya dondurulmuş ve daha sonra kullanmak üzere-80 ° C'de depolanan.
  21. PCR reaksiyon astar kullanılan vektör için uygun kullanarak gerçekleştirin. PMES4 için CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC ve GGTGGTGTGAGGAGACGGTGACCTG birden çok klonlama sitenin yan pozitif klon kullanır astar PCR tarama vardır. Polimeraz kullanılan için 57 ° C ile 30 döngüleri tavlama sıcaklığını Bisiklet koşullarını uygun kullanmaktadır.
  22. PCR reaksiyon %1 (w/v) özel jel çalıştırarak analiz. Pozitif kolonileri var tek etki alanı antikor gen ekler ~ 500 bp. olumlu klonlar 20-%50 örnek vardır emin olun.
    Not: Bu yöntem seçimi ve çoğu araştırma laboratuvarlarında gerçekleştirilen analiz clone için bir araç sağlar. Alternatif olarak, yeni nesil sıralama uygulanabilir ve istatistiksel ve karşılaştırmalı analizi16sağlayan büyük veri kümeleri sağlar.
  23. Plaka pozitif klonlar içeren LB 7 mL 100 µg/mL ampisilin ile taze tüpler içine aşılamak.
  24. Gecede 37 ° C'de için sallayarak ile büyümek
  25. Bir miniprep plazmid DNA elde etmek için kültür üzerinde gerçekleştirin.
  26. Pozitif klonlar astar pEX-Rev (CAGGCTTTACACTTTATGCTTCCGGC) sıralama standardını kullanarak sıra.
  27. Ortaya çıkan tek etki alanı antikor dizileri Hesaplamalı çözümlemesi gerçekleştirin. Hiçbir stop kodon vardır veya çerçeve geçer emin olun.
  28. Benzerlik ve farklılıkların yönetimi için ortaya çıkan serilerini sınıflandırmak. Sürekli olarak tanımlanan dizileri en yüksek afinite bağlayıcı sıraları, özellikle iki tur seçim sonra olması muhtemeldir.
  29. Bir ifade BL21 türetilmiş tür kullanarak tek etki alanı antikor hızlı E. bobin. IPTG, 22 ° C'de geceleme büyüyen, aracılığıyla ifade teşvik
  30. İmmobilize metal benzeşme Kromatografi (IMAC) kullanarak tek etki alanı antikor arındırmak.
  31. Tek etki alanı antikor/antijen bağlayıcı bir doğrudan etkileşim tahlil aşağı açılır, yerli jel elektroforez veya ELISA gibi kullanarak doğrulayın.
  32. Uygulamaya özgü tek etki alanı antikor performansı, belirli deneme için istediğiniz gibi doğrulayın.

Representative Results

Burada sunulan Protokolü a sıra-in protein antijenlere karşı antikor tek etki alanı oluşturmak için kullanılmıştır. Beş antijenleri alpaka kullanılmıştır. Bağışıklık izleme antijenleri çoğunluğu üç hafta (Şekil 1) başlangıçta güçlü tepki gösterdiğini belirtti. Üretim Kenar taşmaları ve sonra yaklaşık altı hafta verir en iyi dengeyi hayvanlar için bu kütüphane inşaat enjekte birden çok antijenleri var. Kaydırma iki tur her antijen için gerçekleştirilen ve izole kolonileri ekranlı (Şekil 2). Sıralama olumlu kolonileri çeşitli tek etki alanı antikor dizileri farklı antijenler tespit. Örnekler için üç benzersiz klonlar maltoz bağlayıcı Protein (MBP) (Şekil 3A) başvuru antijen izole edildi. Sık sık görülmektedir, tek etki alanı antikorlar önemli sıra çeşitlilik ve son derece değişken CDR3 uzunluğu (Şekil 3) içerir. Bu özellikler özellikle başvuru tek etki alanı antikor/CX3CL1 karmaşık17 ' (Şekil 3B) görüldüğü gibi tek etki alanı antikor/antijen etkileşim içinde önemlidir.

Tam uzunlukta tek etki alanı antikor dizileri çoğunluğu ifade ve 1-10 mg/L Kültür (Şekil 4A) saf. Nedeniyle CDR3 uzunluğunda, farklı tek etki alanı antikorlar dinleyelim moleküler ağırlıklı göstermek. Doğrudan bağlama ve uygulama belirli performans önemlidir. Örneğin, seçim karşı antijen B iki tur sonra tek etki alanı antikorlar vardı bir panel (Şekil 2) tespit edilmiştir. Birden çok özdeş dizileri tespit edilmiştir ve tek etki alanı antikor üretilen ve saf. Sonra doğrudan çekme aşağı antijen benzeşme reçine ile test ve güçlü doz bağımlı bağlama (Şekil 4B) gösterdi. Önemlisi, tek etki alanı antikor reçine denetlemek için hiçbir bağlama gösterdi. Bu veriler doğrudan bağlama etkileşim ve benzeşme yakalama içinde aşağı açılır ve ELISA tabanlı oluşum için de uygun olduğu bir göstermektedir.

Figure 1
Resim 1 : Farklı antijenler önemli belirli bağışıklık yanıtı aynı hayvan gösterilen iki ayrı antijenleri temsilcisi bağışıklık izleme. Birçok antijenleri bağışıklama, maksimal yanıt altı hafta sonra gösterilen çoğunluğu ile başlıyor sonra üç hafta gibi erken sağlam tepki göstermek. Altı hafta da afinite olgunlaşma için sağlar ve üretim taşma payı ve B-hücre izolasyon önerilen zamanı. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 : Olumlu klonların PCR tabanlı onay. Astar yayılan pMES4 vektör MCS ve olumlu nanobody klon bir amplicon ~ 500 üretir bp (ile işaretlenmiş *). Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3 : Antijen spesifik dizileri vurgulamak alpaka tek etki alanı antikor çeşitlilik. (A)hizalaması seçin tek etki alanı antikor dizileri için MBP izole bir başvuru tek etki alanı antikor 4XT1, çerçeve ve tamamlayıcılık belirleme bölgeleri (Kabat) aşağıda vurgulanmış. (B) yapısını alpaka tek etki alanı antikor 4XT1 bağlı CX3CL1 için (PDB 4XT1), değişken CDR kritik rolünü vurgulayan spesifik antijen bağlamasında döngüler. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4 : Arıtma ve tek etki alanı antikorlar doğrulanmasını. (A)SDS-çeşitli tek etki alanı antikorlar karşılaştırma sayfası saf IMAC tek etki alanı antikorların. Farklı molekül ağırlıkları CDR3 döngünün farklı uzunluk nedeniyle öncelikle vardır. İfade farklı düzeylerde de saf protein düşük verimleri gösterilen tek etki alanı antikorlar bir azınlık ile gözlenir. (B) doğrulanması bir antijen ilgi açılan kullanarak doğrudan bağlama. Güçlü doz bağımlı tek etki alanı antikor bağlama antijen birleştiğinde reçine ile ama denetim reçine ile değil görülmektedir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Discussion

Belirtildiği gibi yüksek benzeşme ve özgüllük facile ifade ve istikrar, ile birlikte tek etki alanı antikorların onları uygulamalar için ideal reaktifler Biyomedikal araştırma, kritik biyokimyasal reaktifler, tanı araçları yapmak veya terapötik ajanlar18. Ticari uygulamalar için dikkate alınması gereken bazı sorunları ile ilgili fikri mülkiyet vardır. Ayrıca, tek etki alanı antikorlar belirli işaretçileri veya gazetecilere hücresel deneyleri veya tanılama olarak kullanılan Etiketler içerecek şekilde tasarlanmış. Bu kullanımlar için anahtar faiz antijenlere karşı belirli tek etki alanı antikor üretmek için yeteneğidir. Bir yöntem burada tek etki alanı antikorlar alpaka, kullanarak üretmek için çeşitli protein antijenlere karşı güçlü bir bağışıklık yanıtı üreten açıklanmıştır. Hayvan işleme ve yasal uyumluluk hakkında önemli noktalar açıklanır. Bu işlemi bu kısmında başarı için anahtar vardır.

Bağışıklama gerektirmez, ancak bunun yerine semisynthetic kütüphaneler seçimi ve yinelemeli benzeşim19,20 iyileştirmesi için farklı sistemleri ile kullanmak tek etki alanı antikor üretimi için diğer strateji vardır . Ancak, aşılı hayvanlardan elde edilen kitaplıkları kullanmanın avantajı güvenilir bir şekilde yüksek oranda zenginleştirilmiş, çeşitli ve yüksek-benzeşimi tek etki alanı antikorlar yalıtmak için yeteneğidir. Ayrıca, sadece önemli sıra varyasyonları görülmektedir, ancak belirli tek etki alanı antikorlar izole önemli bir çoğunluğu benzersiz eklemeler ve silmeler, özellikle CDR3 vardı.

Ayrıca, tek etki alanı, antikor sadece küçük iğne antijen ve sonra bu işlemi gerektirir basit bir süreci ile üretilen hayvanlar sürünün için döndürülebilir. Dikkat, hayvan lif üretimi için serbestçe kullanılabilir, ancak test antijenleri ve sigara FDA onaylı adjuvan kullanım için tek etki alanı antikor üretimi nedeniyle et (insan gıda zinciri) olarak kullanımdan tutulmalıdır. Yordamı tamamlandığında, hayvanlar için bir hafta, bir final veteriner sınavı verilen takip edilmelidir sonra ya onların ev çiftliğine geri döndü ve tek etki alanı antikor üretimi başka bir turdan önce altı ay dinlenmiş.

Disclosures

DRS. Whiteheart ve Hersh Kentucky Üniversitesi ve moleküler tıp alpaka bir ücret-için-hizmet olarak tek etki alanı antikor üreten bir çekirdek merkezi çalışır.

Acknowledgments

Bu eser Ulusal Sağlık Enstitüleri tarafından (P30GM103486) destek verdi.

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
Alpaka (<em>Lama Paços</em>) Protein antijenleri ve antijen spesifik tek etki alanı antikor üretimi ile bağışıklama
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter