Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Analyses de polymérase quantitative axée sur la réaction en chaîne de murin microbiote Intestinal après un traitement antibiotique par voie orale

doi: 10.3791/58481 Published: November 17, 2018

Summary

Ici nous fournissons des protocoles détaillés pour l’administration orale d’antibiotiques aux souris, collection d’échantillons de matières fécales, l’extraction d’ADN et la quantification des bactéries fécales de qPCR.

Abstract

Le microbiote intestinal a une influence centrale sur la santé humaine. Dysbiose microbienne est associé à plusieurs immunopathologies communs tels que les maladies inflammatoires de l’intestin, l’asthme et l’arthrite. Ainsi, la compréhension des mécanismes qui sous-tendent la diaphonie microbiote-défenses immunitaires est d’une importance cruciale. Administration d’antibiotiques, tout en aidant l’autorisation de l’agent pathogène, induit également des changements drastiques dans la taille et la composition des communautés de bactéries intestinales qui peuvent avoir un impact sur la santé humaine. Antibiothérapie chez les souris récapitule l’impact et les changements à long terme dans la microflore humaine de patients traités aux antibiotiques et permet l’étude des liens entre les changements dans les communautés microbiennes et la fonction des cellules immunitaires mécanistes. Alors que plusieurs méthodes pour un traitement antibiotique de souris ont été décrites, certains d'entre eux provoquent une déshydratation sévère et perte de poids ce qui complique l’interprétation des données. Ici, nous fournissons deux protocoles pour l’administration d’antibiotiques par voie orale qui peut être utilisée pour le traitement à long terme de souris sans provoquer de perte de poids importante. Ces protocoles utilisent une combinaison d’antibiotiques qui ciblent tant Gram-positive et Gram-bactéries et peuvent être fournis soit ad libitum dans l’eau potable ou par gavage. De plus, on décrit une méthode pour la quantification de densité microbienne dans les fèces par qPCR qui peut être utilisé pour valider l’efficacité du traitement antibiotique. La combinaison de ces méthodes fournit une méthodologie fiable pour la manipulation de la microflore intestinale et l’étude des effets d’un traitement antibiotique chez les souris.

Introduction

La muqueuse gastro-intestinale chez les mammifères est un environnement unique colonisé par un mélange très complexe de micro-organismes qui établissent une relation mutualiste avec l’hôte. Le système de défense de la muqueuse intestinale comprend une couche épithéliale et une pléthore de cellules immunitaires qui restreignent les commensaux dans l’intestin tout en préservant leur nombre et leur diversité. À l’inverse, des organismes commensaux sont nécessaires pour le développement d’un système immunitaire complètement fonctionnel. Tandis que les interactions entre l’hôte et les bactéries commensales sont normalement bénéfiques, il devient de plus en plus évident que dysrégulation immunitaire-microbiote diaphonie peut favoriser le développement de maladies inflammatoires chroniques, telle l’intestin asinflammatory la maladie, l’arthrite ou l’asthme1,2.

Le microbiote intestinal peut être modifié par divers facteurs, mais peut-être les changements plus radicaux sont induits par un traitement antibiotique qui altère gravement la taille et la composition des communautés bactériennes3,4. Tandis que les avantages des antibiotiques pour traiter les infections sont indiscutables, les microbiote les changements induits par l’exposition aux antibiotique chez les humains peuvent également modifier les défenses immunitaires qui peuvent conduire à des effets néfastes sur la santé. Par exemple, un traitement antibiotique chez l’être humain a été associé à un risque accru de Clostridium difficile-induite par la diarrhée, l’asthme et certains types de cancer3. Antibiothérapie chez les souris récapitule l’impact et les modifications à long terme dans les communautés intestinale des patients traités par antibiotiques et a permis l’étude des liens entre les changements dans les communautés microbiennes et la fonction des cellules immunitaires mécanistes. Cependant, plusieurs rapports ont montré que l’administration des antibiotiques sur l' eau potable ad libitum entraîne perte de poids très perceptible comme souris s’abstenir de l’eau potable, probablement en raison de son goût fétide5,6. Ainsi, dans ces modèles, la déshydratation sévère concomitante à l’administration d’antibiotiques par voie orale peut compliquer l’interprétation d’expériences visant à déterminer l’effet d’un traitement antibiotique en fonction des cellules immunitaires.

Plusieurs approches permet d’explorer la taille et la composition des communautés microbiennes dans le compartiment intestinale7. Prochaine génération des technologies de séquençage ont fourni des données précieuses sur cette question8, cependant, ces méthodes sont relativement coûteux et nécessitent des analyses bioinformatiques expert pour l’interprétation des données. En revanche, les méthodes traditionnelles de culture microbiologique de faire une détection des espèces bactériennes, mais ils ont une sensibilité faible et une grande partie des bactéries commensales (en particulier les bactéries anaérobies) sont très difficiles voire impossibles à cultiver avec méthodes actuellement disponibles8. Techniques (qPCR) réaction en chaîne de polymérase quantitative sont plus en plus utilisées pour la quantification et l’identification des espèces de bactéries fécales, puisqu’elles fournissent une mesure indépendante de la culture rapide et fiable de la charge microbienne totale. Par conséquent, les méthodes qPCR sont sont révélés utiles pour étudier les changements de la microflore associée avec l’âge ou avec une progression de plusieurs maladies inflammatoires de l’intestin maladies9,10comprise. Dans cette optique, les méthodes de qPCR fournissent une approche rapide et rentable afin de valider l’effet de divers traitements (y compris les antibiotiques) charges bactériennes fécales et microbiote composition10,11,12.

Nous présentons ici un compte-rendu détaillé étape par étape des deux protocoles distincts pour l’administration d’antibiotiques par voie orale à la souris, prélèvement d’échantillons fécaux, extraction de l’ADN, élaboration de normes et de quantification des bactéries dans les fèces par qPCR. Ces protocoles prévoient une méthode fiable pour manipuler le microbiote intestinal chez les souris et étudier les effets d’un traitement antibiotique dans l’homéostasie intestinale et la maladie.

Protocol

Les expériences décrites ici ont été réalisées à l’aide de 6 à 8 semaines, anciennes souris de type sauvage (C57BL6/J), maintenus dans une usine (SPF) exempte de pathogènes spécifiques. Toutes les expériences animales ont été approuvées par College London le Kings et le bien-être des animaux Institut Francis Crick et organe d’examen éthique, le Home Office du Royaume-Uni. Avant de commencer toute procédure d’animaux, assurez-vous que les autorisations appropriées sont obtenues par le biais de l’institution/organisation locale.

1. l’administration d’antibiotiques

Remarque : Deux méthodes possibles pour un traitement antibiotique sont fournis : gavage oral (étape 1.1) et l’administration d’antibiotiques dans l’eau potable (étape 1.2).

  1. Gavage oral
    1. Préparer des stocks d’antibiotiques individuels en les dissolvant dans l’eau stérilisés à l’autoclave pour les concentrations suivantes : ampicilline à 100 mg/mL, gentamicine à 100 mg/mL, néomycine à 100 mg/mL, métronidazole à 10 mg/mL et la vancomycine à 100 mg/mL. Filtre stériliser à l’aide d’un filtre de 0,45 µm. Aliquote et conserver à-20 ° C.
    2. Préparer un cocktail d’antibiotiques en mélangeant les stocks établis ci-dessus. Pour un volume de 1 mL, mélanger 50 µL d’ampicilline (5 mg/mL en finale), 50 µL de gentamicine (5 mg/mL finale), 50 µL de néomycine (5 mg/mL final), 500 µL de métronidazole (5 mg/mL final), 25 µL de vancomycine (2,5 mg/mL final) et 325 µL d’eau. Préparer le cocktail frais avant utilisation.
    3. Charger le mélange antibiotique dans une seringue stérile 1 mL et fixer une aiguille de gavage de calibre approprié (20 G pour souris de 15 à 20 g) tout en éliminant les bulles.
    4. Souris de gavage avec 200 µL du mélange aux antibiotiques.
      1. Prenez la peau par-dessus l’épaule de souris fermement, étirer la tête et du cou pour redresser le œsophage. Dirigez la boule-la pointe de l’aiguille alimentation le long du toit de la bouche et vers l’arrière du pharynx. Puis, doucement, passez-la vers le bas dans le œsophage et injecter la solution 200 μL.
    5. Administrer les antibiotiques autrefois cocktail tous les jours pendant la durée de l’expérience.
  2. Antibiotiques dans l’eau potable
    ATTENTION : Surveiller attentivement le poids de la souris par jour pour les deux premières semaines de l’administration d’antibiotiques dans l’eau potable.
    1. Préparer un cocktail d’antibiotiques en dissolvant le suit dans 1 L d’eau stérilisés à l’autoclave : 1 g d’ampicilline (1 g/L final), 1 g de néomycine (1 g/L final), 1 g de métronidazole (1 g/L final), 0,5 g de vancomycine (0,5 g/L final) et 8 sachets (0,75 g chacun) d’artificiel édulcorant (60 g/L final). Agiter jusqu'à dissolution. Conserver à 4 ° C.
      NOTE : Édulcorant est ajouté pour masquer la saveur des antibiotiques et de prévenir la déshydratation de la souris. Alors que plusieurs marques édulcorant peuvent fonctionner, la concentration finale requise peut être différente pour chaque marque spécifique.
    2. Verser le cocktail aux antibiotiques dans une bouteille d’eau (~ 100 mL/bouteille) et placer le flacon sur une cage de la souris.
      Remarque : Utilisez des bouteilles brunes ou couvrir les bouteilles avec une feuille pour protéger les antibiotiques contre la lumière.
    3. Remplacer le cocktail antibiotique avec stock frais deux fois par semaine pendant la durée de l’expérience.

2. la collecte d’échantillons de matières fécales de selles, le contenu de l’iléon et iléon mur

  1. Peser et identifier 2 mL tubes stérilisés à l’autoclave pour prélèvement d’échantillons.
  2. Pour la collecte d’échantillons de selles fraîches, placez chaque souris dans une drisse et recueillir les pelotes fécales directement de l’anus dans un tube de prélèvement.
    NOTE : Échantillons peuvent également être obtenus en plaçant la souris dans une cage propre autoclavée et le prélèvement d’échantillons de selles avec une pince stérile propre.
  3. Euthanasier les souris avec CO2 asphyxie suivie par dislocation cervicale.
  4. Posez une carcasse de souris avec l’abdomen entièrement exposé et pulvériser la région abdominale avec l’éthanol à 70 %.
  5. À l’aide de ciseaux et pinces stérilisées, pratiquer une incision transversale dans l’abdomen pour exposer le péritoine sans endommager les tissus internes. Soulevez le péritoine et pratiquer une incision pour exposer les intestins.
  6. Retirez les intestins (du côlon vers l’estomac) avec les pinces et ciseaux et placez-le dans une boîte de Petri stérile.
  7. Utilisez soigneusement pinces pour taquiner l’intestin grêle (SI) loin des artères mésentériques et du gras. Étendre l’intestin et le placer sur un chiffon propre laboratoire.
  8. Avec une règle, mesurez et coupez 4 cm de l’iléon distal de l’is (la partie la plus proche pour le caecum). Couper et jeter les 1 cm de l’intestin proximal au caecum. Il y aura une partie de 3 cm d’iléon à gauche qui sera utilisé pour recueillir les bactéries intestinales.
  9. Placez la partie de l’iléon (3 cm) sur un tube stérile de 2 mL. Recueillir le contenu intestinal en extrudant directement l’intestin et rassemblions l’échantillon dans le tube. Cet exemple aura des bactéries présentes dans le contenu de l’iléon.
  10. Préparer une seringue de 20 mL avec du sérum physiologique froid tamponnée au phosphate (PBS), puis rincez la partie de l’iléon (jeter le cheminement).
  11. Placer la partie de l’iléon sur une serviette en papier propre et ouvrez-le longitudinalement avec des ciseaux.
  12. Gratter l’intérieur de la paroi de l’iléon avec un scalpel.
  13. Collecter toutes les bactéries sur le scalpel en lavant le scalpel avec 1 mL de PBS dans un tube à centrifuger propre. Tourner à 8 000 × g pendant 5 min pour les bactéries de granule et éliminer le surnageant. Cet exemple contient des bactéries provenant de la paroi de l’iléon.
    Remarque : Des échantillons de selles, le contenu de l’iléon et mur peuvent être congelées et conservées à-80 ° C jusqu'à l’utilisation.
  14. Peser les tubes contenant les échantillons de selles et l’iléon contenu et de soustraire le poids des tubes vides (à l’étape 2.1) pour obtenir le poids fécal dans chaque échantillon.
  15. Extraire l’ADN bactérien de selles, de contenu de l’iléon et d’iléon mur échantillons utilisant des kits disponibles dans le commerce. Conserver les échantillons d’ADN à-20 ° C jusqu'à l’utilisation.

3. quantification du microbiote Intestinal de qPCR

Remarque : Cette procédure inclut la génération d’une norme (étape 3.1) et la méthode de mise en place de qPCR pour les échantillons les et standards (étape 3.2)

  1. Génération d’une norme pour qPCR
    1. Réaction en chaîne par polymérase (PCR) permet d’amplifier le gène de l’ARNr 16 s de l’ADN génomique extrait d’une culture bactérienne en utilisant les réactifs13 et les conditions PCR détaillés dans le tableau 1.
    2. Exécuter le produit PCR sur un gel d’agarose de 1,5 % et purifier la bande d’ADN à l’aide d’un kit d’extraction d’ADN disponible dans le commerce.
    3. Ligaturer le purifiée fragment d’ADN utilisant un clonage kit (voir la Table des matières, utilisez un vecteur contenant les marqueurs de résistance aux antibiotiques et fusion de gènes β-galactosidase (LacZ) pour la sélection de la colonie de bleu/blanc) et transformer DH10 compétente E. coli suivant les instructions du fabricant. Plaque de transformation sur l’ampicilline (100 µg/mL), des plaques de gélose Luria Bertani (LB) X-gal (20 µg/mL) (10 g/L Tryptone, 5 g/L, extrait de levure, 10 g/L de NaCl, 15 g/L Agar). Incuber pendant la nuit (O/N) à 37 ° C.
    4. Choisir une colonie seul positifs (blanc) de la plaque. Il inoculer dans 5 mL de bouillon de LB contenant 100 µg/mL d’ampicilline et incuber O/N à 37 ° C, agitation à 250 tr/min.
    5. De la culture O/N, isoler et purifier le plasmide à l’aide d’une trousse commerciale miniprep conformément aux instructions du fabricant.
      Remarque : Il est important de la séquence de l’insert de plasmide à ce stade, pour s’assurer que le plasmide ne contienne qu’une seule copie du gène de l’ARNr 16 s et déterminer sa longueur en paires de bases (bp).
    6. Linéariser le plasmide avec une enzyme de restriction qui coupe le plasmide qu’une seule fois.
    7. Purifier le plasmide linéarisé à l’aide d’un kit disponible dans le commerce.
    8. Déterminer la concentration du plasmide par mesurer l’absorbance à 260 nm à l’aide d’un spectrophotomètre.
    9. Calculer le nombre de copies de plasmide/µL de l’échantillon à l’aide de la formule suivante14:
      nombre d’exemplaires = (quantité * 6.022 × 1023) / (longueur * 1 × 109 * 650)
      Lorsque le montant est la concentration d’ADN obtenue à l’étape 3.1.8 (en ng/µL) ; et la longueur est la longueur totale du plasmide (avec l’insert) dans bp. Le nombre d’exemplaires sera obtenue comme copies/µL.
      Remarque : Il existe des outils en ligne basés sur la formule ci-dessus qui permettent le calcul simple du nombre de copies de plasmide.
    10. Aliquote et magasin la norme au besoin à-20 ° C jusqu'à l’utilisation.
  2. qPCR Set-up pour Standard et des échantillons de matières fécales
    1. Décongeler le qPCR standard (de l’étape 3.1.10), les échantillons de matières fécales ADN (de l’étape 2.15) et les réactifs de qPCR (partir d’un kit disponible dans le commerce) sur la glace.
      Remarque : qPCR réactifs utilisés dans cet exemple comprennent le mélange de réaction de qPCR SYBR Green et les amorces et inverses (tableau 2).
    2. Diluer la norme dans l’eau stérile sans ADN dans une gamme de 107 à 102 copies/µL (p. ex., 1/5 des dilutions de 107 à 6,4 x 102 copies/µL). Diluer les échantillons fécaux ADN à 1/2, 1/5, 1/10.
    3. Faire une réaction mélange principal pour le nombre total de réactions plus 1 (tableau 2).
    4. Mix 30 µL du mélange maître et 5 µL de modèle (standard, échantillon ou eau pour contrôle négatif)
    5. Ajouter 10 µL de ce mélange dans chaque puits dans une plaque 384 puits optique qPCR. Effectuer chaque réaction en trois exemplaires.
    6. Sceller l’endroit qPCR, centrifuger brièvement et charger la plaque sur la machine de qPCR programmée dans les conditions suivantes de cyclisme : 95 ° C pendant 20 min suivi de 40 cycles de 95 ° C pour 15 s et 60 ° C pendant 1 min.
    7. Obtenir les valeurs de CT pour standard et échantillons.
    8. Générer une courbe d’étalonnage en traçant les valeurs de CT pour les normes contre le logarithme du nombre copie du plasmide (tel que calculé à l’étape 3.1.9). Effectuer une régression linéaire de la courbe standard.
    9. Calculer le nombre de copies des ADNr 16 s pour les échantillons de matières fécales en interpolant les valeurs de CT (obtenus à l’étape 3.2.2) dans la courbe d’étalonnage.
      NOTE : nombre de copies ADNr 16 s pour chaque échantillon doit être corrigé en tenant compte du facteur de dilution de l’échantillon (tel qu’établi à l’étape 3.2.2), les volume final des acides nucléiques qui sont éluées (à l’étape 2.15) et la quantité d’échantillon fécal (calculée en étape 2.14) pour obtenir copies du gène par gramme de fèces.

Representative Results

Ici, nous fournissons deux protocoles alternatifs pour un traitement antibiotique oral de souris. La figure 1 montre le pourcentage de poids corporel (lié au poids initial de ligne de base pour chaque animal) chez les souris traitées avec des antibiotiques par gavage oral (rouge) ou dans l’eau potable (bleu) pendant 10 jours consécutifs. Aucune perte de poids notable ne se trouve chez des souris qui reçoivent des antibiotiques par gavage. Cependant, lorsque les souris sont traitées avec des antibiotiques, ad libitum , dans l’eau potable, ils perdent du poids (environ 10 %) dans les premiers jours de l’administration d’antibiotiques, mais récupérer le gain de poids normal par la suite (Figure 1). Néanmoins, environ 5 à 10 % des souris ayant reçu des antibiotiques dans l’eau potable peut atteindre > 20 % la perte de poids au sein de la première semaine de traitement, auquel cas ils sont euthanasiés.

La quantification des bactéries dans des échantillons les nécessite l’utilisation d’une courbe d’étalonnage adéquate qui est obtenue en traçant le log du nombre de copies pour le standard (tel que calculé à l’étape 3.2.2) contre les valeurs de CT provenant de qPCR (étape 3.2.7). Figure 2 a montre un exemple représentatif d’une courbe standard qui répond aux critères de performance de courbe d’étalonnage avec une valeur de2 R de 0.99827, une pente de-3.09 et d’une efficacité ((-1 + 10^(-1/slope))*100) de 110 %. R2 valeurs de 0,99 et efficacité PCR au sein de l’ordre de 90 à 110 % sont préférés. Dans la gamme linéaire, l’équation d’analyse de régression permet de quantifier l’abondance d’ADNr 16 s dans les échantillons de matières fécales. Figure 2 b indique le nombre de copies d’ADNr 16 s en tabouret fécal, teneur en SI et mur SI. Figure 2 b, les données apparaissent comme 16 s rDNA copies/g d’échantillon fécal pour tabouret fécal et le contenu de SI. Pour le mur SI, les données sont présentées sous forme de nombre total d’exemplaires d’ADNr 16 s provenant de bactéries provenant de la 3 cm du mur SI (comme la quantité de matériel de départ est trop petite pour obtenir un poids précis).

Pour évaluer l’effet des antibiotiques sur la densité des bactéries dans des échantillons les, souris ont été traitées avec des antibiotiques par gavage tous les jours pendant 10 jours (jours 1 à 10) et les échantillons de selles ont été recueillies avant (jour 0), à différents moments au cours d’un traitement antibiotique ( 5 et 10 jours) et 7 jours après l’arrêt de l’administration antibiotique (jour 17 ; Figure 3 a). Comme le montre la Figure 3 b, un traitement antibiotique induit une forte diminution du nombre de 16 s rDNA copies/g de fèces détecté aux jours 5 et 10, alors que la densité des bactéries dans les matières fécales récupérées à des niveaux normaux (comparables au prétraitement) 1 semaine après administration d’antibiotiques a été arrêtée (17 jours).

Figure 1
Figure 1 : Administration d’antibiotiques. Des souris ont reçu des antibiotiques par gavage oral (rouge) ou dans l’eau potable (bleu) pendant 10 jours consécutifs. Graphique montre le poids des souris pendant toute la durée des expériences par rapport au poids initial avant l’administration d’antibiotiques (jour 0). Les données apparaissent comme moyenne ± SEM. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : amplification de qPCR gène ARNr 16 s des normes et des échantillons fécaux. (A) régression linéaire de la courbe d’étalonnage avec les descripteurs de la courbe d’étalonnage. (B) calcul des abondances de gène d’échantillons de matières fécales. Les données apparaissent comme moyenne ± SEM. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : les bactéries fécales au cours d’un traitement antibiotique. Schéma (A) de l’annexe pour l’administration d’antibiotiques par gavage oral (Ab) et prélèvement tel que représenté avec *. (B) 16 s rDNA copie par gramme de fèces dans les échantillons de selles provenant de souris prélevés aux jours indiqués. Les données apparaissent comme moyenne ± SEM. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Réactif Volume
ADN 8 ΜL
Tampon 10 X 2 ΜL
dNTPs (10mM) 0,4 ΜL
Eubactéries - apprêt F (10 mM) 1 ΜL
Eubactéries - primer R (10 mM) 1 ΜL
Amplification de la Taq 0.2 ΜL
H2O 7,4 ΜL
Volume total 20 ΜL
Séquences d’amorces
Eubactéries - apprêt F 5' ACTCCTACGGGAGGCAGCAGT 3'
Eubactéries - primer R 5' ATTACCGCGGCTGCTGGC 3'
Conditions de cyclisme
Température Temps Cycles
94 ° C 5 min 1 x
94 ° C 30 s 10 :
60 ° C 30 s 10 :
72 ° C 1 min 10 :
72 ° C 5 min 1 x
4 ° C 1 x

Tableau 1 : PCR réactifs et conditions de. Ce tableau fournit les réactifs et les conditions de cyclisme de PCR pour amplifier le gène ARNr 16 s de culture bactérienne pour la production d’une norme à utiliser dans les essais de qPCR. Séquences d’amorces ont été initialement publiés par Kruglov et al. 13.

Réactif Volume
Mix master SYBR Green (2 x) 17.5 ΜL
Eubactéries - apprêt F (10 mM) 0.7 ΜL
Eubactéries - primer R (10 mM) 0.7 ΜL
H2O 11.1 ΜL

Tableau 2 : mélange maître qPCR. Les volumes illustrés (volume final 35 µL) sont pour un seul échantillon exécutera trois exemplaires (10 µL de chaque) sur une plaque 384 puits qPCR (représentant supplémentaire pour pipetage erreur 5 µL). Le montant peut être ajustée vers le haut selon le nombre d’échantillons à analyser.

Discussion

Ici nous fournissons protocoles expérimentaux pour l’administration orale d’antibiotiques à des souris et de quantification des bactéries fécales de qPCR. La combinaison d’antibiotiques utilisés dans les cibles de ce protocole (contenant l’ampicilline, gentamicine, néomycine, métronidazole et vancomycine) des bactéries Gram-positives et Gram-négatives, offrant une activité bactéricide contre un éventail de bactéries. Gavage oral et l’administration d’antibiotiques dans l’eau potable grandement diminuent les bactéries fécales charger5,6,12. En outre, les deux traitements ont un effet profond sur le phénotype des souris qu’ils développent plusieurs caractéristiques typiques des souris axéniques, y compris la taille de la rate réduite et le caecum élargi. La sélection d’une méthode particulière pour l’administration d’antibiotiques peut éventuellement dépendre de la durée de l’expérience comme la méthode de gavage oral exige une administration quotidienne d’antibiotiques, étant beaucoup plus de travail et éventuellement plus gênants pour la animaux dans le long terme.

Pour l’administration d’antibiotiques dans l’eau potable, mise en garde s’imposent avec l’ajout de l’édulcorant au mélange antibiotique car il s’agit d’un facteur crucial pour empêcher la souris de déshydratation. Plusieurs groupes ont montré comment l’administration d’antibiotiques dans l’eau potable (sans ajout de sucre) entraîne très sévère et rapide perte de poids avec toutes les souris perdre plus de 20 % du poids corporel initial dans les premiers jours de l' expérience5 , 6. dans notre protocole, l’utilisation de l’édulcorant à base de saccharine semblait suffisante masquer le goût antibiotiques dans l’eau et les souris ont perdu du poids dans les premiers jours après l’administration d’antibiotiques, mais récupéré leurs poids rapidement après cette ( Figure 1). Néanmoins, dans nos expériences 5 à 10 % des souris encore atteindre l’objectif humain, soit de > 20 % de perte de ligne de base du poids corporel et devaient être euthanasiés. Nous avons aussi testé les édulcorants axée sur le sucralose qui a complètement omis de prévenir la déshydratation de la souris (100 % des souris perdues > 20 % du poids) tandis que d’autres auteurs ont publié des défaillances semblables pour les édulcorants aspartame basée sur5,6. Ajouté à cela, l’âge, la génétique et l’état de santé général des souris utilisées pour les expériences devraient considérer, comme elles peuvent influencer la perte de poids et de bien-être des animaux pendant un traitement antibiotique. Ainsi, un suivi attentif du poids de la souris et l’état de santé général doit être effectué tous les jours pendant les deux premières semaines de l’administration d’antibiotiques par voie orale.

les méthodes de qPCR fournissent une approche rapide et rentable pour la quantification des ARNr 16 s dans les fèces. Toutefois, certaines limitations sont à considérer au sujet de cette technique, y compris : i) la nécessité d’une norme de qualité fiable ; II) la conception et l’efficacité des amorces qPCR ; III) le fait que les micro-organismes peuvent avoir le nombre de copies différentes du gène de l’ARNr 16 s, donc copies du gène ne peuvent pas directement égale à cell compte15. Néanmoins, qPCR est une méthode robuste et sensible qui permet l’analyse rapide des échantillons de matières fécales. Cette méthode peut être particulièrement utile pour valider rapidement l’effet de divers traitements (y compris les antibiotiques) charge bactérienne fécale comme détaillé ici. En outre, même si nous fournissons un protocole de quantification du total 16 s ARNr, cette méthode peut être facilement adaptée (en concevant des amorces spécifiques16) à permettre l’identification des taxons bactériens individuels, fournissant ainsi les deux quantitative et informations qualitatives sur microbiome taille et la composition.

En résumé, nous avons fourni deux protocoles d’antibiothérapie orale de souris et une méthode pour quantifier les changements induits par antibiotiques chez les bactéries fécales qPCR. Bien que ces protocoles peuvent être optimisés et combinées avec d’autres approches selon les différents besoins expérimentaux, ils peuvent servir d’outils rapides, rentables et fiables pour manipuler la microflore intestinale murine et étudier des effets d’un traitement antibiotique dans l’homéostasie intestinale et la maladie.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Ce travail a été financé par le Conseil de recherches médicales de la UK (subvention de M. P.B./L008157/1) ; R.J. bénéficiait d’une bourse Marie Curie intra-européenne (H2020-ACEM-IF-2015-703639) ; P.m.B. est soutenu par une bourse d’étude par le Medical Research Council du Royaume-Uni et College London partenariat du roi formation doctorale en Sciences biomédicales (MR/N013700/1).

Materials

Name Company Catalog Number Comments
Ampicillin sodium salt Sigma-Aldrich (Merck) A9518
Neomycnin trisulfate salt hydrate Sigma-Aldrich (Merck) N1876
Metronidazole Sigma-Aldrich (Merck) M3761
Vancomycin hydrochloride Sigma-Aldrich (Merck) V2002
Gentamicin sulfate salt Sigma-Aldrich (Merck) G3632
Tryptone Sigma-Aldrich (Merck) T7293
Yeast Extract Sigma-Aldrich (Merck) Y1625
NaCL Sigma-Aldrich (Merck) S7653
Sweetener Sweet'n Low Sweet'N Low Available in the UK from Amazon.co.uk
X-Gal (5-brom-4-chloro-3-indoyl B-D-galactopyranoside) Fisher scientific 10234923
Phosphate Buffered Saline  Thermo Fisher Scientific (Gibco) 10010023
Ultrapure Agarose Thermo Fisher Scientific (Invitrogen) 16500500
RT-PCR grade water Thermo Fisher Scientific (Invitrogen) AM9935
Phusion High-Fidelity DNA Polymerase New England BioLabs M0530
Deoxynucleotide (dNTP) Solution Mix New England BioLabs N0447
iTaq Universal SYBR Green Supermix Bio-Rad 1725124 with ROX
TOPO TA cloningTM for sequencing Thermo Fisher Scientific (Invitrogen) 450030
QIAamp fast DNA Stool mini kit  Qiagen 51604
QIAprep spin Miniprep kit Qiagen 27106
QIAquick gel  extraction kit Qiagen 28704
Syringe filter 0.45 µm Fisher scientific 10460031
Swann-MortonTM Carbon steel sterile scalpel blades Fisher scientific 11792724
Syringe (1 mL) BD Plastipak 303172
Syringe (20 mL) BD Plastipak 300613
1.5 mL Crystal clear microcentriguge tube StarLab E1415-1500
2 mL Ultra high recovery microcentrifuge tube StarLab I1420-2600
Oral dosing needles 20 G x 38 mm curved (pk/3) Vet-Tech DE008A
Sterilin petri dish 50 mm  Scientific Laboratory Supplies PET2020
Absolute qPCR plate seals Thermo Fisher Scientific AB1170
MicroAmpTM optical 384-well plate  Thermo Fisher Scientific (Applied Biosystems) 4309849
ViiA7TM 7 real-time PCR system with 384-well block Thermo Fisher Scientific (Applied Biosystems) 4453536
Spectrophotometer (Nanodrop 1000) Thermo Fisher Scientific ND-1000
Labnet Prism microcentrifuge Labnet C2500
MultiGene Optimax Thermal cycler Labnet TC9610

DOWNLOAD MATERIALS LIST

References

  1. Belkaid, Y., Hand, T. W. Role of the microbiota in immunity and inflammation. Cell. 157, (1), 121-141 (2014).
  2. Hooper, L. V., Littman, D. R., Macpherson, A. J. Interactions between the microbiota and the immune system. Science. 336, (6086), 1268-1273 (2012).
  3. Ubeda, C., Pamer, E. G. Antibiotics, microbiota, and immune defense. Trends in Immunology. 33, (9), 459-466 (2012).
  4. Dethlefsen, L., Huse, S., Sogin, M. L., Relman, D. A. The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biology. 6, (11), e280 (2008).
  5. Reikvam, D. H., et al. Depletion of murine intestinal microbiota: effects on gut mucosa and epithelial gene expression. PLoS One. 6, (3), e17996 (2011).
  6. Hill, D. A., et al. Metagenomic analyses reveal antibiotic-induced temporal and spatial changes in intestinal microbiota with associated alterations in immune cell homeostasis. Mucosal Immunology. 3, (2), 148-158 (2010).
  7. Fraher, M. H., O'Toole, P. W., Quigley, E. M. Techniques used to characterize the gut microbiota: a guide for the clinician. Nature Reviews Gastroenterology & Hepatology. 9, (6), 312-322 (2012).
  8. Eckburg, P. B., et al. Diversity of the human intestinal microbial flora. Science. 308, (5728), 1635-1638 (2005).
  9. Sokol, H., et al. Low counts of Fecalibacterium prausnitzii in colitis microbiota. Inflammatiry Bowel Diseases. 15, (8), 1183-1189 (2009).
  10. Bartosch, S., Fite, A., Macfarlane, G. T., McMurdo, M. E. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Applied Environmental Microbiology. 70, (6), 3575-3581 (2004).
  11. Ubeda, C., et al. Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. Journal of Clinical Investigation. 120, (12), 4332-4341 (2010).
  12. Saez de Guinoa, J., et al. CD1d-mediated lipid presentation by CD11c(+) cells regulates intestinal homeostasis. EMBO Journal. 37, (5), (2018).
  13. Kruglov, A. A., et al. Nonredundant function of soluble LTalpha3 produced by innate lymphoid cells in intestinal homeostasis. Science. 342, (6163), 1243-1246 (2013).
  14. Wilhelm, J., Pingoud, A., Hahn, M. Real-time PCR-based method for the estimation of genome sizes. Nucleic Acids Research. 31, (10), e56 (2003).
  15. Kembel, S. W., Wu, M., Eisen, J. A., Green, J. L. Incorporating 16S gene copy number information improves estimates of microbial diversity and abundance. PLoS Computational Biology. 8, (10), e1002743 (2012).
  16. Yang, Y. W., et al. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces. Applied Environmental Microbiology. 81, (19), 6749-6756 (2015).
Analyses de polymérase quantitative axée sur la réaction en chaîne de murin microbiote Intestinal après un traitement antibiotique par voie orale
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).More

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter