Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Planten groei en Agrobacterium-gemedieerde Floral-dip transformatie van de Extremophyte Schrenkiella parvula

doi: 10.3791/58544 Published: January 7, 2019

Summary

Agrobacterium-gemedieerde transformatie met een bloemen-dip-methode kan met succes worden gebruikt om het creëren van stabiele transgene lijnen van het extremophyte model Schrenkiella parvula. We presenteren een protocol aangepast ten opzichte van die voor Arabidopsis thaliana, overwegen verschillende groei gewoonten en fysiologische kenmerken van de extremophyte.

Abstract

Schrenkiella parvula is een extremophyte aangepast aan verschillende abiotische stress, met inbegrip van meervoudige ion toxiciteit druk. Ondanks hoge kwaliteit genomic middelen beschikbaar om te bestuderen hoe de planten zich aanpassen aan milieu benadrukt, zijn waarde als een model van de functionele genomica en gereedschap heeft is beperkt door het ontbreken van een haalbaar transformatie-systeem. In dit protocol rapporteren we hoe te genereren van stabiele transgene S. parvula lijnen met behulp van een methode met Agrobacterium-gemedieerde floral-dip. We bewerkt de transformatie-protocol dat wordt gebruikt voor A. thaliana ter verantwoording voor de unieke eigenschappen van S. parvula, zoals de gewoonte van een onbepaalde bloei en een gehalte aan hoge epicuticular was op Bladeren. S. parvula zaden waren kort, gelaagde bij 4 ° C voor vijf dagen voor het planten. Planten zijn geteeld op een fotoperiode van een 14 h licht en 10 uur donker en een 130 µmol m-2s-1 lichtintensiteit, bij 22 ° C tot 24 ° C. Acht tot negen weken oude planten met meerdere bloeiwijzen werden geselecteerd voor transformatie. Deze bloeiwijzen werden ondergedompeld in een oplossing van de infiltratie van Agrobacterium tumefaciens GV3101 uitvoering van de pMP90RK -plasmide. Wij uitgevoerd twee rondes van de bloem dompelen met een interval van drie tot vier weken de transformatie-efficiëntie te verhogen. De T1 zaden werden verzameld en gedroogd voor vier weken in een container met droogmiddelen alvorens kiemkracht aan het scherm voor kandidaat getransformeerd lijnen. Weerstand tegen BASTA werd gebruikt om het scherm T1 planten. Wij de oplossing BASTA gespoten driemaal met een tussenpauze van drie dagen vanaf twee weken oude planten om valse positieven. Een valproef BASTA werd uitgevoerd op het overleven van de individuele planten te identificeren waar positieve transformants. De efficiëntie van de transformatie was 0.033%, opbrengst 3 – 4 transgene planten per 10.000 T1 zaden gekweekt.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In dit protocol beschrijven we de groei en de totstandbrenging van stabiele transgene lijnen voor het extremophyte model Schrenkiella parvula. De beschikbaarheid van een efficiënte transformatie-systeem is een kenmerk van een veelzijdige genetische model. Planten die bloeien in extreme omgevingen, waarnaar wordt verwezen als extremophytes, bieden een essentiële hulpbron voor het begrijpen van de plant aanpassingen aan milieu benadrukt. Schrenkiella parvula (voorheen Thellungiella parvula en Eutrema parvulum) is een model van dergelijke extremophyte, met het uitbreiden van genomic middelen1,2,3,4,5. Echter, transformatie protocollen hebben nog niet is gerapporteerd voor S. parvula in gepubliceerde studies.

Het genoom van S. parvula is de eerste gepubliceerde extremophyte genoom in kruisbloemenfamilie (mosterd-kool familie) en toont een uitgebreide totale genoom synteny met het niet-extremophyte model, Arabidopsis thaliana1. Dus, vergelijkende studies tussen A. thaliana en S. parvula kon profiteren van de rijkdom aan genetische studies uitgevoerd op A. thaliana om informatieve hypothesen over hoe het genoom S. parvula heeft zich ontwikkeld en geregeld anders om te gaan met benadrukt extreme milieu5,6,7. S. parvula is een van de meest zout-tolerante soorten (gebaseerd op bodem NaCl LD50) onder bekende wilde verwanten A. thaliana8. Naast de NaCl-tolerantie, S. parvula overleeft en voltooit de levenscyclus in de aanwezigheid van meerdere zout ionen bij hoge concentraties giftig voor de meeste planten7. In reactie op de abiotische stress overwegend in zijn natuurlijke habitat, het heeft zich ontwikkeld van verschillende eigenschappen, waaronder zijn verschillende bestudeerd op de biochemische of fysiologisch niveau 8,,9,10, 11.

Sinds 2010 zijn er meer dan 400 publicaties van peer-reveiwed die S. parvula gebruikt als doelsoort of gebruikt in een vergelijking met andere plant genomen. Echter kan een duidelijk knelpunt worden geïdentificeerd met een kijkje van wat voor soort studies zijn uitgevoerd. De meerderheid van deze verslagen bespreken het potentiële gebruik van S. parvula in toekomstige studies of het gebruik in vergelijkende genomic of phylogenomic studies. Als gevolg van het ontbreken van een proof-of-concept transformatie protocol vastgesteld voor S. parvula, het is niet gebruikt in functionele genomische studie, ondanks het feit dat een van de hoogste kwaliteit plant genomen beschikbaar tot op heden (> 5 Mb aanliggend N50) gemonteerd en geannoteerde in pseudomolecules van chromosoom-niveau1.

De Agrobacterium-gemedieerde floral-dip transformatie methode is de meest algemeen gebruikte methode lijnen te maken trasngenic in A. thalianageworden, en de ontwikkeling van een reproduceerbare systeem van transformatie was een kritieke factor in het succes als een genetische model12,13. Niet alle soorten van de Brassicaceae hebben echter aangetoond dat het met succes worden omgezet met behulp van de methode van de bloemen-dip ontwikkeld voor A. thaliana. Speciaal, de Brassicaceae Lineage II-soorten die S. parvula omvatten geweest recalcitrante floral-dip op basis transformatie methoden14,15.

De onbepaalde bloeiende groei gewoonte van S. parvula, gecombineerd met haar smalle blad morfologie heeft gemaakt het uitdagend om de standaard Agrobacterium-gemedieerde floral-dip transformatie methode te hanteren. In deze studie rapporteren we het gewijzigde protocol die wij hebben ontwikkeld voor reproduceerbare transformatie van S. parvula.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. de plantengroei

  1. Zaad sterilisatie (optioneel)
    1. Bereiden van 50% bleekwater in tweemaal gedestilleerd water (ddH2van O) met 1 of 2 druppels van een niet-ionogene detergens (Zie Tabel van materialen) in een tube van 50 mL. Omkeren van de buis meerdere malen te mengen van de oplossing.
      Opmerking: Het verdient de voorkeur om te voeren zaad sterilisatie in een laminaire flow-kast met een UV gesteriliseerde oppervlak voor 15 min.
    2. De bleekwater oplossing toevoegen aan ~ 100 – 200 S. parvula zaden in een 1,5 mL-buis. Meng en laat de buis zitten voor 5 minuten.
    3. Verwijder het bleekmiddel uit de buis en voeg 70% ethanol. De zaden door pipetteren meerdere malen wassen en verwijder de ethanol-oplossing onmiddellijk.
    4. Wassen van de zaden in gesteriliseerd water om teveel bleekmiddel en ethanol te verwijderen en deze vervolgens verwijdert van het water. Herhaal deze stap 5 tot 6 keer.
  2. Zaad stratificatie
    1. De zaden in gesteriliseerd water dompelen, en op te slaan voor 5 tot 7 dagen bij 4 ° C. Als alternatief, gedroogde unsterilized zaaien rechtstreeks op natte bodem, en plaats de lade van de bodem voor 5 tot 7 dagen bij 4 ° C.
  3. Groeiende planten in voorbereiding van transformatie
    1. Vul de bodem mix (Zie Tabel van materialen) in 7 x 6 cm2 potten, geniet van de potten in water, en spuiten van water vanaf de bovenkant om een uniform natte groeimedium. Voeg toe 5-meststof kralen (Zie Tabel van materialen) op het bodemoppervlak van elke pot.
      Opmerking: Voor zover we hebben meegemaakt, groeit S. parvula goed op elke bodem mix waar A. thaliana kan groeien.
    2. Met behulp van een natte tandenstoker, transfer 20 ~ 25 zaden per pot op het bodemoppervlak.
      Opmerking: Een handige praktijk is om een partij van 4 – 5 zaden in de vier hoeken en het midden van de pot (Figuur 1, dag 15, linkerpaneel).
    3. Dekking van het Dienblad van de pot met een duidelijke koepel om te houden van de zaden onder hoge luchtvochtigheid tijdens kieming.
    4. Houd de plant schaaltjes in een zaal van de groei met een lage intensiteit vastgesteld op 130 µmol m−2 s−1 licht, temperatuur van 22-24 ° C en 14 h per dag/10 h per nacht cyclus. Verwijder de koepels na 7-10 dagen na ontkieming. Voeg water uit de bodem van de lade te houden bodem bevochtigd gelijkmatig op een gewenst niveau.
    5. Onkruid uit extra zaailingen en laat enige 4 – 5 gezonde zaailingen per pot goed gescheiden van elkaar (Figuur 1, dag 15, rechter paneel).
    6. Zachtjes de planten om de twee dagen water en bemesten met 0,2 x Hoagland de oplossing16 eenmaal per twee weken.
      Opmerking: Houden van het bodemvocht op een uniform niveau is de sleutel tot een toenemende S. parvula consequent en gezond.
    7. Blijven groeien de planten voor 8-10 weken tot meerdere bloeiwijzen 100 – 150 floral toppen per plant (Figuur 1, dag 60-80 produceren). Op de dag gepland voor de bloemen-dip op basis transformatie (stap 4.5), alle volwassen als opkomende siliques uit de planten te verwijderen.

2. het klonen van het gen/Genomic Element van belang in een Vector voor Plant transformatie

  1. Versterken van het fragment van DNA van doel met behulp van polymerase kettingreactie (PCR)17 en isoleren het PCR-product met behulp van een gel-extractie kit (Zie Tabel van materialen) volgens het protocol van kit of een andere geschikte methode voor het zuiveren van DNA met behulp van agarose gel elektroforese17,18. Controleer of de volgorde van de geïsoleerde PCR-product door Sanger sequencing19.
  2. Kloon het gewenste PCR product in het klonen vector en transformeren de gekloonde constructie in de bevoegde E. coli cellen met behulp van een topoisomerase gebaseerde klonen kit (Zie Tabel van materialen) volgens de richtlijnen van de fabrikant.
  3. Verspreiden van 50 µL van getransformeerde producten op Luria Bertani20 (LB) agar bacteriegroei media (tabel 1) met de juiste antibiotica, bijvoorbeeld., 50 µg / mL spectinomycine (Zie Tabel of Materials), en Incubeer bij 37 ° C's nachts.
  4. De volgende dag, selecteer 5 – 10 enkele kolonies beënten tot vloeibare LB medium met de juiste antibiotica en incubeer met zacht schudden bij 37 ° C's nachts.
  5. Isoleren plasmiden met behulp van een plasmide isolatie kit (Zie Tabel van materialen) en verifiëren via Sanger sequencing19 of de volgorde van de target versterkt in 2.1 goed wordt gekloond.
  6. Overdracht van de gekloonde en geverifieerde PCR product naar een bestemming vector voor plant transformatie compatibel met recombinatie gebaseerde klonen (Zie Tabel van materialen), met behulp van een recombinase enzym mix kit (Zie Tabel of Materials), volgende instructie van de fabrikant van de kit. Herhaal vanaf stap 2.3 naar stap 2.5 te isoleren en te verifiëren klonen herbergen juiste plasmide constructies.

3. omzetten van de bouw van de Vector voor Plant transformatie in Agrobacterium tumefaciens

  1. Het plasmide van de constructie van de vector van 2.6 in de A. tumefaciens stam GV3101:pMP90RK21, die havens een rifampicine-resistentie gen voor chromosomale achtergrond selectie omzetten. Gebruik van de juiste antibiotica, vb. gentamycine of kanamycine (Zie Tabel of Materials), voor de selectie van plant transformatie construeren (Ti-plasmide). Een kort protocol voor A. tumefaciens transformatie via electroporation is opgenomen in punt 3.2.
  2. A. tumefaciens transformatie door electroporation
    1. Ontdooi de A. tumefaciens bevoegde cellen22 op ijs. Mix 0.1 – 1 µg van de plasmide bereid uit 2.6, opgelost in 1 – 2 µL van ddH2O, met bevoegde cellen op ijs. Breng het mengsel in een cuvet electroporation (Zie Tabel van materialen).
    2. Electroporation uitvoeren op het mengsel van plasmiden en bevoegde cellen uit 3.2.1, met behulp van een electroporator (Zie Tabel van materialen) volgens de richtlijnen van de fabrikant.
      Opmerking: Reinig het oppervlak van de Cuvet voordat de electroporation.
    3. Het reactiemengsel van de Cuvet overbrengen naar een microcentrifuge buis, die 1,5 mL vloeibare LB bevat en meng goed met pipetteren en incubeer gedurende 1 uur bij 28 ° C met zacht schudden.
  3. Beënt de getransformeerde A. tumefaciens van punt 3.2 op LB platen met de juiste selectie antibiotica (b.v. kanamycine 25 µg / mL, spectinomycine 50 µg / mL, gentamycine 25 µg / mL, en rifampicine 50 µg / mL) en Incubeer bij 28 ° C gedurende 3 dagen.

4. Agrobacterium-gemedieerde transformatie van S. parvula

  1. De single getransformeerd beënten kolonies van platen in 10 mL vloeibare media LB met antibiotica (gelijk aan 3.3) in een steriel 50 mL conische buis (Zie Tabel van materialen). Incubeer gedurende 24 uur in een schudden incubator (Zie Tabel van materialen) op 250 toeren bij 28 ° C.
  2. De bacteriële oplossing van 3.4.1 overbrengen in een steriele 250 mL-kolf, voeg 40 mL LB vloeibare media met passende antibiotica en incubeer van 12 h tot de optische dichtheid bij 600 nm golflengte (OD600) ongeveer 2.0 bereikt.
  3. Centrifugeer de A. tumefaciens cultureat 3100 x g voor 10 min. Verwijder het supernatant en resuspendeer de bacteriecultuur in 40 mL A. tumefaciens infiltratie oplossing (tabel 1).
  4. Verdun de geresuspendeerde A. tumefaciens met infiltratie oplossing tot een definitieve OD600 van 0,8. 25 µL van oppervlakteactieve stof oplossing (tabel 1) toevoegen aan 50 mL verdunde A. tumefaciens oplossing en meng door het omkeren van meerdere malen.
  5. Dompel de bloeiwijze van de planten in de A. tumefaciens oplossing bereid in de sectie 4.4 voor 20 s. gebruik een verse bacteriële oplossing na het dompelen bloeiwijze van zes potten. Zorg ervoor dat alle bloemen zijn in contact met de oplossing. Pipetteer bacteriële oplossingen direct op bloemen, gelegen in het onderste deel van de bloeiwijze als zij kunnen niet worden ondergedompeld in de oplossing.
    Opmerking: Voor de eerste ronde transformatie, zorg ervoor dat alle volwassen als opkomende siliques met een scherpe scalpel of kleine schaar verwijderen. Verwijder siliques niet als transformatie voor de tweede keer uitvoert.

5. na transformatie Plant zorg en de tweede transformatie

  1. Plaats de planten bloemen gecoat horizontaal in schone bakken met koepels dekking van de planten te plaatsen in een donkere groei kamer voor 1-2 dagen.
    Opmerking: De bloemen onder hoge-vochtigheid te houden is belangrijk in dit stadium (Figuur 1, planten na transformatie).
  2. De planten terug naar rechtop en de planten overbrengen in een kamer van de groei met een 14 h per dag/10 h per nacht cyclus, 130 µmol m-2 s lichtintensiteit-1 en 22 tot en met 24 ° C temperatuur.
  3. Controleren de gedimde bloeiwijzen in de volgende week. Als een groot aantal bloemen afbreken (Figuur 2), herhaalt u de floral dip (stap 4) na ongeveer 4 weken, of na een groot aantal bloemen hebben onlangs ontwikkeld.
    Opmerking: In tegenstelling tot de bereiding stap voor de eerste transformatie (stap 1.3.7), verwijder geen bestaande of de ontwikkeling van siliques (Figuur 2) voor de tweede ronde van transformatie.
  4. De planten groeien totdat de zaden rijpen en oogsten van zaden op ~ 21 weken.
  5. Droge zaden voor 2 – 3 weken bij kamertemperatuur in een luchtdichte verpakking met gevuld met droogmiddelen (Zie Tabel van materialen).

6. de selectie van positieve Transformants

  1. Plant de zaden van de T1 als beschreven voor het wild type zaden in stappen 1.2 tot en met 1.3.
  2. Groeien de planten tot de eerste 2 echte bladeren, ongeveer 10-14 dagen na de kieming ontwikkelt.
  3. De eerste selectie voor herbicide resistentie (Figuur 3A en 3B) als gedetailleerde hieronder uitvoeren.
    1. Verdun het herbicide glufosinaatammonium (11,3%) (of BASTA) (tabel 1) naar 1:1,000 (v/v). Oplossing van verdunde BASTA spray op de zaailingen en 's nachts de planten met koepels bedekken.
    2. BASTA spuiten van 2 tot 3 keer herhalen elke 5-7 dagen.
  4. Het uitvoeren van de tweede selectie met behulp van een BASTA-valproef zoals hieronder beschreven.
    1. Identificeren van planten die overleven na 3-4 keer met BASTA oplossing wordt gespoten. Groeien de planten voor een ander 2-3 weken tot 3-5 bladeren ontwikkelen een relatief groot oppervlak.
    2. Selecteer het grootste volwassen blad per plant, wrijf het oppervlak van het blad voorzichtig met een vinger te verwijderen van de wax laag en breng een druppel van de verdunde oplossing BASTA (uit stap 6.3.1).
      Opmerking: De locatie van het blad met de daling van de BASTA toegepast door het plaatsen van een papieren rompslomp op de dichtstbijzijnde stengel markeren.
    3. Toezicht op de bladeren toegepast met de daling van de BASTA voor tekenen van verwelking voor maximaal een week. Selecteer de planten met blaadjes niet beïnvloed door de druppels BASTA.
      Opmerking: Bladeren van meest vals-positieve planten beginnen te verwelken binnen twee dagen, terwijl de bladeren uit true-positieven zijn intact, zelfs nadat de daling van BASTA oplossing (Figuur 3C opdroogt).
  5. Positieve transformants met behulp van genomic PCR te bevestigen.
    1. 2 tot 3 bladeren van de overlevende planten bij stap 6.4.5 verzamelen.
    2. Het uittreksel van genomic DNA van de bladeren met behulp van de methode CTAB23 of elke andere passende DNA-extractiemethode.
    3. Uitvoeren van PCR met behulp van uitgepakte genomic DNA-monsters uit planten, wild-type planten (als negatieve controles), en de constructie van de plasmide uit de stap 3.1 (zoals een positieve controle). Gebruik een passende combinatie van PCR primers specifiek voor de selectieve marker-gen, bijvoorbeeld, voor BASTA-resistente gen (bar), TCAGCAGGTGGGTGTAGA (in voorwaartse richting) en GTCAACCACTACATCGAGACAA (omgekeerde).
      1. Voor de voorbeeld PCR inleidingen gericht op de bar -gen, het gebruik van de volgende PCR voorwaarden: de eerste denaturatie stap bij 98 ° C gedurende 30 s; gevolgd door 30 cycli van de denaturering bij 98 ° C gedurende 30 s, gloeien bij 59 ° C gedurende 30 s, en uit te breiden bij 72 ° C gedurende 30 s; en de laatste uitbreiding bij 72 ° C gedurende 5 minuten.
        Opmerking: Om ervoor te zorgen de invoeging van het gehele T-DNA, is het raadzaam ook het uitvoeren van genomic PCR met behulp van een PCR Inleiding van de selectieve marker-gen en andere PCR primer specifiek voor de opeenvolging van doel gekloond naar de vector transformatie plant bij de stap
    4. De aanwezigheid van de verwachte omvang van het PCR-product van versterkte bar bevestigen door agarose gel elektroforese17 voor de doelgroep monsters (Figuur 4A) alsook door de rangschikking van de geïsoleerde PCR product19 met behulp de zelfde procedure als in stap 2.1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ontwikkelden we een transformatie-protocol waarmee oogsten van T0 zaden binnen 150 dagen, met behulp van een methode van de bloemen-dip aangepast ten opzichte van die voor A. thaliana. Figuur 1 toont een overzicht van de tijdlijn en S. parvula planten die de optimale fase vertegenwoordigen voor het uitvoeren van de transformatie via floral-dip. Wij hebben gekozen S. parvula planten met 70 –80 bloemen in meerdere bloeiwijzen 60-80 dagen na kieming als het doel-podium voor transformatie. Een klein aantal van de reeds bestaande open of bevruchte bloemen en siliques in dit stadium waren verwijderd kan worden voordat de infiltratie van A. tumefaciens door de methode floral-dip. Infectie met A. tumefaciens resulteerde in abortus van sommige bloemen (Figuur 2, beugel, (a)). Siliques volledig ontwikkeld nadat de bloemen-dip dreigen te bevatten getransformeerde zaden (Figuur 2, beugel (b)). Zelfs na transformatie, S. parvula bleef ontwikkelen nieuwe bloeiwijzen en bloemen, zolang de planten gezond (Figuur 2, witte pijlen) werden bewaard. Als gevolg van deze onbepaalde bloei gewoonte, kan een tweede ronde van de transformatie worden uitgevoerd als de plant niet tekenen van stress of senescentie wordt weergegeven. Figuur 2 A en 2B tonen voorbeelden van S. parvula planten na de eerste en tweede ronde van transformatie, respectievelijk, 25 dagen naast elkaar. In de tweede transformatie, moeten bestaande siliques niet worden verwijderd omdat zij genetisch gemodificeerde zaden bevatten. Ook kunnen de A. tumefaciens worden toegepast door pipetteren de infiltratie oplossing (tabel 1) op de nieuwe opkomende bloemtrossen, in plaats van de volledige shoot dompelen in de oplossing, voor het minimaliseren van de schade aan de siliques van de eerste transformatie.

De efficiëntie van de transformatie is 0.033%, opbrengst 3 – 4 transgene planten per 10.000 T1 zaden gekweekt met behulp van het huidige protocol. Deze schatting is gebaseerd op ~ 50.000 T1 zaden tijdens tien onafhankelijke transformatie pogingen getest. Terwijl het rendement lager dan die van de Arabidopsis thaliana is, is het vergelijkbaar met de transformatie van een ander extremophyte plant Eutrema salsugenium24 en sommige van de Arabidopsis thaliana geneeskrachtig25. De efficiëntie van de transformatie kan verder worden geoptimaliseerd met behulp van alternatieve Agrobacterium stammen en wijzigingen van de oppervlakteactieve stof en infiltratie oplossingen. De meerdere BASTA spray en drop tests (stap 6.3 en 6.4) zal van doorslaggevend belang te identificeren waar positieve transformants en hetaantal monsters getest met behulp van de PCR-bevestiging in stap 6.5 (Figuur 4A) te verminderen. Nog een bevestiging van de transformatie kan worden gecontroleerd met een verslaggever genexpressie, als de gekloonde reeks een verslaggever gen (Figuur 4B bevat).

Figure 1
Figuur 1 : Tijdlijn van S. parvula transformatie. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: S. parvula planten na transformatie door bloemen-DIP Planten werden gefotografeerd 10 dagen na de eerste bloemen-dip op dag 60 (A) en 25 dagen na de tweede ronde van bloemen-dip op dag 85 (B). Infiltratie met Agrobacterium kan breken Hauw ontwikkeling van bloemen zoals in haakjes een. Siliques volledig ontwikkeld nadat floral-dip dreigen te bevatten getransformeerde zaden (haakjes b). Witte pijlen geven aan bloemen en bloeiwijzen onlangs ontstond na elke transformatie. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 : Selectie van S. parvula transformants gebaseerd op BASTA weerstand. (A) T1 zaailingen voordat de spray BASTA. (B) rode cirkel geeft aan een kandidaat-transformant het overleven van de eerste-ronde selectie door de spray BASTA. (C) de tweede-ronde-selectie door BASTA valproef. Een voorbeeld van valse positieven (bovenzijde) en ware transgene planten (lagere paneel) worden weergegeven. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4 : Bevestiging van S. parvula transformatie. (A) PCR versterking van bar gen van genomic DNAs S. parvula planten is onttrokken. Lane 1 en 13: de grootte van de merkers; Lane 2: negatieve controle; Lane 3-5: wild-type S. parvula ; Lane 6-10: transgene S. parvula kandidaten; Lane 11, 12: vectorbestrijding. Rijstroken 7, 8 en 9 illustreren positieve transformants. (B) voorbeeld van GUS verslaggever genexpressie in een positieve S. parvula transformant. Klik hier voor een grotere versie van dit cijfer.

Media / oplossing Reagens Bedrag
Luria Bertani (LB) bacteriële groei media NaCl
Trypton
Gistextract
Agar (voor platen)
ddH2O
10 g
10 g
5 g
20 g
955 mL
Agrobacterium infiltratie oplossing MS zout (1/4 x)
Vitaminen B5 (1 x)
Sacharose (5%w/v)
MES
N6- benzylaminopurine (BA)
Silwet L-77 (0.05%v/v)
pH
2.16 g
1 mL
50 g
0.5 g
10 ΜL
500 ΜL
5.7

Tabel 1: samenstelling van het medium van de bacteriële groei en Agrobacterium infiltratie oplossing.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De fysiologische toestand van de plant aanzienlijk invloed op de efficiëntie van transformatie25. Het gebruik van gezonde en krachtige planten voor transformatie is een basisvereiste voor een succesvolle hervorming van S. parvula. Water of lichte gestresst planten zullen hebben minder bloemen in vergelijking met de gezonde planten ideaal voor transformatie (Figuur 1, midden paneel). S. parvula kunnen groeien met een lage intensiteit minder dan 130 µmol m-2 s-1, maar de planten zijn meestal frailer; dergelijke planten zou leiden tot meer bloemen bloemen-dip na afgebroken. S. parvula heeft de neiging om af te breken Agrobacterium gecoat bloemen met een hogere snelheid dan A. thaliana. Dus, elke stap genomen om te minimaliseren van afgebroken bloemen wanneer ondergedompeld in de A. tumefaciens infiltratie oplossing draagt bij tot een hogere efficiëntie van de transformatie. Het is raadzaam een lichte periode niet langer dan 14 uur per dag. Transformatie van A. thaliana wordt vaak uitgevoerd op planten gekweekt in een lange-dag-voorwaarde (bijvoorbeeld 18 uur licht en 6 uur donker) of zelfs onder continu licht. Echter wij dergelijke praktijken resultaat gevonden in minder veerkrachtig S. parvula planten en leiden tot een lage transformatie-efficiëntie.

Bloemknoppen worden continu op de assen van de bloeiwijze van S. parvula (Figuur 2, witte pijlen) geproduceerd. Daarom, waardoor transformatie van nieuwe bloemen zou aanzienlijk vergroten de kans op het krijgen van positieve transformants. Een tweede floral-dip (stap 5.3) is niet essentieel, maar sterk aanbevolen. Deze stap is echter relatief tijdrovend in vergelijking met A. thaliana floral dompelen, omdat S. parvula meerdere bloeiwijze assen produceert.

Wild-type S. parvula is gevoelig voor BASTA, hoewel het eerste scherm voor positieve transformants met BASTA spray (stap 6.3) 5 – 8 overlevende planten uit 100 zaden gekiemd (Figuur 3A en 3B blijft). De meeste hiervan (> 80%) zullen valse positieven. Dit is grotendeels te wijten aan de smalle bladvorm en de hoek van het blad van S. parvula, die niet voldoende blad oppervlak in een passende oriëntatie bieden te behouden de BASTA-oplossing voor een voldoende duur te observeren een fenotype. Bovendien, als gevolg van het gehalte aan hoge was van het adaxial blad oppervlak van S. parvula10neigt het naar het maken van een meer ongevoelig oppervlak voor BASTA. De tweede screening voor positieve transformants met behulp van een daling van de BASTA op individuele bladeren (stap 6.4, Figuur 3C) is daarom een essentiële stap om te voorkomen dat PCR testen op honderden valse positieven (stap 6.5).

Het huidige protocol werd getest met de A. tumefaciens stam GV3101 uitvoering van de pMP90RK -plasmide. De efficiëntie van de transformatie kan worden verbeterd met andere A. tumefaciens stammen, met inbegrip van stammen ABI, LMG20 en C58C1 Rifr, met de pMP90 virulentie plasmide gemeld aan het verhogen van de efficiëntie van de transformatie in A. thaliana 25. Brassica en Eutrema soorten zijn taxonomisch meer verwant aan S. parvula t.o.v. A. thaliana1. Dus, de A. tumefaciens stam LBA4404 dat met succes werd gebruikt om te transformeren van Brassica napus en de stam EHA105 dat met succes heeft gebruikt om te transformeren van Eutrema salsugineum een hogere transformatie bieden kan efficiëntie dan de gerapporteerde efficiëntie van de stam gebruikt momenteel26,27,28.

Vermindering van de tijd en arbeid vereist door een transformatie-protocol is een andere belangrijke factor in de verbetering van de efficiëntie van de transformatie. Plaatsen van individuele BASTA druppels op Bladeren en monitoring van het blad voor een week op meerdere planten (stap 6.4) zijn saai. Een toekomstige inspanning te verhogen van de efficiëntie van de transformatie kan zoeken naar geschikte alternatieve selecteerbare marker genen29.

De beschikbaarheid van een gevestigde transformatie protocol zal sterk vooraf aan ons vermogen om genen en nieuwe mechanismen waarmee extremophyte model planten om te overleven van meerdere abiotische stress2,4te identificeren. Nieuwe genetische variatie in S. parvula zorgt voor een bredere pool van genetische variatie dat niet kan worden gewonnen uit de collectieve allèlique variatie geïdentificeerd als stress-responsieve genen in het relatief stress-gevoelige model, A. thaliana pan-genoom5,6. Daarom zal onze bloemen-dip op basis A. tumefaciens transformatie protocol ontwikkeld voor S. parvula gemedieerde vullen een gat voor de noodzaak van dergelijke hulpmiddelen voor het uitvoeren van functioneel genomisch experimenten in een model van de extremophyte nauw verwant aan A. thaliana.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Dit werk werd gesteund door een award van de National Science Foundation MCB 1616827.

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).
Planten groei en Agrobacterium-gemedieerde Floral-dip transformatie van de Extremophyte <em>Schrenkiella parvula</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).More

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter