Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Количественные полимеразной цепной реакции на основе анализ мышиных кишечной микробиоты после устные лечения антибиотиками

doi: 10.3791/58481 Published: November 17, 2018

Summary

Здесь мы предоставляем подробные протоколы для орального применения антибиотиков для сбора фекальных проб, экстракции ДНК и количественного определения фекальных бактерий, мышей, ПЦР.

Abstract

Кишка микробиоты имеет центральное влияние на здоровье человека. Микробные дисбиоза ассоциируется с многих общих immunopathologies, таких как воспалительные заболевания кишечника, астмы и артрита. Таким образом понимание механизмов, лежащих в основе перекрестных микрофлору иммунной системы имеет решающее значение. Антибиотикотерапия, при пособничестве Распродажа патогена, также вызывает резкие изменения в размер и состав кишечных бактериальных сообществ, которые могут иметь влияние на здоровье человека. Лечение антибиотиками в мышах резюмирует воздействия и долгосрочные изменения в человека микробиоты от антибиотиков пролеченных больных и позволяет расследования механистический связей между изменениями в микробных сообществ и функции иммунных клеток. Хотя были описаны несколько методов для лечения антибиотиками мышей, некоторые из них вызывают обезвоживания в тяжелой форме и потеря веса, затрудняет интерпретацию данных. Здесь мы предлагаем два протокола для устных антибиотиков, который может использоваться для длительного лечения мышей не вызывая крупные потери веса. Эти протоколы используют комбинации антибиотиков, предназначенных грамположительных и грамотрицательных бактерий и может предоставляться либо ad libitum в питьевой воде или пероральная затравка. Кроме того мы описывают метод количественного определения плотности микробов в фекальных пробах, ПЦР, который может использоваться для проверки эффективности лечения антибиотиками. Сочетание этих подходов обеспечивает надежную методологию для манипуляции кишечной микробиоты и изучению эффектов лечения антибиотиками в мышей.

Introduction

У млекопитающих слизистой ЖКТ представляет собой уникальную среду, колонизирована очень сложная смесь микроорганизмов, которые устанавливают бесшёрстных отношения с принимающей. Система обороны слизистой оболочки кишечника включает эпителиального пласта и множество иммунных клеток, которые ограничивают Комменсалами в кишечнике при сохранении их количества и разнообразия. И наоборот синантропных организмов необходимы для развития полностью функциональной иммунной системы. Хотя взаимодействие между принимающей и синантропных бактерии обычно полезны, он становится все более очевидным, что что dysregulated иммунной системы микробиоты помех может способствуют развитию хронических воспалительных заболеваний, такие asinflammatory кишечника болезни, артрит, астма1,2.

Кишка микробиоты могут быть изменены различные факторы, но возможно наиболее радикальные изменения вызванные лечения антибиотиками, которые сильно изменяет размер и состав бактериальных сообществ3,4. Хотя преимущества антибиотики для лечения инфекции являются несомненными, Микробиота изменений, вызванных воздействием антибиотика в организме человека также может изменить иммунной защиты, которые могут привести к пагубное воздействие на здоровье. Например, лечение антибиотиками в организме человека связано с повышенным риском Clostridium difficile-индуцированной понос, астма и некоторых видов рака3. Лечение антибиотиками в мышах резюмирует воздействия и долгосрочные изменения в кишечнике общин антибиотик лечение больных и позволило расследования механистический связей между изменениями в микробных сообществ и функции иммунных клеток. Однако некоторые доклады показали, что введение антибиотиков на питьевой воде ad libitum приводит к потере веса очень заметно мышей воздерживаться от питьевой воды, предположительно из-за его неприятный вкус5,6. Таким образом в этих моделях тяжелой дегидратации с пероральным антибиотикам может осложнить интерпретации экспериментов, стремясь определить эффект лечения антибиотиками в функции иммунных клеток.

Несколько подходов может использоваться для изучения размер и состав микробных сообществ в кишечной отсека7. Следующее поколение технологии виртуализации предоставили бесценные данные на этот вопрос8, однако эти методы являются относительно дорогими и требуют экспертных bioinformatic анализы для интерпретации данных. С другой стороны традиционная культура микробиологические методы позволяют обнаружение видов бактерий, но они имеют низкую чувствительность, и значительная часть синантропных бактерий (особенно анаэробов) очень сложно или невозможно возделывать с в настоящее время доступные методы8. Методы количественных полимеразной цепной реакции (ПЦР) все чаще используются для количественной оценки и идентификации видов фекальных бактерий, поскольку они обеспечивают быстрый и надежный культуры независимые мера общей микробной нагрузки. Соответственно ПЦР методы оказались полезными для изучения изменений в микробиоты, связанные с возрастом или с прогрессированием ряда заболеваний, включая воспалительных кишечника болезни9,10. В соответствии с этим ПЦР методы обеспечивают быстрый и экономически эффективным подходом для проверки влияния различных методов лечения (в том числе антибиотиков) в фекальных бактерий нагрузок и микробиоты композиция10,,1112.

Здесь мы представляем шаг за шагом подробно два различных протоколов для устных антибиотиков для мышей, фекальных проб, экстракции ДНК, подготовке стандартов и количественной оценки бактерий в фекальных пробах по ПЦР. Эти протоколы обеспечивают надежный способ манипулировать кишечную микрофлору у мышей и изучение последствий антибиотикотерапии кишечная гомеостаза и болезней.

Protocol

Были проведены эксперименты, описанные здесь, с помощью 6-8 недель, старый (C57BL6/J) мышах одичал тип поддерживается в объекте определенного возбудителя бесплатно (SPF). Все эксперименты на животных были утверждены лондонском колледже и Фрэнсиса Крика институт животных благосостояния и этической экспертизой и внутренних дел Соединенного Королевства. До начала любой процедуры, животных, убедитесь, что соответствующие разрешения полученные через местные учреждения/Организации.

1. введение антибиотиков

Примечание: Два альтернативных методов лечения антибиотиками предоставляются: пероральная затравка (шаг 1.1) и введение антибиотиков через питьевой воды (шаг 1.2).

  1. Пероральная затравка
    1. Подготовка запасов отдельных антибиотиков, растворяя их в газобетона воде в концентрациях, следующие: ампициллин в 100 мг/мл, гентамицина в 100 мг/мл, неомицин на 100 мг/мл, метронидазол в 10 мг/мл и ванкомицин на 100 мг/мл. Фильтр стерилизовать, с помощью фильтра 0.45 мкм. Алиготе и хранить при температуре от-20 ° C.
    2. Подготовка коктейля антибиотиков путем смешивания запасов, подготовленный выше. Для тома 1 мл смешайте 50 мкл ампициллин (окончательный 5 мг/мл), 50 мкл гентамицина (окончательный 5 мг/мл), 50 мкл неомицин (окончательный 5 мг/мл), 500 мкл метронидазол (окончательный 5 мг/мл), 25 мкл ванкомицин (2,5 мг/мл окончательный) и 325 мкл воды. Подготовьте свежий коктейль перед использованием.
    3. Загрузить антибиотик смеси в 1 мл стерильного шприца и исправить затравки соответствующего манометра (20 Г на 15 – 20 g мышей) устраняя любые пузыри.
    4. Калийную мышей с 200 мкл антибиотик смеси.
      1. Grab кожи через плечо мыши твердо, растянуть головы и шеи выпрямить пищевода. Направляйте мяч кончик кормления иглу вдоль крыши из устья и к задней части глотки. Затем осторожно передать его в пищевод и вставляют 200 мкл раствора.
    5. Администрирование антибиотиком коктейль раз ежедневно в течение всего эксперимента.
  2. Антибиотики в питьевой воде
    Предупреждение: Внимательно контролировать вес мыши ежедневно для первых двух недель антибиотиков в питьевой воде.
    1. Подготовьте коктейля антибиотиков, растворяют в 1 Л воды газобетона следующее: 1 г ампициллина (1 г/Л окончательный), 1 г неомицина (1 г/Л окончательный), 1 г метронидазола (1 г/Л окончательный), 0,5 г ванкомицин (окончательный 0,5 г/Л) и 8 пакетиков (по 0,75 г) искусственных подсластитель (окончательный 60 г/Л). Встряхните до растворения. Хранить при 4 ° C.
      Примечание: Подсластитель добавляется скрыть вкус антибиотиков и предотвратить обезвоживание мышей. Хотя может работать несколько брендов подсластитель, конечная концентрация необходимых может быть разным для каждой конкретной марки.
    2. Заполните антибиотиков коктейль в бутылку воды (~ 100 мл/бутылка) и поместите бутылку на клетке мыши.
      Примечание: Используйте коричневый бутылки или покрытия бутылки с фольгой, чтобы защитить антибиотики от света.
    3. Замените антибиотиков коктейль с свежим запасом дважды в неделю в течение всего эксперимента.

2. сбор фекальных пробах стула, содержание подвздошной кишки и подвздошной кишки стены

  1. Весят и этикетки 2 мл газобетона трубы для сбора проб.
  2. Для сбора образцов свежие стула поместите каждую мышь в фиксатор и собирать фекальные пеллеты непосредственно из ануса в коллекции трубку.
    Примечание: Образцы можно также получить, поместив мышей в клетку чистой газобетона и сбор образцов стула чистой стерилизовать пинцетом.
  3. Усыпить мышей с CO2 удушение следуют шейки матки дислокации.
  4. Тушу мыши лежит на животе полностью разоблачил и спрей области живота с 70% этиловом спирте.
  5. Использование стерилизованные щипцы и ножницы, сделать поперечный разрез в животе подвергать брюшины без ущерба для каких-либо внутренних тканей. Поднимите брюшины и надрезают подвергать кишечника.
  6. Удаление кишечника (от толстой кишки в желудок) с щипцами и ножницы и поместите его в стерильных Петри.
  7. Осторожно используйте пинцет дразнить тонкой кишки (SI) от верхней брыжеечной артерии и жира. Расширить кишечника и поместите его на протрите чистой лаборатории.
  8. С правителем Отмерьте и отрежьте 4 см дистальной части подвздошной кишки Си (ближайший часть к слепой кишки). Вырезать и отбросить 1 см проксимальнее слепой кишки. Там будет 3 см часть подвздошной кишки слева, который будет использоваться для сбора кишечных бактерий.
  9. Держите части подвздошной кишки (3 см) над 2 мл стерильной пробирке. Собирайте кишечного содержимого, непосредственно выдавливания кишечника и виномаркете образца в трубку. В этом примере будет иметь бактерий из подвздошной кишки содержание.
  10. Подготовить 20 мл шприца с холодной фосфатный буфер (PBS) и промойте части подвздошной кишки (отмены потока через).
  11. Место части подвздошной кишки на чистое бумажное полотенце и открыть его продольно с ножницами.
  12. Скрип внутренней стенке подвздошной кишки с помощью скальпеля.
  13. Соберите все бактерии на скальпель, омыв скальпеля с 1 мл PBS более чистых пластиковых пробирок. Спина на 8000 × g 5 мин Пелле бактерии и отбросить супернатант. В этом примере будет содержать бактерии от стенке подвздошной кишки.
    Примечание: Фекальных пробах стула, содержание подвздошной кишки и стены можно замороженные и хранятся при температуре-80 ° C до использования.
  14. Весят пробирки, содержащие образцы стула и подвздошной кишки содержание и вычесть вес от пустых труб (от шага 2.1) для получения фекальных веса в каждом образце.
  15. Экстракт бактериальной ДНК от стула, содержание подвздошной кишки и подвздошной кишки стены образцы с использованием коммерчески доступные наборы. Хранить образцы ДНК при-20 ° C до использования.

3. Количественная оценка кишечную микрофлору, ПЦР

Примечание: Эта процедура включает поколения стандарта (шаг 3.1) и метод для настройки ПЦР для стандартных и фекальных проб (шаг 3.2)

  1. Поколение стандарта для ПЦР
    1. Использование полимеразной цепной реакции (ПЦР) для того чтобы усилить гена 16S рРНК от геномной ДНК, извлеченные из бактериальной культуры с использованием реагентов13 и условия PCR, подробно изложены в таблице 1.
    2. Запуск продукта ПЦР на 1,5% агарозном геле и очистить группы ДНК, используя набор коммерчески доступных для извлечения ДНК.
    3. Перевязать очищенная ДНК фрагмента с помощью клонирования комплекта (см. Таблицу материалов, использовать вектор, содержащий маркеры антибиотикорезистентности и фьюжн гена β-галактозидазы (LacZ) для выбора колонии синий/белый) и трансформировать DH10 компетентным E. coli следуя инструкциям производителя. Пластина преобразования на ампициллин (100 мкг/мл), X-Гал (20 мкг/мл) Лурия Бертани (LB) агар пластины (10 г/Л Триптон, 5 г/Л экстракт дрожжей, 10 г/Л NaCl, 15 г/Л агар). Инкубируйте на ночь (O/N) при 37 ° C.
    4. Выберите один положительный (белый) колонии от пластины. Прививать в бульоне LB 5 мл, содержащие 100 мкг/мл Ампициллин и инкубировать O/N при 37 ° C, тряски на 250 об/мин.
    5. От O/N культуры изолировать и очищения плазмиды, с использованием коммерческих алкалический комплекта согласно инструкциям производителя.
      Примечание: Важно последовательности вставки плазмида на данном этапе, чтобы гарантировать, что плазмида содержит только одну копию гена 16S рРНК и определить его длину в пар оснований (ВР).
    6. Линеаризации плазмида с энзима ограничения, который режет плазмида только один раз.
    7. Очищайте линеаризованного плазмида, использование коммерчески доступных комплект.
    8. Определить концентрацию плазмида путем измерения оптической плотности на 260 Нм, используя спектрофотометр.
    9. Рассчитайте количество плазмида копий/мкл пример, используя следующие формулы14:
      количество копий = (Сумма * 6.022 × 1023) / (Длина * 1 × 10-9 * 650)
      когда сумма концентрации ДНК, полученные на шаге 3.1.8 (в нг/мкл); и Длина Общая длина плазмида (с вкладышем) в ВР. Количество копий будет получен как копий/мкл.
      Примечание: Существует онлайн инструменты, основанные на указанной выше формулы, которые позволяют легко расчет количество копий плазмиды.
    10. Алиготе и хранить стандарте при необходимости при-20 ° C до использования.
  2. ПЦР настройки для стандартных и фекальных проб
    1. Оттепель ПЦР стандарт (от шага 3.1.10), фекальных проб ДНК (из шага 2.15) и ПЦР реактивы (из коммерчески доступных комплект) на льду.
      Примечание: ПЦР реактивы, используемые в этом примере, включают в себя смесь реакции ПЦР SYBR зеленый и прямого и обратного грунтовки (Таблица 2).
    2. Разбавить стандарта в стерильной ДНК свободной воде в диапазоне от 107 до 10 копий 2/мкл (например, 1/5 серийных разведений от 107 до 6,4 x 102 копий/мкл). Разбавить фекальных образец ДНК до 1/2, 1/5, 1/10.
    3. Сделайте основной микс реакцию на общее количество реакций плюс 1 (Таблица 2).
    4. Размешивать 30 мкл мастер смеси и 5 мкл шаблона (стандарт, образец или воды для отрицательного контроля)
    5. Добавьте 10 мкл этой смеси в каждой скважине в пластине 384-ну оптических ПЦР. Выполнение каждой реакции в трех экземплярах.
    6. Печать место ПЦР, центрифуга кратко и загрузить пластину на ПЦР машины запрограммированы с соблюдением следующих условий Велоспорт: 95 ° C в течение 20 мин, после чего 40 циклов 95 ° c 15 s и 60 ° C в течение 1 мин.
    7. Получение значения CT для стандартных и образцы.
    8. Создание стандартной кривой путем построения CT значения для стандартов против логарифм числа копировать плазмиду (рассчитывается на шаге 3.1.9). Родовой регрессии по калибровочной кривой.
    9. Вычислить 16S рДНК копировать номера для фекальных проб путем интерполяции (полученные на шаге 3.2.2) CT значения в калибровочной кривой.
      Примечание: 16S рДНК копировать номера для каждого образца должны быть исправлены учитывая коэффициент разбавления пробы (как подготовленные на шаге 3.2.2), окончательный объем нуклеиновых кислот, которые были этого eluted (на шаге 2.15) и количество фекальных образца (исчисляемый шаг 2.14) для получения копий гена на грамм калом.

Representative Results

Здесь мы предоставляем два альтернативных протоколов для устных антибиотиков мышей. Рисунок 1 показывает процент веса тела (связанных с первоначального базового веса для каждого животного) у мышей, получавших антибиотики пероральная затравка (красный) или в питьевой воде (синий) для 10 дней подряд. Не заметна потеря веса встречается в мышей, которые получают антибиотики пероральная затравка. Однако когда мыши обрабатываются с ad libitum антибиотиков в питьевой воде, они теряют вес (~ 10%), в течение первых нескольких дней антибиотиков, но восстановление нормального веса после (рис. 1). Тем не менее, около 5-10% мышей, получающих антибиотики в питьевой воде может достигать > 20% веса в течение первой недели лечения, в этом случае они euthanized.

Количественная оценка бактерий в фекальных пробах требует использования адекватных калибровочной кривой, которая получается путем построения в журнал копирования номер стандарт (рассчитывается на шаге 3.2.2) по сравнению с CT значения, полученные из ПЦР (шаг 3.2.7). Рисунок 2A показывает типичный пример от стандартной кривой, которая удовлетворяет критериям производительности калибровочной кривой с значение R2 0.99827, склон-3.09 и эффективности ((-1 + 10^(-1/slope))*100) 110%. Значения R2 0.99 и ПЦР эффективность в диапазоне от 90 до 110% являются предпочтительными. В пределах диапазона линейной уравнение регрессии анализ позволяет количественная оценка 16S рДНК изобилия в фекальных проб. Рисунок 2B показывает количество 16S рДНК копий в Кала Кала, SI содержание и SI стены. В рисунке 2B данные отображаются в виде 16S рДНК копий/г фекалий образца Кала Кала и SI содержание. Для SI стены данные представлены как общее количество 16S рДНК копий, полученных от бактерий, оправился от 3 см SI стены (как количество исходного материала слишком малы, чтобы получить точный вес).

Оценить влияние антибиотиков на плотность бактерий в фекальных пробах, мышей были лечатся антибиотиками пероральная затравка ежедневно в течение 10 дней (дней 1 до 10) и были собраны образцы стула до (день 0), в различное время во время лечения антибиотиками ( дни 5 и 10) и 7 дней после прекращения антибиотиков (день 17; Рис. 3A). Как показано на рисунке 3B, лечение антибиотиками вызывает сильное уменьшение числа 16S рДНК копий/г фекалий, обнаруженных во время дней 5 и 10, в то время как плотность бактерий в фекалиях, восстановлен до нормального уровня (сопоставимы с предварительной обработки) 1 неделю после Антибиотикотерапия была остановлена (день 17).

Figure 1
Рисунок 1: введение антибиотиков. Мышей получил антибиотики пероральная затравка (красный) или в питьевой воде (синий) для 10 дней подряд. Диаграмма показывает вес мышей во время экспериментов относительно первоначального веса до антибиотиков (день 0). Данные отображаются в виде среднее ± SEM. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: 16S рРНК амплификации генов ПЦР стандартов и фекальных проб. (A) линейной регрессии калибровочной кривой с описанием стандартной кривой. (B) расчет распространённость гена фекальных пробах. Данные отображаются в виде среднее ± SEM. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: фекальные бактерии во время лечения антибиотиками. (A) схема расписания для антибиотиков пероральная затравка (Ab) и проб как изображается с *. (B) 16S рДНК копирует на грамм Кала в образцах стула от мышей, собранных на указанных дней. Данные отображаются в виде среднее ± SEM. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Реагент Объем
ДНК 8 МКЛ
Буфер 10 X 2 МКЛ
дНТФ (10 мм) 0.4 МКЛ
Эубактерии - праймера F (10 мм) 1 МКЛ
Эубактерии - R грунтовка (10 мм) 1 МКЛ
Taq Биохимия 0.2 МКЛ
H2O 7.4 МКЛ
Общий объем 20 МКЛ
Грунтовка последовательности
Эубактерии - праймера F 5' ACTCCTACGGGAGGCAGCAGT 3'
Эубактерии - R грунтовка 5' ATTACCGCGGCTGCTGGC 3'
Велоспорт условия
Температура Время Циклы
94 ° C 5 мин 1 x
94 ° C 30 s 30 x
60 ° C 30 s 30 x
72 ° C 1 мин 30 x
72 ° C 5 мин 1 x
4 ° C 1 x

Таблица 1: ПЦР реактивы и условий. Эта таблица предоставляет реагентов и Велоспорт условия PCR усиливает гена 16S рРНК от бактериальной культуры для поколения стандарта для использования в ПЦР-анализов. Последовательностей праймера были первоначально опубликованы Круглов и др. 13.

Реагент Объем
SYBR зеленый главный микс (2 x) 17.5 МКЛ
Эубактерии - праймера F (10 мм) 0,7 МКЛ
Эубактерии - R грунтовка (10 мм) 0,7 МКЛ
H2O 11.1 МКЛ

Таблица 2: мастер смесь ПЦР. Тома, показано (конечный объем 35 мкл) являются для единого образца будет работать на трех экземплярах (по 10 мкл) на табличке 384-ну ПЦР (приходится 5 мкл дополнительных для дозирования ошибка). Сумма может быть повышена по количеству образцов для анализа.

Discussion

Здесь мы предоставляем экспериментальные протоколы для орального применения антибиотиков мышей и количественного определения фекальных бактерий на ПЦР. Комбинация антибиотиков используется в этой цели протокола (содержащий ампициллина, гентамицин, неомицин, метронидазол и ванкомицин) грамположительных и грамотрицательных бактерий, предлагая бактерицидная активность против полный спектр бактерий. Пероральная затравка и введение антибиотиков в питьевой воде значительно уменьшить фекальные бактериальной нагрузки5,6,12. Кроме того оба лечения имеют глубокое воздействие на фенотип мышей, как они развиваются несколько характеристик типичных стерильных мышей, включая снижение селезенки размер и расширенного слепой кишки. Выбор конкретного метода для антибиотиков может возможно зависит от длины эксперимента как метод пероральная затравка требует ежедневной администрации антибиотиков, будучи более трудоемкой и может вызвать больше дискомфорта для Животные в долгосрочной перспективе.

Для введение антибиотиков в питьевой воде необходимо проявлять осторожность с добавлением сахара к антибиотикам смеси как это является решающим фактором для держать мышей от обезвоживания. Несколько групп показали, как введение антибиотиков в питьевой воде (без добавления сахара) приводит к очень тяжелой и быстрой потери веса всех мышей, потеря более 20% от первоначального веса в течение первых нескольких дней эксперимента5 , 6. в наш протокол, использование сахарин основе подсластитель, казалось, быть достаточно, чтобы замаскировать антибиотик вкус в воде и мышей потерял вес в первые несколько дней после антибиотиков, но быстро оправился их веса после этого ( Рисунок 1). Тем не менее, в наших экспериментах 5-10% мышей до сих пор достичь человека конечной точке > 20% потеря базовый вес тела и необходимо быть euthanized. Мы также протестировали на основе сукралоза подсластители, которые полностью не смогли предотвратить обезвоживание мышей (100% мышей потерял > 20% от веса) в то время как другие авторы опубликовали аналогичные сбои на основе Аспартам Заменители сахара5,6. В дополнение к этому, возраст, генетический фон и общего состояния здоровья мышей, используемые для экспериментов следует рассматривать, как они могут повлиять на потерю веса и благополучия животных во время лечения антибиотиками. Таким образом ежедневно в течение первых двух недель устных антибиотиков следует проводить тщательный мониторинг мышей веса и общего состояния здоровья.

ПЦР методы обеспечивают быстрый и экономически эффективным подходом для количественного определения 16S рРНК в фекальных пробах. Однако, следует рассмотреть некоторые ограничения относительно этой техники, в том числе: i) требование надежного стандарт высокого качества; II) дизайн и эффективности ПЦР праймеры; III) тот факт, что микроорганизмы могут иметь номера разные копии гена 16S рРНК, таким образом копии гена не может равняться непосредственно клеток пунктам15. Тем не менее ПЦР является надежной и чувствительной метод, который позволяет быстрый анализ проб фекалий. Этот метод может быть особенно полезным для быстро проверить эффект различных методов лечения (в том числе антибиотиков) в фекальных бактерий нагрузок, как подробно здесь. Кроме того хотя мы предоставляем протокол для количественного определения общего 16S рРНК, этот метод может быть легко адаптирована (путем разработки конкретных грунтовки16) чтобы включить идентификацию индивидуальных бактериальных таксонов, обеспечивая тем самым как количественные, так и качественная информация о микрофлора размера и состава.

Таким образом мы обеспечили два протокола для устных антибиотиков мышей и метод на основе ПЦР для количественного определения антибиотиков индуцированные изменения в фекальных бактерий. Хотя эти протоколы могут далее оптимизированный и в сочетании с другими подходами в соответствии с индивидуальными потребностями экспериментальной, они могут служить быстро, экономически эффективные и надежные инструменты для манипулировать мышиных кишечную микрофлору и изучения последствий антибиотикотерапии кишечная гомеостаза и болезней.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Эта работа финансировалась Великобритании Совета медицинских исследований (Грант п.б. MR/L008157/1); РЖ была поддержана Мари Кюри Европейская стипендий (H2020-МСКА-если-2015-703639); P.M.B. была поддержана студенчества от Великобритании Совета медицинских исследований и короля колледж Лондона докторской обучения партнерства в биомедицинских науках (MR/N013700/1).

Materials

Name Company Catalog Number Comments
Ampicillin sodium salt Sigma-Aldrich (Merck) A9518
Neomycnin trisulfate salt hydrate Sigma-Aldrich (Merck) N1876
Metronidazole Sigma-Aldrich (Merck) M3761
Vancomycin hydrochloride Sigma-Aldrich (Merck) V2002
Gentamicin sulfate salt Sigma-Aldrich (Merck) G3632
Tryptone Sigma-Aldrich (Merck) T7293
Yeast Extract Sigma-Aldrich (Merck) Y1625
NaCL Sigma-Aldrich (Merck) S7653
Sweetener Sweet'n Low Sweet'N Low Available in the UK from Amazon.co.uk
X-Gal (5-brom-4-chloro-3-indoyl B-D-galactopyranoside) Fisher scientific 10234923
Phosphate Buffered Saline  Thermo Fisher Scientific (Gibco) 10010023
Ultrapure Agarose Thermo Fisher Scientific (Invitrogen) 16500500
RT-PCR grade water Thermo Fisher Scientific (Invitrogen) AM9935
Phusion High-Fidelity DNA Polymerase New England BioLabs M0530
Deoxynucleotide (dNTP) Solution Mix New England BioLabs N0447
iTaq Universal SYBR Green Supermix Bio-Rad 1725124 with ROX
TOPO TA cloningTM for sequencing Thermo Fisher Scientific (Invitrogen) 450030
QIAamp fast DNA Stool mini kit  Qiagen 51604
QIAprep spin Miniprep kit Qiagen 27106
QIAquick gel  extraction kit Qiagen 28704
Syringe filter 0.45 µm Fisher scientific 10460031
Swann-MortonTM Carbon steel sterile scalpel blades Fisher scientific 11792724
Syringe (1 mL) BD Plastipak 303172
Syringe (20 mL) BD Plastipak 300613
1.5 mL Crystal clear microcentriguge tube StarLab E1415-1500
2 mL Ultra high recovery microcentrifuge tube StarLab I1420-2600
Oral dosing needles 20 G x 38 mm curved (pk/3) Vet-Tech DE008A
Sterilin petri dish 50 mm  Scientific Laboratory Supplies PET2020
Absolute qPCR plate seals Thermo Fisher Scientific AB1170
MicroAmpTM optical 384-well plate  Thermo Fisher Scientific (Applied Biosystems) 4309849
ViiA7TM 7 real-time PCR system with 384-well block Thermo Fisher Scientific (Applied Biosystems) 4453536
Spectrophotometer (Nanodrop 1000) Thermo Fisher Scientific ND-1000
Labnet Prism microcentrifuge Labnet C2500
MultiGene Optimax Thermal cycler Labnet TC9610

DOWNLOAD MATERIALS LIST

References

  1. Belkaid, Y., Hand, T. W. Role of the microbiota in immunity and inflammation. Cell. 157, (1), 121-141 (2014).
  2. Hooper, L. V., Littman, D. R., Macpherson, A. J. Interactions between the microbiota and the immune system. Science. 336, (6086), 1268-1273 (2012).
  3. Ubeda, C., Pamer, E. G. Antibiotics, microbiota, and immune defense. Trends in Immunology. 33, (9), 459-466 (2012).
  4. Dethlefsen, L., Huse, S., Sogin, M. L., Relman, D. A. The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biology. 6, (11), e280 (2008).
  5. Reikvam, D. H., et al. Depletion of murine intestinal microbiota: effects on gut mucosa and epithelial gene expression. PLoS One. 6, (3), e17996 (2011).
  6. Hill, D. A., et al. Metagenomic analyses reveal antibiotic-induced temporal and spatial changes in intestinal microbiota with associated alterations in immune cell homeostasis. Mucosal Immunology. 3, (2), 148-158 (2010).
  7. Fraher, M. H., O'Toole, P. W., Quigley, E. M. Techniques used to characterize the gut microbiota: a guide for the clinician. Nature Reviews Gastroenterology & Hepatology. 9, (6), 312-322 (2012).
  8. Eckburg, P. B., et al. Diversity of the human intestinal microbial flora. Science. 308, (5728), 1635-1638 (2005).
  9. Sokol, H., et al. Low counts of Fecalibacterium prausnitzii in colitis microbiota. Inflammatiry Bowel Diseases. 15, (8), 1183-1189 (2009).
  10. Bartosch, S., Fite, A., Macfarlane, G. T., McMurdo, M. E. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Applied Environmental Microbiology. 70, (6), 3575-3581 (2004).
  11. Ubeda, C., et al. Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. Journal of Clinical Investigation. 120, (12), 4332-4341 (2010).
  12. Saez de Guinoa, J., et al. CD1d-mediated lipid presentation by CD11c(+) cells regulates intestinal homeostasis. EMBO Journal. 37, (5), (2018).
  13. Kruglov, A. A., et al. Nonredundant function of soluble LTalpha3 produced by innate lymphoid cells in intestinal homeostasis. Science. 342, (6163), 1243-1246 (2013).
  14. Wilhelm, J., Pingoud, A., Hahn, M. Real-time PCR-based method for the estimation of genome sizes. Nucleic Acids Research. 31, (10), e56 (2003).
  15. Kembel, S. W., Wu, M., Eisen, J. A., Green, J. L. Incorporating 16S gene copy number information improves estimates of microbial diversity and abundance. PLoS Computational Biology. 8, (10), e1002743 (2012).
  16. Yang, Y. W., et al. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces. Applied Environmental Microbiology. 81, (19), 6749-6756 (2015).
Количественные полимеразной цепной реакции на основе анализ мышиных кишечной микробиоты после устные лечения антибиотиками
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).More

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter