Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Plant vækst og Agrobacterium-medieret Floral-dip Transformation af Extremophyte Schrenkiella parvula

doi: 10.3791/58544 Published: January 7, 2019

Summary

Agrobacterium-medieret transformation ved hjælp af en blomster-dip metode kan anvendes med succes at skabe stabile transgene linjer af extremophyte model Schrenkiella parvula. Vi præsenterer en protokol, der er ændret fra at for Arabidopsis thaliana, overvejer forskellige vækst vaner og fysiologiske egenskaber af extremophyte.

Abstract

Schrenkiella parvula er en extremophyte tilpasses forskellige abiotiske understreger, herunder flere ion toksicitet understreger. Trods høj kvalitet genomiske ressourcer til rådighed til at studere, hvordan planter tilpasse sig miljø understreger, dets værdi som en funktionel genomforskning model og værktøj har været begrænset af manglen på en gennemførlig transformation system. I denne protokol, rapporterer vi hvordan man kan generere stabile transgene S. parvula linjer ved hjælp af en Agrobacterium-medieret blomster-dip metode. Vi ændrede transformation protokollen anvendes til A. thaliana redegøre for unikke træk ved S. parvula, som en ubestemt blomstring vane og en høj epicuticular voks indhold på bladene. Kort, S. parvula frø blev stratificeret ved 4 ° C i fem dage før plantning. Planterne blev dyrket på en lysperiode en 14 h lys og 10 h mørke og en 130 µmol m-2s-1 lysintensitet, ved 22 ° C til 24 ° C. Otte til ni uger gamle planter med flere blomsterstande blev udvalgt til transformation. Disse blomsterstande var dyppet i en infiltration løsning af Agrobacterium tumefaciens GV3101 transporterer pMP90RK plasmid. Vi udførte to runder af blomst dypning med et interval på tre til fire uger at øge transformation effektivitet. T1 frø blev indsamlet og tørret i fire uger i en beholder med desiccants før spiringen at screene for kandidat omdannet linjer. Modstand til BASTA blev anvendt til at screene T1 planter. Vi sprøjtede BASTA løsning tre gange med et interval på tre dage starter på to uger gamle planter at mindske falske positiver. En BASTA drop test blev udført på overlevende enkelte planter til at identificere sande positive transformants. Transformation effektivitet var 0.033%, hvilket giver 3 – 4 transgene planter pr. 10.000 T1 frø opformeret.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I denne protokol beskrive vi den vækst og etablering af stabile transgene linjer for extremophyte modellen Schrenkiella parvula. Tilgængeligheden af en effektiv transformation system er kendetegnende for nogen alsidig genetiske model. Planter, der trives i ekstreme miljøer, nævnt som extremophytes, give en afgørende ressource for at forstå plante tilpasning af miljøbelastninger. Schrenkiella parvula (tidligere Thellungiella parvula og Eutrema parvulum) er en sådan extremophyte model, med ekspanderende genomiske ressourcer1,2,3,4,5. Men, transformation protokoller har ikke endnu blevet rapporteret til S. parvula i offentliggjorte undersøgelser.

Genomet af S. parvula er den første offentliggjorte extremophyte genom i Brassicaceae (sennep-kål familie) og viser en omfattende samlede genom synteny med ikke-extremophyte model, Arabidopsis thaliana1. Således, sammenlignende undersøgelser mellem A. thaliana og S. parvula kunne drage nytte af rigdommen af genetiske undersøgelser udført på A. thaliana at gøre informative hypoteser om, hvordan S. parvula genomet har udviklet sig og reguleret anderledes for at håndtere understreger ekstreme miljømæssige5,6,7. S. parvula er en af de mest salt-tolerant arter (baseret på jord NaCl LD50) blandt kendte vilde slægtninge af A. thaliana8. Udover NaCl tolerance, S. parvula overlever og fuldender dens livscyklus i overværelse af flere salt ioner i høje koncentrationer giftige for de fleste planter7. Svar på de abiotiske påvirkninger, den fremherskende i dens naturlige habitat, den har udviklet sig forskellige karaktertræk, hvoraf flere er blevet undersøgt på de biokemiske eller fysiologiske niveau 8,9,10, 11.

Siden 2010, har der været over 400 peer-reveiwed publikationer, der bruges S. parvula som målart eller bruges det i en sammenligning med andre plante genomer. Imidlertid kunne en klar flaskehals identificeres med et nærmere kig på hvilken type undersøgelser er blevet gennemført. Fleste af disse rapporter drøfte den potentielle anvendelse af S. parvula i fremtidige undersøgelser eller bruge det i komparativ genomisk eller phylogenomic studier. På grund af manglende en proof of concept transformation protokol etableret for S. parvula, det ikke har været brugt i funktionelle genomisk undersøgelser, selv om de har en af de højeste kvalitet plante genomer rådighed til dato (> 5 Mb contig N50) samlet og kommenteret i kromosom-niveau pseudomolecules1.

Agrobacterium-medieret blomster-dip transformation metode er blevet den mest bredt anvendte metode til at oprette trasngenic linjer i A. thaliana, og udviklingen af en reproducerbar system af transformation var en kritisk faktor for dens succes som en genetiske model12,13. Dog har ikke alle Brassicaceae arter vist sig at omsættes med succes ved hjælp af metoden blomster-dip udviklet til A. thaliana. Specielt, har arternes Brassicaceae Lineage II, der omfatter S. parvula været genstridige til blomster-dip baseret transformation metoder14,15.

Ubestemt blomstrende vækst vane af S. parvula, kombineret med dens smalle blad morfologi har gjort det udfordrende at vedtage standard Agrobacterium-medieret blomster-dip transformation metode. I denne undersøgelse rapport vi den ændrede protokol, vi har udviklet for reproducerbare transformation af S. parvula.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. planternes vækst

  1. Frø sterilisation (valgfri)
    1. Forberede 50% blegemiddel i dobbeltdestilleret vand (ddH2O) med 1 eller 2 dråber af en nonionisk detergent (Se Tabel af materialer) i en 50 mL tube. Vend røret flere gange for at blande opløsningen.
      Bemærk: Det er bedre at gennemføre frø sterilisation i en laminar flow kabinet med UV steriliseret overflade i 15 min.
    2. Tilføj blegemiddelopløsning at ~ 100 – 200 S. parvula frøene i 1,5 mL rør. Bland grundigt og lad det sidde i 5 min. rør.
    3. Fjern blegemiddel fra røret og tilføje 70% ethanol. Vask frøene af pipettering flere gange og derefter fjerne ethanol løsning umiddelbart.
    4. Vask frøene i steriliseret vand for at fjerne overskydende blegemiddel og ethanol, derefter fjerne vandet. Gentag dette trin 5-6 gange.
  2. Frø stratificering
    1. Fordyb frø i steriliseret vand og opbevares i 5 til 7 dage ved 4 ° C. Alternativt, så tørrede usteriliseret frøene direkte på våd jord, og placere bakken jord i 5 til 7 dage ved 4 ° C.
  3. Dyrkning af planter i forberedelsen af transformation
    1. Fyld jord mix (Se Tabel af materialer) i 7 x 6 cm2 Potter, suge krukker i vand og sprøjte vand fra toppen til at sikre en ensartet våde vækstmediet. Tilføj 5-gødning perler (Se Tabel af materialer) på overfladen af hver pot.
      Bemærk: Som vi har oplevet, vokser S. parvula godt på enhver jord mix hvor A. thaliana kan vokse.
    2. Ved hjælp af en våd tandstikker, overføre 20 ~ 25 frø pr. pot på jordens overflade.
      Bemærk: En praktisk praksis er at sætte en serie af 4-5 frø i de fire hjørner og i midten af pot (figur 1, dag 15, venstre panel).
    3. Dække bakken puljen med en klar kuppel til at holde frøene under høj luftfugtighed under spiring.
    4. Holde anlægget bakker i en vækst kammer med en lysintensitet på 130 µmol m−2 s1 lys, 22-24 ° C temperatur og 14 h per dag/10 h pr. nat cyklus. Fjerne kuplerne efter 7-10 dage efter spiring. Tilsæt vand fra bunden af skuffen til at holde jorden fugtet ensartet på et ønskeligt niveau.
    5. Frasortere ekstra kimplanter og efterlade kun 4-5 sunde planter pr pot godt adskilt fra hinanden (figur 1, dag 15, højre panel).
    6. Blidt vand planterne hver to dage og befrugte med 0,2 x Hoaglands løsning16 en gang hver anden uge.
      Bemærk: Holde jordfugtighed på et ensartet niveau er nøglen til voksende S. parvula konsekvent og sundt.
    7. Fortsætte med at vokse planter for 8-10 uger indtil flere blomsterstande producere 100 – 150 blomster knopper pr. plante (figur 1, dag 60-80). Den dag planlagt for blomster-dip baseret transformation (trin 4.5), skal du fjerne alle modne og udvikle siliques fra planterne.

2. kloning gen/genomisk elementet af interesse i en vektor for anlægget Transformation

  1. Forstærke target DNA fragment bruger polymerase kædereaktion (PCR)17 og isolere PCR produkt ved hjælp af en gel udvinding kit (Se Tabel af materialer) Ifølge kit protokol eller en anden passende metode til at rense DNA ved hjælp af agarosegel elektroforese17,18. Kontrollere rækkefølgen af isolerede PCR produktet gennem Sanger sekventering19.
  2. Klon ønskede PCR produktet ind i kloning vektor og omdanne den klonede konstruktion i de kompetente E. coli celler ved hjælp af en topoisomerase-baserede kloning kit (Se Tabel af materialer) efter producentens retningslinjer.
  3. Spred 50 µL af transformerede produkter på Luria-Bertani20 (LB) agar bakteriel vækst medier (tabel 1) med passende antibiotika, e.g., 50 µg / mL Spectinomycin (Se Tabel af materialer), og der inkuberes ved 37 ° C natten over.
  4. Den følgende dag, skal du vælge 5 – 10 enkelt kolonier, podes i LB Lage med passende antibiotika og inkuberes med blid ryster ved 37 ° C natten over.
  5. Isoleres plasmider ved hjælp af en plasmid isolering kit (Se Tabel af materialer) og kontrollere gennem Sanger sekventering19 om target sekvensen forstærkes i 2.1 er korrekt klonet.
  6. Overføre den klonede og verificeres PCR produkt til en destination vektor for anlægget transformation kompatibel med rekombination-baserede kloning (Se Tabel af materialer), ved hjælp af et recombinase enzym mix kit (Se Tabel af materialer), følgende kit fabrikantens anvisninger. Gentag fra trin 2.3 til trin 2.5 at isolere og kontrollere kloner husly ordentlig plasmid konstruktioner.

3. omdanne vektor konstruere for anlægget Transformation til Agrobacterium tumefaciens

  1. Omdanne plasmid af vektor konstruktion fra 2,6 til A. tumefaciens stamme GV3101:pMP90RK21, som havne en Rifampicin modstand genet til kromosom baggrund udvælgelse. Bruge relevante antibiotika, fx phosphatbufferet eller Kanamycin (Se Tabel af materialer), for udvælgelse af plante transformation konstruere (Ti plasmidet). En kort protokol for A. tumefaciens transformation via elektroporation indgår i afsnit 3.2.
  2. A. tumefaciens transformation af elektroporation
    1. A. tumefaciens kompetente celler22 på is. Mix 0,1-1 µg af plasmid forberedt fra 2,6, opløst i 1 – 2 µL af Hedeselskabet2O, med kompetente celler på is. Overfør blandingen til en elektroporation kuvette (Se Tabel af materialer).
    2. Udføre elektroporation på blandingen af plasmider og kompetente celler fra 3.2.1, ved hjælp af en electroporator (Se Tabel af materialer) efter producentens retningslinjer.
      Bemærk: Rengøre overfladen på kuvette før du starter elektroporation.
    3. Overføre reaktionsblandingen fra kuvette til et microcentrifuge rør, der indeholder 1,5 mL flydende LB og bland godt med pipettering og Inkuber i 1 time ved 28 ° C med blid ryster.
  3. Podes den transformerede A. tumefaciens fra afsnit 3.2 på LB plader der indeholder passende udvalg antibiotika (fx Kanamycin 25 µg / mL, Spectinomycin 50 µg / mL, phosphatbufferet 25 µg / mL, og Rifampicin 50 µg / mL) og inkuberes ved 28 ° C i 3 dage.

4. Agrobacterium-medieret Transformation af S. parvula

  1. Podes enkelt omdannet kolonier fra plader til 10 mL af LB flydende medier indeholdende antibiotika (den samme som i 3.3) i en steril 50 mL konisk tube (Se Tabel af materialer). Der inkuberes i 24 timer i en rystende inkubator (Se Tabel af materialer) på 250 omdrejninger. ved 28 ° C.
  2. Bakteriel opløsningen overføres fra 3.4.1 til en steril 250 mL kolbe, der tilsættes 40 mL LB flydende medier med passende antibiotika og Inkuber 12t, indtil den optisk tæthed på 600 nm bølgelængde (OD600) når omkring 2,0.
  3. Der centrifugeres A. tumefaciens cultureat 3.100 x g i 10 min. Fjern supernatanten og genopslæmmes bakteriekulturen i 40 mL af A. tumefaciens infiltration løsning (tabel 1).
  4. Fortynd den resuspenderede A. tumefaciens med infiltration løsning til en afsluttende OD600 af 0,8. Tilsæt 25 µL af overfladeaktivt stof løsning (tabel 1) 50 ml fortyndet A. tumefaciens løsning og mix af invertere flere gange.
  5. Dyp blomsterstand planter i A. tumefaciens løsning udarbejdet i punkt 4.4 til 20 s. Brug en frisk bakteriel løsning efter dypning blomsterstand fra seks gryder. Sørg for alle blomster er i kontakt med løsningen. Med pipette overfoeres bakteriel løsninger direkte på blomster placeret i den lavere del af Blomsterstanden, hvis de ikke kan være dyppet i løsningen.
    Bemærk: For første runde transformation, Sørg for at fjerne alle modne og udvikle siliques ved hjælp af en skarp skalpel eller lille saks. Fjern ikke siliques, hvis udførelse transformation for anden gang.

5. efter transformation plante pleje og den anden Transformation

  1. Placere blomster dyppet planterne vandret i ren bakker med kupler til at dække planterne og placere i en mørk vækst plads til 1-2 dage.
    Bemærk: Holde blomster under høj fugtighed er vigtigt på dette stadium (figur 1, planter efter transformation).
  2. Returnere planterne til en oprejst position og overføre planter til en vækst værelse med en 14 h per dag/10 timer pr. nat cyklus, 130 µmol m-2 s-1 lysintensitet og 22 til 24 ° C temperatur.
  3. Overvåge de dyppes blomsterstande i den følgende uge. Hvis et betydeligt antal blomster afbryde (figur 2), Gentag floral dip (trin 4) efter ca 4 uger eller et stort antal af blomster har nyudviklet.
    Bemærk: I modsætning til trinnet forberedelse til den første transformation (trin 1.3.7) ikke fjerne eksisterende eller udvikle siliques (figur 2) før anden runde af transformation.
  4. Vokse planter, indtil Frøene modnes og høste frø på ~ 21 uger.
  5. Tørt frø til 2 – 3 uger ved stuetemperatur i en lufttæt beholder med fyldt med desiccants (Se Tabel af materialer).

6. valg af Positive Transformants

  1. Plante T1 frø, som beskrevet for vildtype frø i trin 1,2 til 1,3.
  2. Vokse planter, indtil de første 2 løvblade udvikle, ca. 10-14 dage efter spiring.
  3. Udføre den første udvælgelse for herbicidet modstand (fig. 3A og 3 b) som beskrevet nedenfor.
    1. Fortynd ammoniumglufosinat (11,3%) herbicid (eller BASTA) (tabel 1) til 1:1,000 (v/v). Spray fortyndet BASTA løsning på planter og dække planterne med kupler natten over.
    2. Gentag BASTA sprøjtning 2 – 3 gange hver 5-7 dage.
  4. Udføre den anden markering med en BASTA-drop test som beskrevet nedenfor.
    1. Identificere planter, der overlever efter at være sprøjtet 3 – 4 gange med BASTA løsning. Vokse planter til yderligere 2-3 uger indtil 3-5 blade udvikle et relativt stort overfladeareal.
    2. Vælg den største modne leaf pr. plante, gnide overfladen af blad forsigtigt med en finger til at fjerne vokslag og placere en dråbe af den fortyndede BASTA løsning (fra trin 6.3.1).
      Bemærk: Mark placeringen af bladet anvendes med BASTA drop ved at placere et papir tape på den nærmeste stilk.
    3. Overvåge bladene anvendes med BASTA drop for tegn på visnen op til en uge. Vælg planter med blade upåvirket af BASTA dråber.
      Bemærk: Blade fra mest falsk-positive planter begynder at visne i løbet af to dage, mens bladene fra sand-positiver er intakt, selv efter dråbe af BASTA løsning tørrer op (figur 3C).
  5. Bekræfte positive transformants ved hjælp af genomisk PCR.
    1. Indsamle 2 – 3 blade fra de efterladte planter på trin 6.4.5.
    2. Uddrag genomisk DNA fra bladene ved hjælp af CTAB metoden23 eller enhver anden passende DNA ekstraktion metode.
    3. Udføre PCR ved hjælp af uddraget genomisk DNA-prøver fra målgruppen af planter, wild-type planter (som negative kontroller) og plasmid konstruktion fra trin 3.1 (som positiv kontrol). Brug en passende par af PCR primere specifikke til den selektive markørgen, f.eks, til BASTA-resistente gen (bar), TCAGCAGGTGGGTGTAGA (frem) og GTCAACCACTACATCGAGACAA (omvendt).
      1. For eksempel PCR primere målretning bar -genet, bruge følgende PCR betingelser: det indledende denaturering skridt på 98 ° C til 30 s; efterfulgt af 30 cyklusser af denatureringen på 98 ° C til 30 s, udglødning på 59 ° C til 30 s, og udvide ved 72 ° C i 30 s; og den sidste udvidelse ved 72 ° C i 5 min.
        Bemærk: For at sikre, at indsættelsen af den hele T-DNA, anbefaler vi også udfører genomisk PCR ved hjælp af en PCR primer fra den selektive markørgen og en anden PCR primer specifikke for mål-sekvens klonet plante transformation vektor på trinnet
    4. Bekræfte tilstedeværelsen af den forventede størrelse af forstærket bar PCR produkt ved agarosegelelektroforese gel elektroforese17 mål prøverne (figur 4A) samt ved sekventering isolerede PCR produkt19 med den samme procedure som i trin 2.1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vi udviklede en transformation protokol, der giver mulighed for høst af T0 frøene 150 dage, en metoden blomster-dip er ændret fra at for A. thaliana. Figur 1 viser en oversigt over tidslinjen og S. parvula planter, der repræsenterer den optimale fase for udførelsen transformation gennem blomster-dip. Vi valgte S. parvula planter med 70 –80 blomster i flere blomsterstande 60 – 80 dage efter spiring som target scenen for transformation. Et lille antal eksisterende åbne eller befrugtede blomster og siliques på dette tidspunkt blev fjernet før infiltration af A. tumefaciens ved metoden blomster-dip. Infektion med A. tumefaciens resulterede i abort af nogle blomster (figur 2, beslag (a)). Siliques fuldt udviklet efter blomster-dip er tilbøjelige til at indeholde transformerede frø (figur 2, beslag (b)). Selv efter omdannelse, S. parvula fortsatte med at udvikle nye blomsterstande og blomster som planterne blev holdt sunde (figur 2, hvide pile). På grund af denne ubestemt blomstring vane, kan en anden runde af transformation udføres, hvis planten ikke viser tegn på stress eller ældning. Figur 2 A og 2B viser eksempler på S. parvula planter efter den første og anden runde af transformation, henholdsvis 25 dage fra hinanden. I den anden transformation, bør eksisterende siliques ikke fjernes, fordi de kan indeholde genetisk modificeret frø. Også, A. tumefaciens kan anvendes af pipettering infiltration løsning (tabel 1) på nyopstået blomsterklaser, i stedet for at dyppe hele skyde i løsningen, at minimere skaderne til siliques fra først transformation.

Transformation effektivitet er 0.033%, giver 3 – 4 transgene planter pr. 10.000 T1 frø opformeret ved hjælp af den aktuelle protokol. Dette skøn er baseret på ~ 50.000 T1 frø testet under ti uafhængige transformation forsøg. Mens effektiviteten er lavere end fra Arabidopsis thaliana, kan det sammenlignes med omdannelsen af en anden extremophyte plante Eutrema salsugenium24 og nogle af Arabidopsis thaliana økotyper25. Transformation effektivitet kan optimeres yderligere ved hjælp af alternative Agrobacterium stammer og ændringer af overfladeaktivt stof og infiltration løsninger. Den flere BASTA spray og drop test (trin 6.3 og 6.4) vil være afgørende for at identificere sandt positive transformants og reducere antallet af stikprøver, der undersøges ved hjælp af PCR bekræftelse i skridt 6,5 (figur 4A). Yderligere bekræftelse af transformation kan kontrolleres med en reporter gen expression, hvis klonede sekvensen indeholder en reporter gen (fig. 4B).

Figure 1
Figur 1 : Tidslinje S. parvula transformation. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: S. parvula planter efter omdannelsen af blomster-dip. Planterne blev fotograferet 10 dage efter de første blomster-dip på dag 60 (A) og 25 dage efter andet runde af blomster-dip på dag 85 (B). Infiltration med Agrobacterium kan afbryde silique udvikling af blomster, som vist i parenteser en. Siliques fuldt udviklet efter blomster-dip er tilbøjelige til at indeholde transformerede frø (parentes b). Hvide pile angiver, blomster og blomsterstande nyligt opstået efter hver transformation. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : Udvalg af S. parvula transformants baseret på BASTA modstand. (A) T1 frøplanter før BASTA spray. (B) rød cirkel angiver en kandidat transformant overlevende første-runde valg af BASTA spray. (C) den anden runde udvalg af BASTA drop test. Er vist et eksempel af falske positiver (toppanelet) og sande transgene planter (nederste panel). Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4 : Bekræftelse af S. parvula transformation. (A) PCR forstærkning af bar -genet fra genomisk DNAs udvundet fra S. parvula planter. Lane 1 og 13: størrelse markører; Lane 2: negativ kontrol; Lane 3-5: vildtype S. parvula ; Lane 6-10: transgene S. parvula kandidater; Lane 11, 12: vektor kontrol. Baner 7, 8 og 9 eksemplificere positive transformants. (B) eksempel på GUS reporter gen expression i en positiv S. parvula transformant. Venligst klik her for at se en større version af dette tal.

Medier / løsning Reagens Beløb
Luria-Bertani (LB) bakteriel vækst medier NaCl
Trypton
Gærekstrakt
Agar (for plader)
Hedeselskabet2O
10 g
10 g
5 g
20 g
955 mL
Agrobacterium infiltration løsning MS salt (1/4 x)
B5 vitaminer (1 x)
Saccharose (5%w/v)
MES
N6- benzylaminopurine (BA)
Silwet L-77 (0.05%v/v)
pH
2.16 g
1 mL
50 g
0,5 g
10 ΜL
500 ΜL
5.7

Tabel 1: sammensætningen af bakteriel vækst medier og Agrobacterium infiltration løsning.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Plantens fysiologiske tilstand væsentligt påvirker effektiviteten af transformation25. Brug af sund og energisk planter til transformation er et centralt krav for vellykket transformation i S. parvula. Vand eller lys stresset planter vil have færre blomster i forhold til de sunde planter ideelt for transformation (figur 1, center panel). S. parvula kan vokse ved en let intensitet mindre end 130 µmol m-2 s-1, men planter har tendens til at være svage; sådanne anlæg ville føre til mere afbrudt blomster efter blomster-dip. S. parvula tendens til at afbryde Agrobacterium-dyppet blomster med en højere sats end A. thaliana. Derfor, hvert skridt taget til at minimere afbrudte blomster når dyppet i A. tumefaciens infiltration løsning bidrager til en højere transformation effektivitet. Vi anbefaler en lys periode ikke længere end 14 timer pr. dag. Ofte, udføres transformation af A. thaliana på planter, der dyrkes i en lang-dag tilstand (f.eks. 18 h lys og 6 h mørke) eller endda under kontinuerlig lys. Men vi fandt sådanne praksis resultat i mindre modstandsdygtige S. parvula planter og føre til en lav transformation effektivitet.

Blomsterknopper er kontinuerligt produceres på blomsterstand akser af S. parvula (figur 2, hvide pile). Derfor ville tillader omdannelse af nye blomster væsentligt øge chancen for at få positive transformants. Et andet blomster-dip (trin 5.3) er ikke afgørende, men kraftigt foreslået. Dette trin er imidlertid relativt tidskrævende i forhold til A. thaliana floral dypning, fordi S. parvula producerer flere blomsterstand akser.

Wild-type S. parvula er følsom over for BASTA, selvom den oprindelige skærm til positive transformants med BASTA spray (trin 6.3) vil lade 5 – 8 overlevende planter ud af 100 frø spirede (fig. 3A og 3 b). De fleste af dette (> 80%) vil være falske positiver. Dette skyldes hovedsageligt den smalle bladform og blad vinkel af S. parvula, som ikke giver tilstrækkelig blad overflade i en passende orientering at bevare BASTA løsning for en tilstrækkelig varighed til at observere en fænotype. Desuden, på grund af den høje voks indhold af S. parvula10adaxial blad overflade, det tendens til at skabe en mere uigennemtrængelig overflade til BASTA. Den anden screening for positive transformants ved hjælp af en BASTA drop på enkelte blade (trin 6.4, figur 3C) er derfor et vigtigt skridt til at undgå PCR test på hundredvis af falske positiver (skridt 6,5).

Den nuværende protokol blev testet med A. tumefaciens stamme GV3101 transporterer pMP90RK plasmid. Effektiviteten af transformation kan forbedres med andre stammer, A. tumefaciens , herunder stammer ABI, LMG20 og C58C1 Rifr, med pMP90 virulens plasmid rapporteret at øge transformation effektivitet i A. thaliana 25. kål og Eutrema arter er taxonomically nærmere beslægtet med S. parvula sammenlignet med A. thaliana1. Derfor, A. tumefaciens stamme LBA4404, der var med held bruges til at transformere Brassica napus og stamme EHA105, der har været anvendt med succes til at omdanne Eutrema salsugineum kan tilbyde en højere transformation effektivitet end de rapporterede effektivitet af stammen, der i øjeblikket anvendes26,27,28.

At reducere den tid og arbejdskraft kræver en transformation protokol er en anden væsentlig faktor for en bedre transformation effektivitet. Placere enkelte BASTA dråber på bladene og overvågning blade til en uge på flere planter (trin 6.4) er kedelig. En fremtidig indsats for at øge transformation effektivitet kunne søge efter passende alternative valgbar markør gener29.

Tilgængeligheden af en etableret transformation protokollen vil stærkt fremme vores evne til at identificere gener og nye mekanismer, der tillader extremophyte model planter at overleve flere abiotiske understreger2,4. Roman genetiske variation i S. parvula vil give en større pulje af genetisk variation, der ikke kan være udvundet fra den kollektive allel variation identificeret som stress-responderende gener i den relativt stress-følsomme model, A. thaliana Pan-genom5,6. Derfor vil vores blomster-dip baseret A. tumefaciens medieret transformation protokol udviklet til S. parvula udfylde et hul for behovet for sådanne værktøjer til at udføre funktionelle genomisk eksperimenter i en extremophyte model nært beslægtet med A. thaliana.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Dette arbejde blev støttet af en National Science Foundation award MCB 1616827.

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).
Plant vækst og Agrobacterium-medieret Floral-dip Transformation af Extremophyte <em>Schrenkiella parvula</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).More

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter