Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Kvantitativa Polymerase Chain Reaction-baserade analyser av murina tarmens bakterieflora efter Oral antibiotikabehandling

doi: 10.3791/58481 Published: November 17, 2018

Summary

Här tillhandahåller vi detaljerade protokoll för oral administrering av antibiotika till möss, samling av fekal prover, DNA-extraktion och kvantifiering av fekal bakterier av qPCR.

Abstract

Tarmfloran har en central inverkan på människors hälsa. Mikrobiell dysbios är förknippad med många vanliga immunopathologies såsom inflammatorisk tarmsjukdom, astma och artrit. Thus, förstå mekanismerna bakom bakterieflora-immunsystemet överhörning är av avgörande betydelse. Antibiotikumet administrering, medan medhjälp patogen clearance, inducerar också drastiska förändringar i storlek och sammansättning av intestinal bakteriella samhällen som kan ha en inverkan på människors hälsa. Antibiotikabehandling hos möss recapitulates inverkan och långsiktiga förändringar i människans bakterieflora från antibiotiska behandlade patienter och gör utredningen av de mekanistiska samband mellan förändringar i mikrobiella samhällen och immunceller funktion. Medan flera metoder för antibiotikabehandling av möss har beskrivits, framkalla några av dem allvarlig uttorkning och viktminskning komplicerar tolkningen av data. Här, ger vi två protokoll för oral antibiotika administrering som kan användas för långtidsbehandling av möss utan förmå större viktminskning. Dessa protokoll utnyttja en kombination av antibiotika som mål både grampositiva och gramnegativa bakterier och kan tillhandahållas antingen ad libitum i dricksvattnet eller via oral sondmatning. Dessutom beskriver vi en metod för kvantifiering av mikrobiell densitet i fecal prov av qPCR som kan användas för att validera effekten av antibiotika behandling. Kombinationen av dessa synsätt ger en tillförlitlig metod för manipulering av den intestinala bakterieflora och studien av effekterna av antibiotikabehandling hos möss.

Introduction

Däggdjur gastrointestinala slemhinnan är en unik miljö som koloniserats av en mycket komplex blandning av mikroorganismer som skapar en mutualistisk relation till värden. Försvaret av tarmslemhinnan består av en epiteliala lagret och en uppsjö av immunceller som begränsar förknippas inom tarmen samtidigt som deras antal och mångfald. Omvänt, kommensaler organismer krävs för utvecklingen av en fullt fungerande immunförsvar. Interaktioner mellan värd och kommensaler bakterier är normalt fördelaktigt, blir det allt tydligare att dysreglerad immunförsvaret-bakterieflora överhörning kan gynna utvecklingen av kroniska inflammatoriska sjukdomar, sådana asinflammatory tarm sjukdom, artrit eller astma1,2.

Tarmfloran kan ändras av olika faktorer, men kanske de mest drastiska förändringarna induceras av antibiotikabehandling som kraftigt förändrar både storlek och sammansättning av bakteriesamhällen3,4. Fördelarna med antibiotika för att behandla infektioner är obestridliga, kan bakterieflora förändringar orsakade av antibiotika exponering hos människa också ändra immunförsvar vilket kan leda till skadliga effekter på hälsa. Exempelvis behandling med antibiotika hos människa har kopplats till en ökad risk för Clostridium difficile-diarré, astma och vissa typer av cancer3. Antibiotikabehandling hos möss recapitulates inverkan och långsiktiga förändringar i tarmen samhällen av antibiotikum-behandlade patienter och har aktiverat utredning av de mekanistiska samband mellan förändringar i mikrobiella samhällen och immunceller funktion. Flera rapporter har dock visat att administrering av antibiotika på den dricksvatten ad libitum resulterar i mycket märkbar viktminskning som möss avstå från att dricka vatten, förmodligen på grund av dess foul smak5,6. Således i dessa modeller kan den svår dehydrering samtidig oral antibiotika administration komplicera tolkningen av experiment som syftar till att identifiera effekten av antibiotikabehandling i immunceller funktion.

Flera metoder kan användas för att utforska storlek och sammansättning av mikrobiella samhällen i intestinal fack7. Nästa generations sekvensering teknik har tillhandahållit ovärderlig information om denna fråga8, men dessa metoder är relativt dyra och kräver expert bioinformatiska analyser för tolkningen av data. Däremot, traditionella mikrobiologiska kultur metoder möjliggöra upptäckt av bakteriearter, men de har låg känslighet och en stor del av kommensaler bakterier (särskilt anaerober) är mycket svårt eller omöjligt att odla med för närvarande tillgängliga metoder8. Kvantitativa polymerasen kedjar reaktion (qPCR) tekniker används alltmer för kvantifiering och identifiering av fekal bakteriearter, eftersom de ger en snabb och tillförlitlig kultur-oberoende mått på total mikrobiell belastning. QPCR metoder har således visat sig vara användbart för att studera förändringar i den bakterieflora som är associerad med ålder eller progression av flera sjukdomar inklusive inflammatorisk tarmsjukdom sjukdom9,10. I linje med detta ger qPCR metoder en snabb och kostnadseffektiv metod för att validera effekten av olika behandlingar (inklusive antibiotika) fekal bakterier laster och bakterieflora sammansättning10,11,12.

Här presenterar vi en detaljerad steg för steg-redovisning av två distinkta protokoll för oral antibiotika administrering till möss, fekal provtagning, DNA-extraktion, beredning av standarder och kvantifiering av bakterier i fecal prov av qPCR. Dessa protokoll ger en tillförlitlig metod att manipulera den intestinala bakterieflora hos möss och studera effekterna av antibiotikabehandling vid intestinala homeostas och sjukdom.

Protocol

Experimenten som beskrivs här utfördes med hjälp av 6-8 veckor gamla vildtyp (C57BL6/J) möss underhålls i en specifik patogen fri (SPF) anläggning. Alla djurförsök godkändes av King's College London och Storbritannien Home Office, Francis Crick Institute djurvälfärd och etiska prövningsorganet. Innan du påbörjar något djur förfarande, se till att lämpliga behörigheter erhålls genom den lokala institution/organisationen.

1. administrering av antibiotika

Obs: Två alternativa metoder för antibiotikabehandling tillhandahålls: oral sondmatning (steg 1.1) och administrering av antibiotika via dricksvattnet (steg 1.2).

  1. Oral sondmatning
    1. Förbereda bestånd av enskilda antibiotika genom att lösa upp dem i Ånghärdad vatten vid följande koncentrationer: Ampicillin vid 100 mg/mL, Gentamicin vid 100 mg/mL, Neomycin vid 100 mg/mL, metronidazol vid 10 mg/mL och vankomycin vid 100 mg/mL. Filter sterilisera med 0.45 µm filter. Delprov och förvaras vid-20 ° C.
    2. Förbered en cocktail av antibiotika genom att blanda de bestånd som förberetts enligt ovan. För en volym om 1 mL blanda 50 µL av Ampicillin (5 mg/mL slutlig), 50 µL Gentamicin (5 mg/mL slutlig), 50 µL av Neomycin (5 mg/mL slutlig), 500 µL av metronidazol (5 mg/mL slutlig), 25 µL av vankomycin (2,5 mg/mL slutlig) och 325 µL av vatten. Förbereda de cocktail färska före användning.
    3. Läsa in antibiotika mixen i en steril 1 mL-spruta och fixa en lämplig mätare sondmatning nål (20 G för 15 – 20 g möss) samtidigt som det eliminerar eventuella bubblor.
    4. Sondmatning möss med 200 µL av antibiotika mix.
      1. Greppa huden över mus axeln ordentligt, sträcka huvudet och halsen att räta upp i matstrupen. Direkt boll-spetsen av utfodring nålen längs taket i munnen och mot bakre delen av svalget. Sedan försiktigt passera det ner i matstrupen och 200 μL lösningen injiceras.
    5. Administrera antibiotika cocktail en gång dagligen under hela försöket.
  2. Antibiotika i dricksvattnet
    FÖRSIKTIGHET: Noggrant övervaka Musens vikt dagligen under de första två veckorna av antibiotikumet administrering i dricksvattnet.
    1. Förbereda en cocktail av antibiotika genom att lösa följande i 1 L Ånghärdad vatten: 1 g av Ampicillin (1 g/L slutlig), 1 g av Neomycin (1 g/L slutlig), 1 g av metronidazol (1 g/L slutlig), 0,5 g av vankomycin (0,5 g/L slutlig) och 8 dospåsar (0,75 g vardera) artificiell sötningsmedel (60 g/L slutlig). Skaka tills upplöst. Förvaras vid 4 ° C.
      Obs: Sötningsmedel tillsätts dölja smaken av antibiotika och förhindra möss uttorkning. Medan flera sötningsmedel varumärken kan fungera, kan den slutliga koncentration som krävs vara olika för varje specifikt märke.
    2. Fylla de Antibiotikabehandlade cocktailen i en flaska vatten (~ 100 mL/flaska) och placera flaskan på en mus bur.
      Obs: Använd bruna flaskor eller täcka flaskorna med folie ljuskänsligt antibiotika.
    3. Ersätta de Antibiotikabehandlade cocktailen med färsk lager två gånger i veckan under hela försöket.

2. insamling av Fecal prov från pall, Ileum innehåll och Ileum vägg

  1. Väga och etikett 2 mL Ånghärdad rör för provtagning.
  2. För insamling av färska avföringsprover, placera varje mus i en fasthållning och samla fekal pellets direkt från anus i en samling röret.
    Obs: Prover kan också erhållas genom att placera möss i en ren Ånghärdad bur, och samla avföringsprov med ren steriliserad pincett.
  3. Euthanize möss med CO2 kvävning följt av cervikal dislokation.
  4. Lägg ett mus-kadaver med buken fullt exponerade och spraya buken med 70% etanol.
  5. Använda steriliserad pincett och sax, göra en tvärgående snitt i buken att exponera bukhinnan utan att skada någon inre vävnader. Lyft bukhinnan och gör ett snitt att exponera tarmarna.
  6. Ta bort tarmarna (från tjocktarmen till magen) med pincett och sax och placera den i en steril petriskål.
  7. Försiktigt använda pincett för att retas tunntarmen (SI) från mesenterica artärer och fett. Förlänga tarmen och placera den på en ren lab torka.
  8. Med en linjal mäta och skär 4 cm av distala ileum av SI (den närmaste delen till blindtarmen). Skär och kassera den 1 cm av tarmen proximalt blindtarmen. Det blir en 3 cm del av ileum som lämnade som används för att samla in tarmbakterier.
  9. Håll ileum portion (3 cm) över en 2 mL sterilt rör. Samla tarmens innehåll genom direkt strängpressning tarmen och colleting provet i röret. Detta prov kommer att ha bakterier från ileum innehållet.
  10. Förbereda en 20 mL spruta med kall fosfatbuffrad saltlösning (PBS) och spola ileum portion (ignorera genomströmmande).
  11. Placera ileum portion på en ren pappershandduk och öppna den longitudinellt med sax.
  12. Skrapa insidan av ileum väggen med en skalpell.
  13. Samla alla bakterier på skalpell genom att tvätta skalpell med 1 mL PBS över en ren centrifugrör. Snurra på 8 000 × g i 5 min till pellet bakterierna och kasta bort supernatanten. Detta prov kommer att innehålla bakterier från ileum väggen.
    Obs: Fecal prov från pall, ileum innehåll och väggen kan frysas och förvaras vid-80 ° C fram till användning.
  14. Väga rören som innehåller proverna från pall och ileum innehåll och subtrahera vikt från de tomma tuberna (från steg 2.1) för att få fekalt vikten i varje prov.
  15. Extrahera bakteriell DNA från pall, ileum innehåll och ileum vägg prover med kommersiellt tillgängliga kits. Lagra DNA-prover vid-20 ° C fram till användning.

3. kvantifiering av tarmens bakterieflora av qPCR

Obs: Denna procedur innefattar generering av en standard (steg 3.1) och metoden för qPCR set-up för standard- och fecal prov (steg 3,2)

  1. Generering av en standard för qPCR
    1. Använd polymeras-kedjereaktion (PCR) för att förstärka 16S rRNA-genen från genomisk DNA extraheras från en bakterie kultur med hjälp av reagenser13 och PCR villkoren i tabell 1.
    2. Köra PCR-produkten på en 1,5% agarosgel och rena DNA bandet med en kommersiellt tillgänglig DNA extraktion kit.
    3. Ligera av renade DNA fragment med en kloning kit (se Tabell för material, använder en vektor som innehåller markörer för antibiotikaresistens och β-galaktosidas (Lindholm) genen fusion för blå/vit kolonin urval) och omvandla DH10 behöriga E. coli följa tillverkarens instruktioner. Tavla omvandling på Ampicillin (100 µg/mL), X-gal (20 µg/mL) Luria Bertani (LB) agarplattor (10 g/L trypton, 5 g/L jästextrakt, 10 g/L NaCl, 15 g/L Agar). Inkubera över natten (O/N) vid 37 ° C.
    4. Välj en enda positiv (vit)-koloni från plattan. Inokulera det i 5 mL LB buljong som innehåller 100 µg/mL Ampicillin och inkubera O/N vid 37 ° C, skaka vid 250 rpm.
    5. Från O/N kultur, isolera och rena plasmiden med en kommersiell miniprep enligt tillverkarens anvisningar.
      Obs: Det är viktigt att sekvensera plasmid skäret i detta skede, att säkerställa att plasmiden innehåller bara en kopia av 16S rRNA-genen och att bestämma dess längd i base-par (bp).
    6. Linjär plasmiden med ett restriktionsenzym som klipper plasmiden endast en gång.
    7. Rena det linearized plasmid med en kommersiellt tillgänglig kit.
    8. Bestämma koncentrationen av Plasmiden genom att mäta absorbansen vid 260 nm med en spektrofotometer.
    9. Beräkna antalet plasmid kopior/μl av prov med hjälp av följande formel14:
      antal kopior = (belopp * 6.022 × 1023) / (längden * 1 × 109 * 650)
      där uppgår den DNA-koncentration som erhålls i steg 3.1.8 (i ng/µL); och längden är den totala längden av Plasmiden (med insatsen) i bp. Antal kopior kommer att erhållas som kopior/μl.
      Obs: Det finns online-verktyg baserat på formeln ovan som aktiverar lätt beräkningen av antalet plasmid kopior.
    10. Delprov och store standarden som behövs vid-20 ° C fram till användning.
  2. qPCR Set-up för Standard och Fecal prov
    1. Tina de qPCR standard (från steg 3.1.10), fecal prov DNA (från steg 2.15) och qPCR reagens (från ett kommersiellt tillgängliga kit) på is.
      Obs: qPCR reagens som används i det här exemplet inkluderar SYBR Green qPCR reaktionsblandning och framåt och bakåt primers (tabell 2).
    2. Späd standarden i sterila DNA-fritt vatten i ett intervall från 107 till 102 kopior/μl (t.ex. 1/5 seriespädningar från 107 till 6,4 x 102 kopior/μl). Späd fecal prov DNA till 1/2, 1/5, 1/10.
    3. Gör en master mix reaktion för det totala antalet reaktioner plus 1 (tabell 2).
    4. Mix 30 µL av huvudmixen och 5 µL mall (standard, prov eller vatten för negativ kontroll)
    5. Tillsätt 10 µL av denna blandning till varje brunn i en 384-väl optiska qPCR-tallrik. Utför varje reaktion i tre exemplar.
    6. Tätar qPCR platsen, Centrifugera kort och ladda plattan på qPCR maskinen programmerats med cykling följande: 95 ° C under 20 minuter följt av 40 cykler av 95 ° C för 15 s och 60 ° C i 1 min.
    7. Skaffa CT -värden för standard och prover.
    8. Generera en standardkurva genom plottning CT värdena för standarder versus logaritmen av kopia antalet plasmiden (som beräknas enligt steg 3.1.9). Utför linjär regression av standardkurvan.
    9. Beräkna 16S rDNA kopiera siffrorna för fekal prover genom att interpolera CT -värden (erhålls i steg 3.2.2) i standardkurvan.
      Obs: 16S rDNA kopia nummer för varje prov bör rättas till med tanke på utspädningsfaktorn för provet (som bereddes i steg 3.2.2), de slutliga volymen nukleinsyror som var elueras (i steg 2.15) och mängden fecal prov (beräknade i steg 2.14) att få gen kopior per gram avföring.

Representative Results

Här tillhandahåller vi två alternativa protokoll för oral antibiotikabehandling av möss. Figur 1 visar andelen kroppsvikt (relaterat till ursprungliga base linjetjocklek för varje djur) hos möss som behandlades med antibiotika med oral sondmatning (röd) eller i dricksvattnet (blå) för 10 dagar. Vid oral sondmatning finns ingen märkbar viktminskning hos möss som får antibiotika. När möss behandlas med antibiotika ad libitum i dricksvattnet, de gå ner i vikt (~ 10%) inom de första dagarna av antibiotikumet administrering, men återställa därefter normal viktökning (figur 1). Ändå runt 5-10% av möss som fick antibiotika i dricksvattnet når > 20% viktminskning inom den första veckan av behandling, i vilket fall de är euthanized.

Kvantifiering av bakterier i fecal prov kräver användning av en adekvat standard kurva som erhålls genom att rita loggen för kopienumret för standard (som beräknas enligt steg 3.2.2) kontra de CT -värden som erhålls från qPCR (steg 3.2.7). Figur 2A visar ett representativt exempel från en standardkurva som uppfyller kriteriet standardkurvan prestanda med R2 värdet 0.99827, en lutning på-3.09 och en effektivitet ((-1 + 10^(-1/slope))*100) på 110%. R2 värden 0,99 och PCR effektivitetsvinster inom spänna av 90 till 110% är att föredra. Inom linjär möjliggör analys regressionsekvationen kvantifiering av 16S rDNA överflödet inom fekal proverna. Figur 2B visar antalet 16S rDNA kopior i fekal pall, SI innehåll och SI vägg. I figur 2B visas data som 16S rDNA kopior/g fecal prov för fekal pall och SI innehåll. För SI vägg presenteras data som totala antalet 16S rDNA kopior erhållits från bakterier som återhämtat sig från den 3 cm av SI vägg (som mängden utgångsmaterial är för liten för att få en exakt vikt).

För att utvärdera effekten av antibiotika på tätheten av bakterier i fecal prov, möss behandlades med antibiotika av oral sondmatning dagligen i 10 dagar (1 till 10 dagar) och avföringsprover samlades innan (dag 0), vid olika tidpunkter under behandling med antibiotika () dag 5 och 10), och 7 dagar efter att administreringen av antibiotika (dag 17; Figur 3A). Som visas i figur 3B, inducerar antibiotikabehandling en stark minskning av antalet 16S rDNA kopior/g av avföring som upptäcks vid dag 5 och 10, medan tätheten av bakterier i avföringen återställts till normala nivåer (jämförbar med förbehandling) 1 vecka efter antibiotikumet administrering stoppades (dag 17).

Figure 1
Figur 1: administrering av antibiotika. Möss fick antibiotika antingen via oral sondmatning (röd) eller i dricksvattnet (blå) för 10 dagar. Handlingen visar vikter av möss under experimenten i förhållande till original vikt före antibiotikumet administrering (dag 0). Data visas som medelvärde ± SEM. vänligen klicka här för att visa en större version av denna siffra.

Figure 2
Figur 2: 16S rRNA genen qPCR amplifiering av standarder och fecal prov. (A) linjär regression av standardkurvan med standardkurvan deskriptorer. (B) beräkningen av genen sammansättning från fekal prover. Data visas som medelvärde ± SEM. vänligen klicka här för att visa en större version av denna siffra.

Figure 3
Figur 3: fekal bakterier under antibiotikabehandling. (A) Schematisk bild av schemat för antibiotikumet administrering av oral sondmatning (Ab) och provtagning som skildras med *. (B), 16S rDNA kopior per gram avföring i avföringsprover från möss som samlas in på de angivna dagarna. Data visas som medelvärde ± SEM. vänligen klicka här för att visa en större version av denna siffra.

Reagens Volym
DNA 8 ΜL
Buffra 10 X 2 ΜL
dNTP (10mM) 0,4 ΜL
Eubacteria - F primer (10 mM) 1 ΜL
Eubacteria - R primer (10 mM) 1 ΜL
Taq Polimerase 0.2 ΜL
H2O 7,4 ΜL
Totala volymen 20 ΜL
Primer-sekvenser
Eubacteria - F primer 5' ACTCCTACGGGAGGCAGCAGT 3'
Eubacteria - R primer 5' ATTACCGCGGCTGCTGGC 3'
Cykling villkor
Temperatur Tid Cykler
94 ° C 5 min 1 x
94 ° C 30 s 30 x
60 ° C 30 s 30 x
72 ° C 1 min 30 x
72 ° C 5 min 1 x
4 ° C 1 x

Tabell 1: PCR reagens och villkorar. Denna tabell ger reagenser och PCR-cykling villkor att förstärka 16S rRNA-genen från bakterieodling för generering av en standard för att använda i qPCR analyserna. Primer sekvenser publicerades ursprungligen av Kruglov o.a. 13.

Reagens Volym
SYBR Green master mix (2 x) 17,5 ΜL
Eubacteria - F primer (10 mM) 0.7 ΜL
Eubacteria - R primer (10 mM) 0.7 ΜL
H2O 11.1 ΜL

Tabell 2: qPCR huvudmixen. De volymer som anges (slutlig volym 35 µL) är för ett enda prov kan köras på tre exemplar (10 µL varje) på en 384-väl qPCR tallrik (redovisning för 5 µL extra för pipettering fel). Beloppet kan vara skalas upp beroende på antalet prov som ska analyseras.

Discussion

Här tillhandahåller vi experimentella protokoll för oral administrering av antibiotika till möss och kvantifiering av fekal bakterier av qPCR. Kombinationen av antibiotika används i detta protokoll (innehållande ampicillin, gentamicin, neomycin, metronidazol och vankomycin) mål både grampositiva och gramnegativa bakterier, erbjuder bakteriedödande aktivitet mot ett fullt spektrum av bakterier. Både oral sondmatning och administrering av antibiotika i dricksvattnet kraftigt minska fekal bakteriell belastning5,6,12. Dessutom har båda behandlingarna en djupgående effekt på fenotypen av möss när de utvecklar flera egenskaper som är typiska för bakteriefria möss inklusive minskad mjältstorlek och utvidgade blindtarmen. Valet av en särskild metod för antibiotikumet administrering kan möjligen bero på längden av experimentet som oral sondmatning metoden kräver daglig administrering av antibiotika, att vara mer arbetsintensiva och eventuellt orsakar mer obehag för de djur på lång sikt.

För administrering av antibiotika i dricksvattnet, måste försiktighet iakttas med tillägg av sötningsmedlet till antibiotika blandningen eftersom detta är en avgörande faktor att hålla möss från uttorkning. Flera grupper har visat hur administrering av antibiotika i dricksvatten (utan tillsats av sötningsmedel) leder till mycket allvarliga och snabb viktminskning med alla möss att förlora mer än 20% av ursprungliga kroppsvikt inom de första dagarna av experiment5 , 6. i våra protokoll, användning av sötningsmedlet sackarin-baserade tycktes vara tillräcklig för att maskera den antibiotiska smaken i vattnet och möss gick ner i vikt de första dagarna efter administrering av antibiotika, men återhämtade sig deras vikter snabbt efter att ( Figur 1). Dock i våra experiment 5-10% av mössen fortfarande nå humana slutpunkten av > 20% förlust av baslinjen kroppsvikt och behövde till vara euthanized. Vi har också testat sukralos-baserade sötningsmedel som helt misslyckats med att förhindra möss uttorkning (100% av möss som förlorat > 20% av vikten) medan andra författare har publicerat liknande misslyckanden för aspartam-baserade sötningsmedel5,6. Till detta övervägas ålder, genetisk bakgrund och allmänna hälsotillståndet hos de möss som används för experiment, eftersom de kan påverka viktminskning och djurens välbefinnande under behandling med antibiotika. Noggrann övervakning av möss vikt och allmänna hälsotillstånd bör således utföras dagligen under de första två veckorna av oral antibiotika administrering.

qPCR metoder ger en snabb och kostnadseffektiv metod för kvantifiering av 16S rRNA i fekal prover. Dock vissa begränsningar bör beaktas när det gäller denna teknik inklusive: jag) kravet på en tillförlitlig hög standard. (II) design och effektivitet av qPCR primers; (III) det faktum att mikroorganismer kan ha olika exemplar nummer av 16S rRNA-genen, således gen kopior kan inte direkt lika cell räknas15. Ändå, qPCR är en robust och känslig metod som möjliggör snabb analys av fekalt prover. Denna metod kan vara särskilt användbart för att snabbt validera effekten av olika behandlingar (inklusive antibiotika) i fekal bakterier laster som detaljerad här. Dessutom, även om vi tillhandahåller ett protokoll för kvantifiering av totala 16S rRNA, denna metod kan lätt anpassas (genom att utforma specifika primers16) till möjliggöra identifiering av enskilda bakteriell taxa, vilket ger både kvantitativa och kvalitativ information om mikrobiomet storlek och sammansättning.

Sammanfattningsvis har vi tillhandahållit två protokoll för oral antibiotikabehandling av möss och en qPCR-baserad metod för att kvantifiera antibiotikum-inducerade förändringar i fekal bakterier. Även om dessa protokoll kan ytterligare optimerad och kombineras med andra metoder utifrån individuella experimentella behov, kan de fungera som snabbt, kostnadseffektivt och tillförlitligt verktyg för att manipulera det murina tarmens bakterieflora och studera effekter av antibiotikabehandling vid intestinala homeostas och sjukdom.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Detta arbete finansierades av brittiska Medicinska forskningsrådet (grant till P.B. Herr/L008157/1); R.J. stöddes av en Marie Curie Intra-European Fellowship (H2020-behöriga myndigheters-IF-2015-703639); P.M.B. stöddes av en STUDENTTILLVARO från UK Medicinska forskningsrådet och King's College London forskarnivå utbildning partnerskap i biomedicinsk vetenskap (herr/N013700/1).

Materials

Name Company Catalog Number Comments
Ampicillin sodium salt Sigma-Aldrich (Merck) A9518
Neomycnin trisulfate salt hydrate Sigma-Aldrich (Merck) N1876
Metronidazole Sigma-Aldrich (Merck) M3761
Vancomycin hydrochloride Sigma-Aldrich (Merck) V2002
Gentamicin sulfate salt Sigma-Aldrich (Merck) G3632
Tryptone Sigma-Aldrich (Merck) T7293
Yeast Extract Sigma-Aldrich (Merck) Y1625
NaCL Sigma-Aldrich (Merck) S7653
Sweetener Sweet'n Low Sweet'N Low Available in the UK from Amazon.co.uk
X-Gal (5-brom-4-chloro-3-indoyl B-D-galactopyranoside) Fisher scientific 10234923
Phosphate Buffered Saline  Thermo Fisher Scientific (Gibco) 10010023
Ultrapure Agarose Thermo Fisher Scientific (Invitrogen) 16500500
RT-PCR grade water Thermo Fisher Scientific (Invitrogen) AM9935
Phusion High-Fidelity DNA Polymerase New England BioLabs M0530
Deoxynucleotide (dNTP) Solution Mix New England BioLabs N0447
iTaq Universal SYBR Green Supermix Bio-Rad 1725124 with ROX
TOPO TA cloningTM for sequencing Thermo Fisher Scientific (Invitrogen) 450030
QIAamp fast DNA Stool mini kit  Qiagen 51604
QIAprep spin Miniprep kit Qiagen 27106
QIAquick gel  extraction kit Qiagen 28704
Syringe filter 0.45 µm Fisher scientific 10460031
Swann-MortonTM Carbon steel sterile scalpel blades Fisher scientific 11792724
Syringe (1 mL) BD Plastipak 303172
Syringe (20 mL) BD Plastipak 300613
1.5 mL Crystal clear microcentriguge tube StarLab E1415-1500
2 mL Ultra high recovery microcentrifuge tube StarLab I1420-2600
Oral dosing needles 20 G x 38 mm curved (pk/3) Vet-Tech DE008A
Sterilin petri dish 50 mm  Scientific Laboratory Supplies PET2020
Absolute qPCR plate seals Thermo Fisher Scientific AB1170
MicroAmpTM optical 384-well plate  Thermo Fisher Scientific (Applied Biosystems) 4309849
ViiA7TM 7 real-time PCR system with 384-well block Thermo Fisher Scientific (Applied Biosystems) 4453536
Spectrophotometer (Nanodrop 1000) Thermo Fisher Scientific ND-1000
Labnet Prism microcentrifuge Labnet C2500
MultiGene Optimax Thermal cycler Labnet TC9610

DOWNLOAD MATERIALS LIST

References

  1. Belkaid, Y., Hand, T. W. Role of the microbiota in immunity and inflammation. Cell. 157, (1), 121-141 (2014).
  2. Hooper, L. V., Littman, D. R., Macpherson, A. J. Interactions between the microbiota and the immune system. Science. 336, (6086), 1268-1273 (2012).
  3. Ubeda, C., Pamer, E. G. Antibiotics, microbiota, and immune defense. Trends in Immunology. 33, (9), 459-466 (2012).
  4. Dethlefsen, L., Huse, S., Sogin, M. L., Relman, D. A. The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing. PLoS Biology. 6, (11), e280 (2008).
  5. Reikvam, D. H., et al. Depletion of murine intestinal microbiota: effects on gut mucosa and epithelial gene expression. PLoS One. 6, (3), e17996 (2011).
  6. Hill, D. A., et al. Metagenomic analyses reveal antibiotic-induced temporal and spatial changes in intestinal microbiota with associated alterations in immune cell homeostasis. Mucosal Immunology. 3, (2), 148-158 (2010).
  7. Fraher, M. H., O'Toole, P. W., Quigley, E. M. Techniques used to characterize the gut microbiota: a guide for the clinician. Nature Reviews Gastroenterology & Hepatology. 9, (6), 312-322 (2012).
  8. Eckburg, P. B., et al. Diversity of the human intestinal microbial flora. Science. 308, (5728), 1635-1638 (2005).
  9. Sokol, H., et al. Low counts of Fecalibacterium prausnitzii in colitis microbiota. Inflammatiry Bowel Diseases. 15, (8), 1183-1189 (2009).
  10. Bartosch, S., Fite, A., Macfarlane, G. T., McMurdo, M. E. Characterization of bacterial communities in feces from healthy elderly volunteers and hospitalized elderly patients by using real-time PCR and effects of antibiotic treatment on the fecal microbiota. Applied Environmental Microbiology. 70, (6), 3575-3581 (2004).
  11. Ubeda, C., et al. Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans. Journal of Clinical Investigation. 120, (12), 4332-4341 (2010).
  12. Saez de Guinoa, J., et al. CD1d-mediated lipid presentation by CD11c(+) cells regulates intestinal homeostasis. EMBO Journal. 37, (5), (2018).
  13. Kruglov, A. A., et al. Nonredundant function of soluble LTalpha3 produced by innate lymphoid cells in intestinal homeostasis. Science. 342, (6163), 1243-1246 (2013).
  14. Wilhelm, J., Pingoud, A., Hahn, M. Real-time PCR-based method for the estimation of genome sizes. Nucleic Acids Research. 31, (10), e56 (2003).
  15. Kembel, S. W., Wu, M., Eisen, J. A., Green, J. L. Incorporating 16S gene copy number information improves estimates of microbial diversity and abundance. PLoS Computational Biology. 8, (10), e1002743 (2012).
  16. Yang, Y. W., et al. Use of 16S rRNA Gene-Targeted Group-Specific Primers for Real-Time PCR Analysis of Predominant Bacteria in Mouse Feces. Applied Environmental Microbiology. 81, (19), 6749-6756 (2015).
Kvantitativa Polymerase Chain Reaction-baserade analyser av murina tarmens bakterieflora efter Oral antibiotikabehandling
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).More

Jimeno, R., Brailey, P. M., Barral, P. Quantitative Polymerase Chain Reaction-based Analyses of Murine Intestinal Microbiota After Oral Antibiotic Treatment. J. Vis. Exp. (141), e58481, doi:10.3791/58481 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter