Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

פולימראז כמותי המבוסס על תגובת שרשרת ניתוחים של מאתר Microbiota מעיים לאחר טיפול אנטיביוטי דרך הפה

doi: 10.3791/58481 Published: November 17, 2018

Summary

כאן אנו מספקים נתונים היסטוריים פרוטוקולים עבור המינהל אנטיביוטיקה דרך הפה עכברים, איסוף דגימות צואה, הפקת דנ א, כימות של צואה חיידקים על ידי qPCR.

Abstract

Microbiota הבטן יש השפעה מרכזית על בריאות האדם. חיידקים dysbiosis קשורה immunopathologies נפוצות רבות כגון מחלות מעי דלקתיות, אסתמה ודלקת פרקים. לפיכך, הבנת המנגנונים שבבסיס crosstalk המערכת החיסונית microbiota היא בעלת חשיבות מכרעת. ניהול לאנטיביוטיקה, תוך סיוע סיווג הפתוגן, גורם גם שינויים דרסטיים גודלו והרכבו של קהילות חיידקי מעיים, אשר יכול להשפיע על בריאות האדם. טיפול אנטיביוטי בעכברים recapitulates את ההשפעה ושינויים לטווח ארוך microbiota האנושי מחולים שטופלו באנטיביוטיקה, מאפשר חקירה של הקישורים מכניסטית בין שינויים בקהילות מיקרוביאלית ותפקוד תאי מערכת החיסון. בעוד מספר שיטות טיפול אנטיביוטי של עכברים תוארו, חלק מהם לגרום התייבשות חמורה, במשקל שמסבך את הפרשנות של הנתונים. כאן, אנו מספקים שני פרוטוקולים עבור ניהול אנטיביוטי דרך הפה אשר יכול לשמש לטיפול לטווח ארוך של עכברים ללא גרימת אובדן משקל גדול. פרוטוקולים אלה להשתמש בשילוב של אנטיביוטיקה את המטרה גראם חיוביים והן גראם שליליים חיידקים, ניתן לספק גם ad libitum במי השתייה או על-ידי gavage דרך הפה. יתר על כן, אנו מתארים שיטה כימות של צפיפות מיקרוביאלי דגימות צואה על-ידי qPCR אשר יכול לשמש כדי לאמת את היעילות של טיפול אנטיביוטי. השילוב של גישות אלה מספק מתודולוגיה אמינה המניפולציה של microbiota מעיים המחקר של ההשפעות של טיפול אנטיביוטי בעכברים.

Introduction

רירית מערכת העיכול יונקים מהווה סביבה ייחודית בידי תערובת מורכבת מאוד של המיקרואורגניזמים ליצור מערכת יחסים mutualistic עם המחשב המארח. ? מערכת ההגנה של רירית המעי כוללת שכבת האפיתל, שפע של תאים חיסוניים שמגבילות את commensals בתוך המעי תוך שמירה על מספר והמגוון שלהם. לעומת זאת, אורגניזמים commensal נדרשים להתפתחות של מערכת החיסון מתפקדת במלואה. בעוד אינטראקציות בין המארח לבין חיידקים commensal הם בדרך כלל מועיל, שזה ברור יותר ויותר ש-crosstalk המערכת החיסונית-microbiota הזה dysregulated יכול להעדיף התפתחות מחלות דלקתיות כרוניות, כגון המעי asinflammatory מחלה, דלקת מפרקים או אסטמה1,2.

ניתן לשנות את microbiota הבטן על ידי גורמים שונים, אבל אולי שינויים דרסטיים ביותר הם המושרה על ידי טיפול אנטיביוטי שמשנה קשות הן את גודל והרכב של קהילות חיידקי3,4. היתרונות של אנטיביוטיקה לטיפול בדלקות אמנם מוטלת בספק, השינויים microbiota הנגרם על ידי חשיפה לאנטיביוטיקה בבני אדם ניתן גם לשנות מערכות ההגנה החיסוניות אשר יכול להוביל השפעות מזיקות על הבריאות. למשל, טיפול אנטיביוטי בבני נקשר לסיכון מוגבר של Clostridium difficile-induced שלשולים, אסטמה, סוגים מסוימים של סרטן3. טיפול אנטיביוטי בעכברים recapitulates השפעה והשינויים לטווח ארוך נמצאו קהילות הבטן של חולים שטופלו אנטיביוטיקה, אפשרה החקירה של הקישורים מכניסטית בין שינויים בקהילות מיקרוביאלית ותפקוד תאי מערכת החיסון. עם זאת, מספר דיווחים הראו כי הניהול של אנטיביוטיקה על מי השתייה ad libitum מתבטא במשקל מורגש מאוד כמו עכברים מהפעלת שתיית מים, ככל הנראה עקב שלה טעם עבירה5,6. לפיכך, במודלים אלה התייבשות חמורה והמצוות למינהל אנטיביוטי אוראלי עשוי לסבך את הפרשנות של ניסויים במטרה לזהות את ההשפעה של טיפול אנטיביוטי בתפקוד תאי מערכת החיסון.

מספר גישות יכול לשמש כדי לחקור את גודלו והרכבו של יישובים מיקרוביאלית מעיים תא7. הדור הבא טכנולוגיות רצף סיפקו נתונים שלא יסולא בפז על העניין הזה8, עם זאת, שיטות אלה יקרים יחסית, דורשת ניתוח bioinformatic מומחה לפרשנויות של הנתונים. מצד שני, התרבות המסורתית מיקרוביולוגית, ומאפשרים זיהוי המינים חיידקי, אבל יש להם רגישות נמוכה, חלק גדול של חיידקים commensal (במיוחד anaerobes) הם מאוד קשה או בלתי אפשרי לטפח עם שיטות זמין כרגע8. טכניקות כמותיות פולימראז תגובת שרשרת (qPCR) נמצאים בשימוש יותר ויותר עבור כימות וזיהוי מינים חיידקי צואה, כפי שהם מספקים מדד שאינו תלוי-תרבות מהירה ואמינה של עומס מיקרוביאלי הכולל. בהתאם לכך, שיטות qPCR הוכיחו מועיל ללמוד לשינויים microbiota עם הגיל או עם התקדמות של מספר מחלות כולל9,של מחלות מעי דלקתיות10. בקו זה, שיטות qPCR מספקים גישה מהירה וחסכונית כדי לאמת את ההשפעה של טיפולים שונים (כולל אנטיביוטיקה) נטען חיידקי צואה, microbiota הרכב10,11,12.

כאן, אנחנו מציגים דין וחשבון מפורט שלב אחר שלב שני פרוטוקולים ברורים לניהול אנטיביוטי אוראלי עכברים, אוסף דגימת צואה, הפקת דנ א, הכנת תקנים, כימות של חיידקים דגימות צואה על-ידי qPCR. פרוטוקולים אלה מספקות שיטה אמינה לתמרן את microbiota מעיים בעכברים וכדי ללמוד ההשפעות של טיפול אנטיביוטי ב הומאוסטזיס מעיים ומחלות.

Protocol

הניסויים המתוארים כאן בוצעו באמצעות 6-8 שבועות עכברים (C57BL6/J) פראי-סוג הישן נשמר במתקן (SPF) חינם פתוגן מסוים. ניסויים בבעלי חיים כל אושרו על-ידי קולג '-לונדון המלך, את פרנסיס קריק המכון צער ואת גוף ביקורת אתית המשרד הממלכה המאוחדת. לפני תחילת כל שגרת חיים, ודא כי ההרשאות המתאימות מתקבלים באמצעות הארגון/המוסד מקומי.

1. ניהול של אנטיביוטיקה

הערה: בשתי שיטות חלופיות לטיפול אנטיביוטי מסופקים: אוראלי gavage (שלב 1.1) וניהול של אנטיביוטיקה באמצעות שתיית מים (שלב 1.2).

  1. Gavage שבעל-פה
    1. הכנת המלאי של אנטיביוטיקה בודדים על ידי המסת אותם במים בלוק בריכוזים הבאים: אמפיצילין-100 מ"ג/מ"ל, גנטמיצין ב 100 מ"ג/מ"ל, Neomycin-100 מ"ג/מ"ל, מטרונידזול-10 מ"ג/מ"ל, ואנקומיצין ב 100 מ"ג/מ"ל. מסנן לחטא באמצעות מסנן 0.45 מיקרומטר. Aliquot וחנות ב-20 ° C.
    2. להכין קוקטייל של אנטיביוטיקה על ידי ערבוב את המניות המוכן מעל. עבור אמצעי אחסון של 1 מ"ל מערבבים 50 µL של אמפיצילין (5 מ"ג/מ"ל הסופי), µL 50 של גנטמיצין (5 מ"ג/מ"ל הסופי), 50 µL של Neomycin (5 מ"ג/מ"ל הסופי), µL 500 של מטרונידזול (5 מ"ג/מ"ל הסופי), µL 25 של ונקומיצין (2.5 מ"ג/מ"ל הסופי) ו- 325 µL של מים. להכין הטרייה קוקטייל לפני השימוש.
    3. לטעון את התמהיל לאנטיביוטיקה לתוך מזרק 1 מ"ל סטרילי ותקן של מחט gavage בקוטר המתאים (20 גרם במשך 15-20 g עכברים) תוך צמצום בועות.
    4. Gavage עכברים עם 200 µL של שילוב אנטיביוטיקה.
      1. . תפוס את העור מעל הכתף העכבר בחוזקה, למתוח את הראש והצוואר כדי לסדר את הוושט. כוונו את הכדור-קצה המחט האכלה לאורך הגג של הפה, לכיוון החלק האחורי של הלוע. . ואז, בעדינות. תעבירו לתוך הוושט, להזריק את הפתרון 200 μL.
    5. לנהל פעם קוקטייל אנטיביוטיקה כל יום משך זמן הניסוי.
  2. אנטיביוטיקה במי השתייה
    התראה: לפקח בקפידה על משקל העכבר מדי יום במשך השבועיים הראשונים של הממשל לאנטיביוטיקה במי השתייה.
    1. להכין קוקטייל של אנטיביוטיקה על ידי המסת הבאות בקובץ 1 ליטר של מים בלוק: 1g של אמפיצילין (1 g/L הסופי), 1g של Neomycin (1 g/L הסופי), 1g של מטרונידזול (1 g/L הסופי), 0.5 גר' ונקומיצין (0.5 g/L הסופי) ו- 8 שקיות (0.75 גר' כל אחד) של מלאכותי ממתיק (60 g/L הסופי). לנער עד התפרקה. חנות ב 4 º C.
      הערה: ממתיק נוסף כדי להסתיר את הטעם של אנטיביוטיקה ולמנוע התייבשות עכברים. בעוד מספר ממתיק מותגים עשוי לעבוד, הריכוז הסופי הנדרש עשוי להיות שונה עבור כל מותג מסוים.
    2. למלא את הקוקטייל לאנטיביוטיקה לתוך בקבוק מים (~ 100 מ"ל/בקבוקים) ומניחים את הבקבוק על כלוב עכבר.
      הערה: השתמש חום בקבוקים או לכסות את הבקבוקים עם נייר כסף על אנטיביוטיקה מפני אור.
    3. החלף את הקוקטייל לאנטיביוטיקה מניות טריים פעמיים בשבוע למשך של הניסוי.

2. איסוף דגימות צואה של צואה, תוכן מעי מעי קיר

  1. שוקל, תווית 2 mL צינורות בלוק לאיסוף הדגימה.
  2. אוסף של דגימות צואה טרייה, למקם את העכבר כל restrainer ולאסוף כדורי צואה ישירות מפי-הטבעת בשפופרת איסוף.
    הערה: דוגמאות ניתן להשיג על ידי הצבת עכברים בתוך כלוב נקי בלוק, איסוף דגימות צואה עם מלקחיים סטיריליים נקי.
  3. המתת חסד העכברים עם CO2 חנק ואחריו נקע בצוואר הרחם.
  4. שכב לגוויה העכבר בבטן חשוף לגמרי, לרסס את אזור הבטן עם 70% אתנול.
  5. בעזרת מלקחיים סטיריליים ומספריים, עושים חתך רוחבי על הבטן כדי לחשוף את הצפק מבלי לפגוע בכל רקמות פנימיות. הרם את הצפק, בחתך לחשוף את המעיים.
  6. הסר את המעיים (מן המעי הגס לבטן) עם מלקחיים, מספריים ולמקם אותו בצלחת פטרי סטריליות.
  7. להשתמש בזהירות מלקחיים להתגרות המעי הדק (SI) העורקים מצע המעי העליון ו- fat. להרחיב את המעי ומניחים אותו על מחיקה מעבדה נקייה.
  8. עם סרגל, למדוד ולחתוך 4 ס מ של מעי דיסטלי של סי (החלק הקרוב ביותר אל המעי). חותכים וזורקים 1 ס מ של המעי מקורב אל המעי. יהיו חלק 3 ס מ של מעי עזב אשר ישמש כדי לאסוף חיידקים במעיים.
  9. החזק את חלק המעי העקום (3 ס מ) על צינור סטרילי 2 מ"ל. לאסוף את תוכן המעי על ידי הבלטת ממד ישירות על המעי ועל לאיסוף הדגימה בצינור. דוגמה זו יהיו חיידקים מהתוכן מעי.
  10. להכין מזרק 20 מ עם פוספט קרות באגירה סליין (הציבורי), להוריד את חלק המעי העקום (להשליך הזרימה דרך).
  11. מניחים את החלק העקום על מגבת נייר נקי ולפתוח אותה longitudinally עם מספריים.
  12. לגרד הפנימי של הקיר מעי עם אזמל.
  13. לאסוף את כל החיידקים על האזמל בכך שתרחץ את האזמל עם 1 מ"ל של PBS מעל שפופרת צנטרפוגה נקי. ספין-× 8000 g עבור 5 דקות כדי הצניפה החיידקים ולמחוק את תגובת שיקוע. דוגמה זו יכילו חיידקים מהקיר מעי.
    הערה: דגימות צואה צואה, תוכן מעי וקיר יכול להיות קפוא ומאוחסנים ב-80 מעלות צלזיוס עד השימוש.
  14. שוקל הצינורות המכילים את דגימות צואה ותוכן מעי, להפחית את המשקל משפופרות ריק (מתוך שלב 2.1) כדי להשיג את המשקל צואה בכל מדגם.
  15. תמצית ה-DNA חיידקי צואה, תוכן מעי, דגימות בקיר המעי העקום באמצעות ערכות זמינים מסחרית. לאחסן דגימות די אן איי ב-20 ° C עד השימוש.

3. כימות של המעי Microbiota על ידי qPCR

הערה: הליך זה כולל את הדור של תקן (שלב 3.1) ואת השיטה עבור הגדרת qPCR עבור דגימות צואה רגילה (שלב 3.2)

  1. הדור של תקן עבור qPCR
    1. השתמש תגובת שרשרת פולימראזית (PCR) כדי להגביר את הגן rRNA מטוסי אף-16 יצאו מן ה-DNA גנומי מופק תרבות חיידקי שימוש ריאגנטים13 ו- PCR התנאים המפורטים בטבלה1.
    2. להפעיל את המוצר PCR על 1.5% agarose ג'ל ולטהר את הלהקה הדנ א באמצעות ערכת חילוץ DNA זמינים מסחרית.
    3. מאתרים ומפסיקים את מטוהרים DNA פרגמנט באמצעות שיבוט קיט (ראה טבלה של חומרים, שימוש וקטור שמכיל סמנים עמידות לאנטיביוטיקה ופיוז'ן הגן β-galactosidase (LacZ) לבחירה המושבה כחול/לבן) ולהפוך המוסמכים DH10 E. coli ההוראות של היצרן. צלחת טרנספורמציה אל אמפיצילין (100 µg/mL), X-גל (20 µg/mL) לוריא Bertani (LB) אגר צלחות (10 גרם/ליטר טריפטון, 5 g/L תמצית שמרים, 10 גרם/ליטר NaCl, 15 גר'/ליטר אגר). דגירה לילה (O/N) ב 37 º C.
    4. בחר מושבה בודדת חיובית (לבן) הצלחת. לחסן אותה ב- 5 מ ל LB מרק המכיל 100 µg/mL אמפיצילין, דגירה O/N ב- 37 מעלות צלזיוס, רועדת-250 סל"ד.
    5. מן התרבות O/N, לבודד ולטהר את פלסמיד באמצעות ערכת miniprep מסחרי לפי הנחיות היצרן.
      הערה: חשוב על רצף של תותב פלסמיד בשלב זה, כדי להבטיח כי פלסמיד מכיל עותק אחד בלבד של הגן rRNA מטוסי אף-16 וכדי לקבוע את אורך בסיס-בזוגות (bp).
    6. Linearize את פלסמיד באנזים הגבלה שחותך את פלסמיד פעם אחת בלבד.
    7. לטהר את פלסמיד ליניארית באמצעות ערכת זמינים מסחרית.
    8. לקבוע את הריכוז של פלסמיד על ידי מדידת ספיגת ב-260 nm באמצעות ספקטרופוטומטרים.
    9. לחשב את מספר עותקים פלסמיד/µL מדגם באמצעות הנוסחה הבאה14:
      מספר העותקים = (כמות * × 10 6.02223) / (אורך * 1 × 109 * 650)
      איפה כמות ריכוז הדנ א שהושג בשלב 3.1.8 (ב ng/µL); אורך האורך הכולל של פלסמיד (עם הוספת) ב- bp. ניתן להשיג את מספר העותקים כמו עותקים/µL.
      הערה: ישנם כלים מקוונים המבוססת על הנוסחה לעיל, המאפשרים חישוב קל של מספר העותקים פלסמיד.
    10. Aliquot, חנות תקן כנדרש ב-20 ° C עד השימוש.
  2. qPCR הגדרת תקן, דגימות צואה
    1. להפשיר את qPCR רגיל (מתוך שלב 3.1.10), צואה דגימות דנ א (מתוך שלב 2.15) ואת qPCR ריאגנטים (מתוך ערכת זמינים מסחרית) על קרח.
      הערה: ריאגנטים qPCR השתמשו בדוגמה זו כוללים את תערובת התגובה SYBR Green qPCR תחל ואחורה (טבלה 2).
    2. לדלל את התקן במים סטרילי ללא ה-DNA בטווח של 107 ל 102 עותקים/µL (למשל, 1/5 טורי דילולים מ 107 ל 6.4 x 102 עותקים/µL). לדלל דגימת צואה DNA ל- 1/2, 1/5, 1/10.
    3. לגרום לתגובה מיקס מאסטר עבור המספר הכולל של תגובות ועוד 1 (טבלה 2).
    4. לערבב 30 µL של האב ואת µL 5 של תבנית (תקן, מדגם או מים עבור פקד שלילי)
    5. להוסיף 10 µL של המיקס הזה מכל קידוח לתוך צלחת qPCR אופטי 384-. טוב. לבצע את התגובה לכל דולר.
    6. לסגור את המקום qPCR, צנטריפוגה בקצרה ולטעון את הצלחת על מכונת qPCR מתוכנת עם אופניים התנאים הבאים: 95 מעלות צלזיוס למשך 20 דקות ואחריו 40 מחזורי 95 ° C עבור 15 s ו- 60 ° C עבור 1 דקות.
    7. להשיג ערכי CT עבור תקן ודוגמאות.
    8. ליצור עיקול רגיל ידי הערכים CT בסטנדרטים מול הלוגריתם של מספר עותק פלסמיד (כפי שמחושבת בשלב 3.1.9). לבצע רגרסיה לינאל של העקומה סטנדרטי.
    9. לחשב את מספרי עותק rDNA מטוסי אף-16 דגימות צואה על-ידי ויצירת שינוי הערכים CT (שהתקבלו בשלב 3.2.2) בעקומת סטנדרטי.
      הערה: מטוסי אף-16 rDNA עותק מספרי עבור כל דגימה אמור להיפתר בהתחשב הגורם דילול של המדגם (כמו להכין בשלב 3.2.2), חומצות גרעין נפח סופי זה היו eluted (בשלב 2.15) והכמות של דגימת צואה (שלב כמחושב 2.14) כדי להשיג ג'ין מעתיק לגרם של צואה.

Representative Results

כאן אנו מספקים שני פרוטוקולים חלופי עבור טיפול אנטיביוטי דרך הפה של עכברים. איור 1 מציג את אחוז משקל הגוף (קשורים למשקל קו הבסיס המקורי עבור כל חיה) בעכברים מטופלים עם אנטיביוטיקה דרך הפה gavage (אדום) או במי השתייה (כחול) למשך 10 ימים רצופים. אין ירידה במשקל מורגש נמצא בעכברים מקבל אנטיביוטיקה מאת gavage דרך הפה. אולם, כאשר עכברים מטופלים עם אנטיביוטיקה ad libitum במי השתייה, הם לרזות (~ 10%) בתוך הימים הראשונים של הממשל לאנטיביוטיקה, אך לשחזר עלייה במשקל נורמלי לאחר מכן (איור 1). למרות זאת, בסביבות 5-10% של עכברים שקיבלו אנטיביוטיקה במי השתייה יכול להגיע > 20% ירידה במשקל בתוך השבוע הראשון של הטיפול, ובמקרה הזה הם מורדמים.

כימות של חיידקים דגימות צואה מחייב שימוש מעגל סטנדרטי נאותה אשר מתקבל על ידי מתכנן את יומן הרישום של עותק מספר עבור התקן (כפי שמחושבת בשלב 3.2.2) לעומת הערכים CT המתקבל qPCR (שלב 3.2.7). איור 2A מראה דוגמה מייצגת של עיקול רגיל אשר עונה על הקריטריונים ביצועים עיקול רגיל עם ערך2 R של 0.99827, מדרון של-3.09 ויעילות ((-1 + 10^(-1/slope))*100) של 110%. ערכי R2 0.99 ו- PCR יעילות בטווח של 90-110% הם העדיפו. בתוך הטווח. ליניארית, ניתוח הרגרסיה מאפשר כימות של שפע rDNA מטוסי אף-16 בתוך דגימות צואה. איור 2B מציג את מספר העותקים rDNA מטוסי אף-16 צואה צואה, תוכן סי ו סי קיר. איור 2B נתונים מוצגים כמו מטוסי אף-16 rDNA עותקים/g דגימת צואה צואה צואה ו סי תוכן. עבור קיר סי, הנתונים מוצגים כמו המספר הכולל של מטוסי אף-16 rDNA עותקים המתקבל חיידקים התאוששה של 3 ס מ של SI קיר (כמו כמות החומר מתחיל קטן מדי כדי להשיג משקל מדויק).

כדי להעריך את ההשפעה של האנטיביוטיקה על הצפיפות של חיידקים דגימות צואה, עכברים טופלו באנטיביוטיקה מאת gavage אוראלי מדי יום למשך 10 ימים (ימים 1-10), נאספו דגימות צואה לפני (יום 0), בנקודות שונות בזמן-במהלך טיפול אנטיביוטי ( ימים 5 ו-10), ו- 7 ימים לאחר הפסקת אנטיביוטיקה המינהל (יום 17; איור 3A). כפי שמוצג באיור 3B, טיפול אנטיביוטי גורם לירידה חזקה מספר מטוסי אף-16 rDNA עותקים/g צואה זוהה ליד ימים 5 ו-10, הצפיפות של חיידקים צואה התאושש לרמות נורמליות (המקביל לטיפול מראש) 1 שבוע לאחר ניהול לאנטיביוטיקה הופסק (יום 17).

Figure 1
איור 1: הניהול של אנטיביוטיקה. העכברים קיבלו אנטיביוטיקה דרך הפה gavage (אדום) או במי השתייה (כחול) למשך 10 ימים רצופים. העלילה מציגה משקולות של עכברים לאורך משך הניסויים באופן יחסי המשקל המקורי לפני המינהל לאנטיביוטיקה (יום 0). הנתונים מוצגים זאת אומרת ± ב- SEM אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: 16 rRNA ג'ין qPCR הגברה של תקנים, דגימות צואה. (א) רגרסיה ליניארית של עיקול רגיל עם עיקול רגיל מתארי. (B) החישוב של ג'ין abundances של דגימות צואה. הנתונים מוצגים זאת אומרת ± ב- SEM אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: צואה חיידקים במהלך טיפול אנטיביוטי- מפרטים טכניים (A) של לוח הזמנים עבור ניהול אנטיביוטי אוראלי gavage (אלב), אוסף דגימה כמו שתוארו עם *. (B) 16 rDNA מעתיק לגרם של צואה של דגימות צואה של עכברים שייאסף הימים המצוין. הנתונים מוצגים זאת אומרת ± ב- SEM אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

מגיב נפח
ה-DNA 8 ΜL
מאגר 10 X 2 ΜL
dNTPs (10 מ מ) 0.4 ΜL
Eubacteria - F פריימר (10 מ מ) 1 ΜL
Eubacteria - R פריימר (10 מ מ) 1 ΜL
Taq Polimerase 0.2 ΜL
H2O 7.4 ΜL
הנפח הכולל 20 ΜL
פריימר רצפים
Eubacteria - F פריימר 5' ACTCCTACGGGAGGCAGCAGT 3'
Eubacteria - R פריימר 5' ATTACCGCGGCTGCTGGC 3'
תנאי הרכיבה
טמפרטורה זמן מחזורים
94 ° C 5 דקות 1 x
94 ° C 30 s 10:
60 ° C 30 s 10:
72 ° C 1 דקות 10:
72 ° C 5 דקות 1 x
4 ° C 1 x

טבלה 1: PCR ריאגנטים ותנאים. השולחן הזה מספק את ריאגנטים ואת תנאי הרכיבה PCR כדי להגביר את מטוסי אף-16 גנים rRNA מן התרבות חיידקי לדור של תקן לשימוש ב- מבחני qPCR. פריימר רצפים פורסמו במקור על ידי Kruglov. et al. 13.

מגיב נפח
מיקס מאסטר SYBR Green (2x) 17.5 ΜL
Eubacteria - F פריימר (10 מ מ) 0.7 ΜL
Eubacteria - R פריימר (10 מ מ) 0.7 ΜL
H2O 11.1 ΜL

בטבלה 2: מיקס מאסטר qPCR. אמצעי האחסון המוצגת (נפח סופי 35 µL) הם דוגמה אחת לרוץ שהפקידים (10 µL כל אחד) על צלחת qPCR 384-טוב (לדעה נוספת לטעויות pipetting 5 µL). הסכום עשוי להיות יורה על פי מספר דוגמאות כדי להיות מנותח.

Discussion

כאן אנו מספקים פרוטוקולים ניסיוני עבור ניהול אוראלי של אנטיביוטיקה עכברים, כימות של צואה חיידקים על ידי qPCR. השילוב של אנטיביוטיקה בשימוש זה מטרות הפרוטוקול (המכיל אמפיצילין, גנטמיצין, neomycin, מטרונידזול, ואנקומיצין) חיידקים גראם חיוביים והן גראם שליליים, המציע פעילות אחרים נגד ספקטרום מלא של חיידקים. Gavage שבעל-פה והן הממשל של אנטיביוטיקה במי השתייה להקטין במידה רבה בקטריאלי צואה לטעון5,6,12. יתר על כן, שני הטיפולים יש השפעה עמוקה פנוטיפ של העכברים כפי שהם מפתחים מספר מאפיינים טיפוסיים של עכברים מחיידקים, כולל גודל הטחול מופחתת של המעי האטום מוגדלת. הבחירה של שיטה מסוימת עבור ניהול אנטיביוטי אולי תלויה אורך הניסוי כמו שיטת gavage אוראלי דורש ניהול יומיומי של אנטיביוטיקה, להיות יותר לתקיפות, ולגרום לאי נוחות יותר בעלי חיים בטווח הארוך.

עבור המינהל של אנטיביוטיקה במי השתייה, התראה חייב להילקח עם התוספת של הממתיק לתערובת אנטיביוטי כפי זהו גורם חיוני כדי למנוע התייבשות עכברים. מספר קבוצות הראו איך הממשל של אנטיביוטיקה על שתיית מים (ללא תוספת של ממתיק) מוביל מהיר ועוצמתי במשקל עם עכברים כל לאבד יותר מ 20% ממשקל הגוף הראשונית בתוך הימים הראשונים של הניסוי5 , 6. הפרוטוקול שלנו השימוש ממתיק סכרין מבוססי שנראה מספיק כדי להסוות את הטעם אנטיביוטיים במים, עכברים במשקל בבימים הראשונים לאחר אנטיביוטיקה, אך התאוששה משקולות שלהם במהירות לאחר הזה ( איור 1). למרות זאת, בניסויים שלנו 5-10% של עכברים עדיין להגיע את מובילים האנושי של > 20% אובדן בסיסית למשקל הגוף ויש צורך לבצע המתה. גם בדקנו ממתיקים מבוססי סוכרלוז נכשל לחלוטין כדי למנוע התייבשות עכברים (100% של עכברים איבד > 20% ממשקל) בעוד מחברים אחרים פרסמו כשלים דומים ממתיקים מבוסס-ממתיק5,6. נוסף לזה, גיל, הרקע הגנטי ומצב בריאותו הכללית של העכברים המשמשים את הניסויים יש לשקול, כפי שהם עשויים להשפיע במשקל ורווחה בעלי חיים במהלך טיפול אנטיביוטי. לפיכך, פיקוח קפדני על עכברים משקל ומצב בריאותו הכללית צריכה להתבצע מדי יום במהלך השבועיים הראשונים של הממשל אנטיביוטיקה דרך הפה.

שיטות qPCR מספקים גישה מהירה וחסכונית של כימות של מטוסי אף-16 rRNA דגימות צואה. עם זאת, יש לקחת בחשבון כמה מגבלות לגבי טכניקה זו, וביניהם: אני) הדרישה תקן איכותי אמין; ii) עיצוב והיעילות של תחל qPCR; iii) העובדה מיקרואורגניזמים ייתכן שיש מספרים שונים עותק של הגן rRNA מטוסי אף-16, ובכך ג'ין עותקים ייתכן ישירות שווה תא סעיפים15. בכל זאת, qPCR היא שיטה חזקה ורגיש המאפשר ניתוח מהיר של דגימות צואה. שיטה זו יכולה להיות שימושית במיוחד לאימות במהירות את ההשפעה של טיפולים שונים (כולל אנטיביוטיקה) מאד חיידקי צואה מפורט כאן. יתר על כן, למרות אנו מספקים פרוטוקול על כימות של סה כ 16 rRNA, בשיטה זו ניתן להתאים בקלות (על ידי עיצוב ספציפי תחל16) כדי לאפשר זיהוי של הפרט taxa חיידקי, ובכך לספק הן כמותית, מידע איכותי אודות microbiome גודלו והרכבו.

לסיכום, סיפקנו שני פרוטוקולים לטיפול אנטיביוטי דרך הפה של עכברים, שיטה המבוססת על qPCR לכמת הנוצרות על-ידי אנטיביוטיקה לשינויים צואה חיידקים. אף על פי פרוטוקולים אלה יכול להיות עוד יותר ממוטב בשילוב עם גישות אחרות לפי הצרכים האישיים ניסיוני, שהם עשויים לשרת ככלים מהירה, חסכונית ואמינה לתמרן את microbiota מעיים מאתר וכדי ללמוד האפקטים של טיפול אנטיביוטי ב הומאוסטזיס מעיים ומחלות.

Disclosures

המחברים אין לחשוף.

Acknowledgments

עבודה זו מומן על ידי בריטניה המועצה למחקר רפואי (מענק מר ת/L008157/1); אר. ג'י נתמכה על ידי מארי קירי התמחות Intra-European (H2020-MSCA-אם-2015-703639); P.M.B. נתמכה על ידי studentship של המועצה למחקר רפואי בבריטניה ושותפות של המלך המכללה לונדון הדוקטורט הכשרה בתחום הביו-רפואי מדעי (מר/N013700/1).

Materials

Name Company Catalog Number Comments
Ampicillin sodium salt Sigma-Aldrich (Merck) A9518
Neomycnin trisulfate salt hydrate Sigma-Aldrich (Merck) N1876
Metronidazole Sigma-Aldrich (Merck) M3761
Vancomycin hydrochloride Sigma-Aldrich (Merck) V2002
Gentamicin sulfate salt Sigma-Aldrich (Merck) G3632
Tryptone Sigma-Aldrich (Merck) T7293
Yeast Extract Sigma-Aldrich (Merck) Y1625
NaCL Sigma-Aldrich (Merck) S7653
Sweetener Sweet'n Low Sweet'N Low Available in the UK from Amazon.co.uk
X-Gal (5-brom-4-chloro-3-indoyl B-D-galactopyranoside) Fisher scientific 10234923
Phosphate Buffered Saline  Thermo Fisher Scientific (Gibco) 10010023
Ultrapure Agarose Thermo Fisher Scientific (Invitrogen) 16500500
RT-PCR grade water Thermo Fisher Scientific (Invitrogen) AM9935
Phusion High-Fidelity DNA Polymerase New England BioLabs M0530
Deoxynucleotide (dNTP) Solution Mix New England BioLabs N0447
iTaq Universal SYBR Green Supermix Bio-Rad 1725124 with ROX
TOPO TA cloningTM for sequencing Thermo Fisher Scientific (Invitrogen) 450030
QIAamp fast DNA Stool mini kit  Qiagen 51604
QIAprep spin Miniprep kit Qiagen 27106
QIAquick gel  extraction kit Qiagen 28704
Syringe filter 0.45 µm Fisher scientific 10460031
Swann-MortonTM Carbon steel sterile scalpel blades Fisher scientific 11792724
Syringe (1 mL) BD Plastipak 303172
Syringe (20 mL) BD Plastipak 300613
1.5 mL Crystal clear microcentriguge tube StarLab E1415-1500
2 mL Ultra high recovery microcentrifuge tube StarLab I1420-2600
Oral dosing needles 20 G x 38 mm curved (pk/3) Vet-Tech DE008A
Sterilin petri dish 50 mm  Scientific Laboratory Supplies PET2020
Absolute qPCR plate seals Thermo Fisher Scientific AB1170
MicroAmpTM optical 384-well plate  Thermo Fisher Scientific (Applied Biosystems) 4309849
ViiA7TM 7 real-time PCR system with 384-well block Thermo Fisher Scientific (Applied Biosystems) 4453536
Spectrophotometer (Nanodrop 1000) Thermo Fisher Scientific ND-1000
Labnet Prism microcentrifuge Labnet C2500
MultiGene Optimax Thermal cycler Labnet TC9610

DOWNLOAD MATERIALS LIST

References

  1. Belkaid, Y., Hand, T. W. Role of the microbiota in immunity and inflammation. Cell. 157, (1), 121-141 (2014).
  2. Hooper, L. V., Littman, D. R., Macpherson, A. J. Interactions between the microbiota and the immune system. Science. 336, (6086), 1268-1273 (2012).
  3. Ubeda, C., Pamer, E. G. Antibiotics, microbiota, and immune defense. Trends in Immunology. 33, (9), 459-466 (2012).
  4. Dethlefsen, L., Huse, S., Sogin, M. L., Relman, D. A. The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biology. 6, (11), e280 (2008).
  5. Reikvam, D. H., et al. Depletion of murine intestinal microbiota: effects on gut mucosa and epithelial gene expression. PLoS One. 6, (3), e17996 (2011).
  6. Hill, D. A., et al. Metagenomic analyses reveal antibiotic-induced temporal and spatial changes in intestinal microbiota with associated alterations in immune cell homeostasis. Mucosal Immunology. 3, (2), 148-158 (2010).
  7. Fraher, M. H., O'Toole, P. W., Quigley, E. M. Techniques used to characterize the gut microbiota: a guide for the clinician. Nature Reviews Gastroenterology & Hepatology. 9, (6), 312-322 (2012).
  8. Eckburg, P. B., et al. Diversity of the human intestinal microbial flora. Science. 308, (5728), 1635-1638 (2005).
  9. Sokol, H., et al. Low counts of Fecalibacterium prausnitzii in colitis microbiota. Inflammatiry Bowel Diseases. 15, (8), 1183-1189 (2009).
  10. Bartosch, S., Fite, A., Macfarlane, G. T., McMurdo, M. E. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Applied Environmental Microbiology. 70, (6), 3575-3581 (2004).
  11. Ubeda, C., et al. Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. Journal of Clinical Investigation. 120, (12), 4332-4341 (2010).
  12. Saez de Guinoa, J., et al. CD1d-mediated lipid presentation by CD11c(+) cells regulates intestinal homeostasis. EMBO Journal. 37, (5), (2018).
  13. Kruglov, A. A., et al. Nonredundant function of soluble LTalpha3 produced by innate lymphoid cells in intestinal homeostasis. Science. 342, (6163), 1243-1246 (2013).
  14. Wilhelm, J., Pingoud, A., Hahn, M. Real-time PCR-based method for the estimation of genome sizes. Nucleic Acids Research. 31, (10), e56 (2003).
  15. Kembel, S. W., Wu, M., Eisen, J. A., Green, J. L. Incorporating 16S gene copy number information improves estimates of microbial diversity and abundance. PLoS Computational Biology. 8, (10), e1002743 (2012).
  16. Yang, Y. W., et al. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces. Applied Environmental Microbiology. 81, (19), 6749-6756 (2015).
פולימראז כמותי המבוסס על תגובת שרשרת ניתוחים של מאתר Microbiota מעיים לאחר טיפול אנטיביוטי דרך הפה
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).More

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter