Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Croissance des plantes et la Transformation par Agrobacterium Floral creux de la Extremophyte Schrenkiella parvula

doi: 10.3791/58544 Published: January 7, 2019

Summary

La transformation par Agrobacterium en utilisant une méthode floral creux peut être employée avec succès pour créer des lignées transgéniques stables du modèle extremophyte Schrenkiella parvula. Nous présentons un protocole modifié de celui d' Arabidopsis thaliana, compte tenu des habitudes de croissance différent et les caractéristiques physiologiques de l’extremophyte.

Abstract

Schrenkiella parvula est une extremophyte adaptée aux différents stress abiotiques, y compris les multiples contraintes de la toxicité d’ion. Malgré la qualité des ressources génomiques disponibles pour étudier comment les plantes s’adaptent à l’environnement souligne, sa valeur comme un modèle de génomique fonctionnelle et outil ont été limité par l’absence d’un système de transformation possible. Dans ce protocole, nous rapportons comment générer transgéniques stable S. parvula lignes en utilisant une méthode d’immersion à floral par Agrobacterium. Nous avons modifié le protocole de transformation utilisé pour a. thaliana pour tenir compte des caractéristiques uniques du S. parvula, comme une habitude de floraison pour une période indéterminée et une teneur en cires épicuticulaire élevé sur les feuilles. En bref, S. parvula graines ont été stratifiées à 4 ° C pendant cinq jours avant la plantation. Les plantes ont été cultivées à une photopériode d’une lumière de 14 h et 10 h d’obscurité et une 130 µmol m-2s-1 intensité lumineuse, à 22 ° C à 24 ° C. Huit à neuf semaines plantes avec plusieurs inflorescences ont été sélectionnés pour la transformation. Ces inflorescences sont trempés dans une solution d’infiltration d’Agrobacterium tumefaciens GV3101 portant le plasmide pMP90RK . Nous avons effectué deux séries de fleur plongeant avec un intervalle de trois à quatre semaines pour augmenter l’efficacité de la transformation. Les graines de T1 ont été recueillies et séchées pendant quatre semaines dans un récipient avec gel de silice avant la germination pour dépister le candidat transformé lignes. Résistance aux BASTA a été utilisée pour dépister les plantes T1. Nous avons pulvérisé la solution BASTA trois fois avec un intervalle de trois jours à partir de deux semaines centrales pour réduire les faux positifs. Une épreuve de chute BASTA a été réalisée sur la survie des plantes individuelles afin d’identifier les vrais positifs transformants. L’efficacité de la transformation a été 0,033 %, ce qui donne des plantes transgéniques de 3 – 4 10 000 graines T1 propagées.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dans ce protocole, nous décrivons la croissance et la création de lignées transgéniques stables pour le modèle extremophyte Schrenkiella parvula. La disponibilité d’un système efficace de transformation est une caractéristique de n’importe quel modèle génétique polyvalent. Plantes qui se développent dans des environnements extrêmes, mentionné comme extremophytes, fournissent une ressource cruciale pour comprendre les adaptations des plantes aux stress environnementaux. Schrenkiella parvula (anciennement Thellungiella parvula et Eutrema parvula) est un tel modèle extremophyte, avec l’expansion des ressources génomiques1,2,3,4,5. Toutefois, des protocoles de transformation n'ont pas encore été signalées pour S. parvula études publiées.

Le génome de S. parvula est le premier génome d’extremophyte publiés dans Brassicaceae (famille de la moutarde-chou) et montre une vaste synténie du génome globale avec le modèle non-extremophyte, Arabidopsis thaliana1. Ainsi, des études comparatives entre a. thaliana et S. parvula pourraient bénéficier de la richesse des études génétiques effectuées sur a. thaliana , faire des hypothèses informatives sur comment le génome de s. parvula a évolué et réglementé différemment pour faire face aux extrêmes environnementaux souligne5,6,7. S. parvula est une des espèces plus tolérantes au sel (basés sur sol NaCl LD50) parmi les parents sauvages connues d’a. thaliana8. En plus de la tolérance de NaCl, S. parvula survit et termine son cycle de vie en présence de plusieurs ions salins à de fortes concentrations de toxiques pour la plupart de plantes7. En réponse aux stress abiotiques dans son habitat naturel, il a évolué des traits différents, parmi lesquels plusieurs ont été étudiés à la biochimiques ou physiologiques niveau 8,9,10, 11.

Depuis 2010, ont été plus de 400 publications peer-reveiwed utilisé S. parvula comme espèce cible ou utilisèrent dans une comparaison avec d’autres génomes de plantes. Toutefois, un goulot d’étranglement clair pourrait être identifié avec un examen approfondi de ce type d’études ont été menées. La majorité de ces rapports discute l’utilisation potentielle de S. parvula dans de futures études ou l’utilise dans la génomique comparative ou études de phylogenomic. En raison de l’absence d’un protocole de validation de la transformation établie pour S. parvula, il n’a pas été utilisé dans les études de génomique fonctionnelles, malgré avoir un des plus hautes génomes de plantes de qualité disponibles à ce jour (> 5 Mo contig N50) assemblés et annoté en pseudomolécules au niveau du chromosome1.

La méthode de la transformation par Agrobacterium floral creux est devenue la méthode la plus largement utilisée pour créer des lignes de trasngenic dans Arabidopsis, et l’élaboration d’un système reproductible de transformation a été un facteur essentiel à son succès comme un modèle génétique12,13. Cependant, pas toutes les espèces de Brassicaceae ont démontré être transformée avec succès en utilisant la méthode floral creux mis au point pour a. thaliana. Spécialement, les espèces de Brassicaceae Lineage II qui incluent S. parvula a été récalcitrant à floral creux transformation fonction méthodes14,15.

L’habitude de croissance floraison pour une période indéterminée de S. parvula, combinée à sa morphologie de feuille étroite rend difficile d’adopter la méthode de transformation de floral creux standard par Agrobacterium. Dans cette étude, nous présentons le protocole modifié, que nous avons développé pour transformation reproductible de S. parvula.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. la croissance des plantes

  1. Stérilisation des semences (facultative)
    1. Préparer 50 % eau de Javel dans l’eau bidistillée (ddH2O) avec 1 ou 2 gouttes d’un détergent non ionique (voir Table des matières) dans un tube de 50 mL. Inverser le tube plusieurs fois pour mélanger la solution.
      Remarque : Il est préférable de procéder à la stérilisation des semences dans un flux laminaire avec une surface stérilisée UV pendant 15 min.
    2. Ajouter la solution d’eau de Javel à ~ 100-200 S. parvula graines dans un tube de 1,5 mL. Bien mélanger et laisser le tube pendant 5 min.
    3. Retirer le tube de l’eau de Javel et ajouter de l’éthanol à 70 %. Laver les graines en pipettant également plusieurs fois et retirez immédiatement la solution d’éthanol.
    4. Lavez les graines dans de l’eau stérilisée pour éliminer l’éthanol et eau de Javel excès, puis enlever l’eau. Répétez cette étape 5 à 6 fois.
  2. Stratification des graines
    1. Plonger les graines dans de l’eau stérilisée et stocker pendant 5 à 7 jours à 4 ° C. Vous pouvez aussi semer des graines séchées non stérilisées directement sur le sol humide et placez le plateau de sol de 5 à 7 jours à 4 ° C.
  3. La culture de plantes en vue de la transformation
    1. Remplir le sol mélanger (voir Table des matières) dans des pots de 7 x 6 cm2 , tremper les pots dans l’eau et pulvériser de l’eau par le haut pour assurer un milieu de croissance uniformément humide. Ajouter 5 – engrais perles (voir Table des matières) sur la surface du sol de chaque pot.
      Remarque : Comme nous l’avons connu, S. parvula pousse bien sur n’importe quel mélange de terre où a. thaliana peut grandir.
    2. À l’aide d’un cure-dent humide, transférer 20 ~ 25 graines par pot sur la surface du sol.
      Remarque : Une commode est recommandé de placer un lot de 4 à 5 graines dans les quatre coins et au centre de la casserole (panneau de gauche dela Figure 1du jour 15,).
    3. Recouvrir le plateau de pot avec un dôme transparent pour garder les graines sous une humidité élevée pendant la germination.
    4. Garder les plateaux de la plante dans une chambre de croissance avec une intensité lumineuse fixé à 130 µmol m−2 s−1 lumière, température de 22 à 24 ° C et 14 h par jour/10 h par cycle de nuit. Enlevez les dômes après 7-10 jours après la germination. Ajouter de l’eau depuis le fond de la caissette pour garder le sol imbibé de façon uniforme à un niveau souhaitable.
    5. Éliminer les plantules supplémentaires et laisser seulement 4 – 5 plants sains par pot bien séparé de l’autre (Figure 1, jour 15, panneau de droite).
    6. Délicatement, arroser les plantes tous les deux jours et fertiliser avec 0,2 x solution16 de Hoagland une fois toutes les deux semaines.
      Remarque : Garder l’humidité du sol à un niveau uniforme est essentiel à la croissance de S. parvula régulièrement et sainement.
    7. Continuer à cultiver les plantes pour 8 à 10 semaines, jusqu'à ce que plusieurs inflorescences produisent des bourgeons floraux 100 – 150 par plante (Figure 1, jour 60 – 80). Le jour prévu pour la transformation de la base floral creux (étape 4.5), enlever toutes les siliques matures et en développement sur les plantes.

2. l’élément génétique/génomique d’intérêt le clonage dans un vecteur pour la Transformation des plantes

  1. Amplifier le fragment d’ADN cible à l’aide de polymerase chain reaction (PCR)17 et isoler le produit PCR à l’aide d’une gel extraction kit (voir Table des matières) selon le protocole du kit ou toute autre méthode appropriée pour purifier l’ADN à l’aide de gel d’agarose l’électrophorèse17,18. Vérifier la séquence du produit PCR isolé par le biais de séquençage Sanger19.
  2. Clone le produit PCR désiré dans le vecteur et le transformer la construction clonée dans le compétent e. coli cellules utilisant une topoisomérase clonage clonage kit (voir Table des matières) suite aux directives du fabricant.
  3. Répartis 50 µL de produits transformés sur Luria-Bertani milieux de croissance bactérienne avec agar de20 (LB) (tableau 1) avec des antibiotiques appropriés, par ex.., 50 µg / mL spectinomycine (voir Table des matières) et incuber à 37 ° c C pendant la nuit.
  4. Le jour suivant, sélectionnez 5 – 10 colonies individuelles, ensemencer un milieu LB liquide avec des antibiotiques appropriés et incuber avec agitant doucement à 37 ° C pendant la nuit.
  5. Les plasmides isoler à l’aide d’un isolement de plasmide kit (voir Table des matières) et vérifier par le biais de séquençage Sanger19 si la séquence cible amplifiée 2.1 est correctement clonée.
  6. Transférer le produit PCR cloné et vérifié à un vecteur de destination pour la transformation des plantes compatible avec axée sur la recombinaison de clonage (voir Table des matières), en utilisant un mélange d’enzymes recombinase kit qui suit (voir Table des matières), instructions du fabricant de la trousse. Répétez étape 2.3 à l’étape 2.5 d’isoler et de vérifier les clones hébergeant des constructions de plasmide approprié.

3. comment transformer le vecteur de construire pour la Transformation des plantes Agrobacterium tumefaciens

  1. Le plasmide de la construction de vecteur de 2,6 à transformer la souche a. tumefaciens GV3101:pMP90RK21, qui recèle un gène de résistance de Rifampicin pour sélection de fond chromosomiques. Utiliser des antibiotiques appropriés, par exemple, gentamycine ou kanamycine (voir Table des matières), pour la sélection d’usine de transformation a construire (plasmide Ti). Un protocole bref pour transformation d’a. tumefaciens par électroporation est inclus dans la section 3.2.
  2. A. tumefaciens transformation par électroporation
    1. Décongeler les cellules compétentes d’a. tumefaciens 22 sur la glace. Mix 0,1 et 1 µg du plasmide préparé à partir de 2.6, dissoute dans 1-2 µL de ddH2O, avec des cellules compétentes sur la glace. Transférer le mélange dans une cupule d’électroporation (voir Table des matières).
    2. Effectuer l’électroporation sur le mélange des plasmides et des cellules capables de 3.2.1, à l’aide d’un électroporateur (voir la Table des matières) suivant les directives du fabricant.
      Remarque : Nettoyer la surface de la cuvette avant de commencer l’électroporation.
    3. Transférer le mélange réactionnel de la cuvette dans un tube de microcentrifuge qui contient 1,5 mL de liquide LB et mélangez bien avec le pipetage et incuber pendant 1 h à 28 ° C sous agitation douce.
  3. Ensemencer la transformée a. tumefaciens de section 3.2 sur plaques LB contenant des antibiotiques une sélection appropriée (p. ex. kanamycine 25 µg / mL, la spectinomycine 50 µg / mL, gentamicine 25 µg / mL et rifampicine 50 µg / mL) et incuber à 28 ° C pendant 3 jours.

4. par Agrobacterium Transformation de S. parvula

  1. Inoculer le single transformé colonies de plaques dans 10 mL de support liquide LB contenant des antibiotiques (les mêmes qu’en 3.3) dans une conique stérile de 50 mL de tube (voir Table des matières). Incuber pendant 24 h dans un incubateur à agitation (voir Table des matières) à 250 tr/mn à 28 ° C.
  2. Transférer la solution bactérienne de 3.4.1 dans un flacon stérile 250 mL, ajouter 40 mL de milieu liquide LB avec des antibiotiques appropriés et incuber pendant 12 heures, jusqu'à ce que la densité optique à une longueur d’onde de 600 nm (OD600) atteint environ 2.0.
  3. Centrifuger l’a. tumefaciens cultureat 3 100 x g pendant 10 min. retirer le surnageant et remettre en suspension les cultures bactériennes dans 40 mL de solution d’infiltration a. tumefaciens (tableau 1).
  4. Diluer l' extrait a. tumefaciens avec une solution d’infiltration pour un final de l’OD600 de 0,8. Ajouter 25 µL de solution de surfactant (tableau 1) à 50 mL de dilué a. tumefaciens solution et mélanger en retournant plusieurs fois.
  5. Tremper l’inflorescence des plantes dans la solution d’a. tumefaciens préparée dans la section 4.4 à 20 s. utiliser une solution bactérienne fraîche après inflorescence de six pots de trempage. Assurez-vous que toutes les fleurs sont en contact avec la solution. Solutions bactériennes pipette directement sur les fleurs situés dans la partie inférieure de l’inflorescence s’ils ne peuvent pas être plongés dans la solution.
    Remarque : Pour la transformation de la première ronde, assurez-vous d’enlever toutes les siliques matures et en développement, à l’aide d’un scalpel tranchant ou petits ciseaux. Ne pas enlever les siliques si vous effectuez la transformation pour la deuxième fois.

5. soin des plantes après la transformation et la deuxième Transformation

  1. Placez les plantes florales-plongé horizontalement dans des plateaux propres avec dômes à couvrir les plantes et les placer dans une pièce sombre croissance pendant 1 à 2 jours.
    Remarque : Garder les fleurs sous humidité élevée est important à ce stade (Figure 1, les plantes après transformation).
  2. Retourner les plantes à la verticale et transférer les plantes dans une chambre de croissance avec un 14 h par jour/10 h par cycle nuit, 130 µmol m-2 s-1 intensité de la lumière et la température de 22 à 24 ° C.
  3. Surveiller les inflorescences plongés dans la semaine suivante. Si un nombre important de fleurs s’interrompt (Figure 2), répétez la trempette florale (étape 4) après environ 4 semaines ou après qu’un grand nombre de fleurs ont récemment mis au point.
    Remarque : Contrairement à l’étape de préparation de la première transformation (étape 1.3.7), ne pas enlever le préexistants ou développer des siliques (Figure 2) avant le second tour de la transformation.
  4. Cultiver les plantes jusqu'à ce que les graines mûrissent et récoltent les graines à ~ 21 semaines.
  5. Graines sèches pendant 2 – 3 semaines à température ambiante dans une boîte hermétique avec remplis de gel de silice (voir Table des matières).

6. sélection des Transformants positifs

  1. Plantez les graines à T1 comme pour le type sauvage de graines dans les étapes 1,2 à 1,3.
  2. Cultiver les plantes jusqu'à ce que les 2 premières vraies feuilles développent, environ 10 à 14 jours après la germination.
  3. Effectuer une première sélection pour la résistance aux herbicides (Figure 3A et 3 b) comme indiqué ci-dessous.
    1. Diluer l’herbicide glufosinate-ammonium (11,3 %) (ou BASTA) (tableau 1) de 1 : 1 000 (v/v). Vaporiser la solution diluée de BASTA sur les semis et couvrir les plantes avec des coupoles du jour au lendemain.
    2. Répétez BASTA pulvériser 2 à 3 fois tous les 5 – 7 jours.
  4. Effectuer la deuxième sélection utilisant un test de BASTA-déposer tel que décrit ci-après.
    1. Identifier les plantes qui survivent après avoir pulvérisé 3 à 4 fois avec la solution BASTA. Cultiver les plantes pour encore 2 à 3 semaines jusqu'à ce que 3 à 5 feuilles développent une surface relativement importante.
    2. Sélectionner la plus grande feuille mature par plante, frotter la surface de la feuille délicatement avec un doigt pour enlever la couche de cire et déposez une goutte de la solution diluée de BASTA (de l’étape 6.3.1).
      Remarque : Marquez l’emplacement de la feuille, appliquée avec la chute BASTA en plaçant une bande de papier sur la tige le plus proche.
    3. Surveiller les feuilles appliquées avec la chute de BASTA pour signes de flétrissement pendant une semaine. Sélectionner les plantes avec feuilles pas affectées par les gouttes BASTA.
      Remarque : Feuilles de plantes plus de faux-positifs commencent à se faner dans les deux jours, tandis que les feuilles de true-positifs sont intactes, même après que la goutte de solution BASTA sèche vers le haut (Figure 3C).
  5. Confirmer les transformants positifs par PCR genomic.
    1. Recueillent les 2 – 3 feuilles de plantes survivants à étape 6.4.5.
    2. Extraire l’ADN génomique des feuilles à l’aide de la méthode CTAB23 ou approprié toute autre méthode d’extraction de l’ADN.
    3. Effectuer la PCR à l’aide d’extraits des échantillons d’ADN génomiques de plantes cibles, les plantes de type sauvage (comme les contrôles négatifs) et la construction plasmidique de l’étape 3.1 (à titre de témoin positif). Utilisez une paire appropriée d’amorces PCR spécifiques au gène marqueur sélectif, par exemple, pour le gène résistant à BASTA (bar), TCAGCAGGTGGGTGTAGA (avant) et GTCAACCACTACATCGAGACAA (revers).
      1. Pour les amorces PCR exemple ciblant le gène bar , utiliser les conditions suivantes de la PCR : l’étape de dénaturation initiale à 98 ° C pendant 30 s ; suivi de 30 cycles de dénaturation à 98 ° C pendant 30 s, recuit à 59 ° C pendant 30 s et s’étendant à 72 ° C pendant 30 s ; et l’extension finale à 72 ° C pendant 5 min.
        Remarque : Afin d’assurer l’insertion de l’ADN-T ensemble, nous recommandons de procéder aussi génomique PCR utilisant une amorce PCR du gène marqueur sélective et une autre amorce PCR spécifique de la séquence cible cloné à vecteur de transformation de la plante à l’étape
    4. Confirmer la présence de la taille attendue du produit PCR amplifiés bar par agarose gel électrophorèse17 pour les échantillons de cible (Figure 4A) ainsi que par le produit PCR isolés19 utilisant le séquençage la même procédure qu’à l’étape 2.1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nous avons développé un protocole de transformation qui permet la récolte de graines0 T dans les 150 jours suivant, en utilisant une méthode d’immersion à floral modifiée de celle d’a. thaliana. La figure 1 montre un résumé de la chronologie et les plantes de S. parvula qui représentent le stade optimal pour l’exécution de la transformation par le biais de floral-dip. Nous avons choisi S. parvula plantes avec des fleurs de 70 – 80 dans plusieurs inflorescences à 60 à 80 jours après la germination comme la phase cible pour la transformation. Un petit nombre de préexistants fleurs ouvertes ou fécondés et siliques à ce stade ont été retiré avant l’infiltration d’a. tumefaciens par la méthode d’immersion à floral. Infection par a. tumefaciens a provoqué l’avortement de quelques fleurs (Figure 2, support (a)). Siliques complètement développé après le floral-dip sont susceptibles de contenir des graines transformées (Figure 2, support (b)). Même après transformation, S. parvula a continué à développer de nouvelles inflorescences et fleurs tant que les plantes se trouvaient en bonne santé (Figure 2, flèches blanches). En raison de cette habitude de floraison pour une période indéterminée, une deuxième série de transformation peut être effectuée si la plante ne montre pas de signes de stress ou de sénescence. Figure 2 A et 2 b donnent des exemples de plantes S. parvula après le premier et le deuxième tour de la transformation, respectivement, 25 jours, indépendamment de l’autre. Dans la deuxième transformation, siliques existants ne devraient pas être retirés parce qu’ils peuvent contenir des semences transgéniques. En outre, le a. tumefaciens peuvent être appliquées en pipettant également, la solution d’infiltration (tableau 1) sur nouvelles grappes de fleurs, au lieu de tremper la tige entière dans la solution, pour minimiser les dégâts à siliques dès le premier transformation.

L’efficacité de la transformation est 0,033 %, ce qui donne des plantes transgéniques de 3 – 4 10 000 graines T1 propagées en utilisant le protocole actuel. Cette estimation repose sur ~ 50 000 graines T1 testés au cours de dix tentatives de transformation indépendant. Alors que l’efficacité est inférieure à celle de l' Arabidopsis thaliana, il est comparable à la transformation d’un autre extremophyte plante Eutrema salsugenium24 et certains de l’Arabidopsis thaliana écotypes25. L’efficacité de la transformation peut être optimisée en utilisant les autres souches d’Agrobacterium et modifications de surfactant et infiltration des solutions. Le BASTA plusieurs tests de pulvérisation et goutte (points 6.3 et 6.4) sera crucial pour identifier le vrais transformants positifs et réduire le nombre d’échantillons testés avec la confirmation de la PCR à l’étape 6.5 (Figure 4A). Nouvelle confirmation de la transformation peut être vérifiée avec une expression du gène rapporteur, si la séquence clonée comprend un gène rapporteur (Figure 4B).

Figure 1
Figure 1 : Chronologie de la transformation de S. parvula . S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2: S. parvula plantes après transformation par floral-trempette au Les plantes ont été photographiés à 10 jours après le premier floral-dip à 60 jours (A) et 25 jours après la deuxième série de floral-dip à jour 85 (B). Infiltration avec Agrobacterium peut avorter développement silique de fleurs comme sur supports un. Siliques complètement développé après floral creux sont susceptibles de contenir des graines transformées (supports b). Les flèches blanches indiquent fleurs et inflorescences nouvellement émergés après chaque transformation. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Sélection de S. parvula transformants basé sur la résistance de BASTA. (A) T1 semis avant la pulvérisation BASTA. (B) cercle rouge indique un candidat transformant survivant le choix de première ronde par les embruns BASTA. Épreuve de chute (C), le choix de deuxième ronde de BASTA. Un exemple de faux positifs (panneau supérieur) et de vraies plantes transgéniques (panneau inférieur) sont indiquées. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : Confirmation de la transformation de S. parvula . (A), PCR amplification du gène de la barre d’ADN génomique, extraits de plantes S. parvula . Voie 1 et 13 : taille des marqueurs ; Voie 2 : contrôle négatif ; Lane 3-5 : sauvage S. parvula ; Lane 6-10 : transgéniques S. parvula candidats ; Lane 11-12 : la lutte antivectorielle. Pistes 7, 8 et 9 sont des exemples positifs transformants. (B) exemple d’expression du gène rapporteur GUS dans un positif S. parvula transformant. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Médias / Solution Réactif Montant
Milieux de culture bactérienne de Luria-Bertani (LB) NaCl
Tryptone
Extrait de levure
Agar (pour plaques)
ddH2O
10 g
10 g
5 g
20 g
955 mL
Solution d’infiltration Agrobacterium MS de sel (1/4 x)
Vitamines B5 (1 x)
Saccharose (5%w/v)
MES
N6- benzylaminopurine (BA)
Silwet L-77 (0.05%v/v)
pH
2,16 g
1 mL
50 g
0,5 g
10 ΜL
500 ΜL
5.7

Tableau 1 : Composition des milieux de croissance bactérienne et Agrobacterium solution infiltration.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L’état physiologique de la plante influence significativement l’efficacité de transformation25. L’utilisation de plants sains et vigoureux pour transformation est une condition essentielle pour la réussite de la transformation en S. parvula. L’eau ou lumière des plantes stressées auront moins de fleurs par rapport à l’idéal de transformation (Figure 1, panneau central) des plantes saines. S. parvula peuvent pousser à une intensité lumineuse inférieure à 130 µmol m-2 s-1, mais les plantes ont tendance à être fragiles ; ces plantes conduirait à plus abandonnée fleurs suite floral creux. S. parvula tend à abandonner les fleurs Agrobacterium-plongé à un taux plus élevé que a. thaliana. Par conséquent, toutes les mesures prises pour minimiser les fleurs avortés lorsque trempée dans la solution d’infiltration a. tumefaciens contribuent à une meilleure efficacité de transformation. Nous recommandons une période de lumière n’est plus que 14 h par jour. Souvent, la transformation d’a. thaliana est effectuée sur les plantes cultivées dans une condition de jours longs (par exemple 18 h de lumière et 6 h obscurité) ou même sous un éclairage continu. Cependant, nous avons trouvé tel résultat de pratiques chez les plantes S. parvula moins résilients et conduisent à une efficacité de transformation faible.

Les bourgeons floraux sont produites continuellement sur les axes de l’inflorescence de S. parvula (Figure 2, flèches blanches). Par conséquent, ce qui permet la transformation de nouvelles fleurs augmenterait de façon significative les chances d’obtenir des transformants positives. Un deuxième floral-plongeon (étape 5.3) n’est pas indispensable, mais fortement suggérée. Toutefois, cette étape est relativement beaucoup de temps par rapport à a. thaliana floral plongeant, parce que S. parvula produit plusieurs axes de l’inflorescence.

Sauvage S. parvula est sensible aux BASTA, bien que l’écran initial de transformants positives avec spray BASTA (étape 6.3) laissera 5 – 8 plantes survivants hors 100 graines germées (Figure 3A et 3 b). La plupart de ceci (> 80 %) seront des faux positifs. C’est en grande partie en raison de la forme des feuilles étroites et l’angle de la feuille de S. parvula, qui ne prévoient pas de surface foliaire suffisante dans une orientation appropriée pour retenir la solution BASTA pour une durée suffisante pour observer un phénotype. En outre, en raison de la teneur en cires haut de la surface adaxiale des feuilles de S. parvula10, il a tendance à créer une surface plus imperméable pour BASTA. La seconde projection de transformants positives à l’aide d’une goutte BASTA sur feuilles individuelles (étape 6.4, Figure 3C) est donc une étape essentielle pour éviter les PCR des tests sur des centaines de faux positifs (étape 6.5).

Le protocole actuel a été testé avec la souche a. tumefaciens GV3101 portant le plasmide pMP90RK . L’efficacité de transformation peut-être être améliorée avec les autres souches d’a. tumefaciens , y compris les souches ABI LMG20 et Rifr C58C1, avec le plasmide de virulence pMP90 signalé pour augmenter l’efficacité de la transformation chez Arabidopsis 25. espèces Brassica et Eutrema sont sur le plan taxonomique plus étroitement apparentés aux s. parvula par rapport à a. thaliana1. Par conséquent, le a. tumefaciens souche LBA4404 qui a été utilisé avec succès pour transformer les Brassica napus et la souche EHA105 qui a été utilisé avec succès pour transformer Eutrema Bavarica peut offrir une transformation plus élevée efficacité que l’efficience déclaré de la souche utilisée actuellement26,27,28.

Réduire le temps et la main-d'oeuvre requise par un protocole de transformation est un autre facteur important dans l’amélioration de l’efficacité de la transformation. Mise individuels BASTA gouttes sur les feuilles et la feuille de surveillance pendant une semaine sur plusieurs usines (étape 6.4) sont fastidieux. Une future afin d’accroître l’efficacité de la transformation pourrait rechercher marqueur sélectionnable alternatif approprié gènes29.

La disponibilité d’un protocole de transformation établies feront progresser considérablement notre capacité à identifier des gènes et nouveaux mécanismes qui permettent aux plantes de modèles extremophyte survivre plusieurs stress abiotiques2,4. Nouvelles variations génétiques chez les S. parvula offrira un plus large bassin de variation génétique qui ne peut être extrait de la variation allélique collective identifiée comme des gènes sensibles aux stress dans le modèle relativement sensibles au stress, a. thaliana Pan-génome5,6. Par conséquent, notre trempette-floral selon a. tumefaciens véhiculée par le protocole de transformation développé pour S. parvula comblera une lacune pour le besoin de tels outils pour réaliser des expériences de génomiques fonctionnelles dans un modèle d’extremophyte apparenté au A. thaliana.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Ce travail a été soutenu par une bourse de la National Science Foundation 1616827 MCB.

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).
Croissance des plantes et la Transformation par Agrobacterium Floral creux de la Extremophyte <em>Schrenkiella parvula</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).More

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter