Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Pflanzen Sie Wachstum und Agrobakterium-vermittelten Floral-Dip Transformation des Extremophyte Schrenkiella parvula

doi: 10.3791/58544 Published: January 7, 2019

Summary

Agrobakterium-vermittelten Transformation mit einem floral-Dip-Methode kann erfolgreich eingesetzt werden, stabilere transgene Linien des Modells Extremophyte Schrenkiella Parvulaerstellen. Wir präsentieren Ihnen ein Protokoll aus, die für Arabidopsis Thaliana, unter Berücksichtigung verschiedener Wachstum Gewohnheiten und physiologischen Eigenschaften der Extremophyte modifiziert.

Abstract

Schrenkiella Parvula ist eine Extremophyte, die verschiedenen abiotischen Belastungen ausgesetzt, darunter mehrere Ionen-Toxizität betont angepasst. Trotz hoher Qualität genomischer Ressourcen zur Verfügung zu studieren, wie Pflanzen sich an ökologischen anpassen betont seinen Wert als ein Modell der funktionellen Genomik und Werkzeug hat durch das Fehlen eines Systems möglich Transformation beschränkt worden. Wir berichten in diesem Protokoll wie stabile transgenen S. Parvula erzeugt Linien mit einem Agrobakterium-vermittelten floral-Dip Verfahren. Wir modifiziert das Umwandlung Protokoll A. Thaliana , um einzigartige Merkmale von S. Parvula, wie eine unbestimmte blühenden Gewohnheit und eine hohe epikutikulären Wachsgehalt auf den Blättern zu berücksichtigen. Kurz, waren S. Parvula Samen bei 4 ° C für fünf Tage vor der Aussaat stratifiziert. Pflanzen wurden angebaut an eine Photoperiode 14 h Licht und dunkel 10 h und eine 130 µmol m-2s-1 Lichtintensität, bei 22 ° C bis 24 ° C. Acht bis neun Wochen alten Pflanzen mit mehreren Blütenständen wurden für die Transformation ausgewählt. Diese Blütenstände wurden in einer Infiltration-Lösung von Agrobacterium Tumefaciens GV3101 tragen das Plasmid pMP90RK getaucht. Wir führten zwei Runden der Blume mit einem Intervall von drei bis vier Wochen zur Steigerung der Effizienz der Umwandlung eintauchen. Die T1-Samen wurden gesammelt und getrocknet für vier Wochen in einem Behälter mit Trockenmittel, bevor Keimung zum Bildschirm für Kandidaten Linien umgewandelt. Widerstand gegen BASTA diente T1 Pflanzen auf den Bildschirm. Die BASTA-Lösung besprüht wir dreimal mit einem Abstand von drei Tagen ab zwei Wochen alten Pflanzen, Fehlalarme zu reduzieren. Ein BASTA Drop durchgeführt wurde auf die Überlebenden Einzelpflanzen um wahre positive Transformanten zu identifizieren. Die Transformationseffizienz war 0,033 %, 3 – 4 transgene Pflanzen pro 10.000 T1 Samen vermehrt nachgeben.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In diesem Protokoll beschreiben wir das Wachstum und die Schaffung von stabilen transgenen Linien für das Extremophyte Modell Schrenkiella Parvula. Die Verfügbarkeit eines effizienten Transformation-Systems ist ein Markenzeichen von jedem vielseitige genetisches Modell. Pflanzen, die in extremen Umgebungen, bezeichnet als Extremophytes, liefern eine wichtige Ressource für das Verständnis Pflanze Anpassungen an Umweltbelastungen. Schrenkiella parvula (ehemals Thellungiella Parvula und Eutrema Parvulum) ist ein solches Extremophyte-Modell, mit der Erweiterung genomischer Ressourcen1,2,3,4,5. Jedoch wurden Umwandlung Protokolle nicht noch für S. Parvula in veröffentlichten Studien berichtet.

Das Genom von S. Parvula ist das erste veröffentlichte Extremophyte Genom in Brassicaceae (Senf-Kohl-Familie) und zeigt eine umfangreiche allgemeine Genom trägt mit dem nicht-Extremophyte Modell, Arabidopsis Thaliana1. So könnten Vergleichsstudien zwischen A. Thaliana und S. Parvula profitieren aus der Fülle der genetischen Studien auf A. Thaliana zu informativen Hypothesen über wie das Genom S. Parvula reguliert entwickelt und hat anders zur Bewältigung betont extremer Umwelt5,6,7. S. Parvula ist eines der am meisten salztoleranten Arten (basierend auf Boden NaCl LD50) unter bekannten wilden Verwandten von A. Thaliana8. Neben der NaCl-Toleranz S. Parvula überlebt und seines Lebenszyklus in Anwesenheit von mehreren Salzionen in hohen Konzentrationen giftig für die meisten Pflanzen7vervollständigt. In Reaktion auf die abiotischen betont in seinem natürlichen Lebensraum weit verbreitet hat es verschiedene Merkmale entwickelt, unter denen mehrere biochemische oder physiologische Ebene 8,9,10untersucht worden sind, 11.

Seit 2010 über 400 Peer-getestet-Publikationen, die als ein Zielarten S. Parvula verwendet oder im Vergleich mit anderen Pflanzengenomen verwendet. Jedoch konnte ein klare Engpass identifiziert werden, mit einem genaueren Blick der welche Art von Studien sind durchgeführt worden. Die meisten dieser Berichte die mögliche Verwendung von S. Parvula in zukünftigen Studien zu diskutieren oder in vergleichende genomische oder Phylogenomic Studien verwenden. Aufgrund des Fehlens eines Proof-of-Concept-Transformation-Protokolls eingerichtet für S. Parvula, es nicht in funktionelle Genomik Studien, trotz des Habens eines der höchsten Qualität Pflanzengenomen bisher verfügbaren verwendet wurde (> 5 Mb Contig N50) montiert und kommentiert in Chromosom-Ebene Pseudomolecules1.

Floral-Dip Transformationsmethode Agrobakterium-vermittelten geworden die meisten allgemein verwendeten Methode zum Erstellen von Trasngenic Linien in A. Thalianaund eine reproduzierbare System Transformation entwickelte sich ein kritischer Faktor für seinen Erfolg als eine genetischen Modell12,13. Nicht alle Brassicaceae Arten ist jedoch nachweislich erfolgreich umgewandelt werden mit der floral-Dip-Methode für A. Thalianaentwickelt. Speziell, wurde die Brassicaceae Lineage II-Arten, die S. Parvula gehören widerspenstigen bis floral-Dip nach Umwandlung Methoden14,15.

Die unbestimmten Blüte Wuchsform von S. Parvula, kombiniert mit seiner schmalen Blatt Morphologie machte es schwierig, die standard Agrobakterium-vermittelten floral-Dip Transformationsmethode zu verabschieden. In dieser Studie berichten wir über das geänderte Protokoll, die, das wir für reproduzierbare Transformation von S. Parvulaentwickelt haben.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Pflanzenwachstum

  1. Samen Sterilisation (optional)
    1. Bereiten Sie 50 % Bleichmittel in bidestilliertem Wasser (DdH2O) mit 1 oder 2 Tropfen eines nichtionischen Waschmittels (siehe Tabelle der Materialien) in einem 50 mL-Tube. Invertieren Sie das Rohr mehrmals, um die Lösung zu mischen.
      Hinweis: Es empfiehlt sich, Samen Sterilisation in einem Laminar-Flow Kabinett mit einer UV sterilisierte Oberfläche für 15 min durchzuführen.
    2. Fügen Sie das Bleichmittel-Lösung auf ~ 100 – 200 S. Parvula Samen in einer 1,5 mL Tube. Mischen Sie gründlich und lassen Sie den Schlauch für 5 Minuten sitzen.
    3. Entfernen Sie das Bleichmittel aus dem Rohr zu, und fügen Sie 70 % Ethanol. Die Samen durch Pipettieren mehrmals waschen und dann die Ethanol-Lösung sofort entfernen.
    4. Waschen Sie die Samen in sterilisierten Wasser, überschüssige Bleichmittel und Ethanol zu entfernen, dann entfernen Sie das Wasser. Wiederholen Sie diesen Schritt 5 bis 6 Mal.
  2. Samen Schichtung
    1. Die Samen in sterilisierten Wasser tauchen und für 5 bis 7 Tage bei 4 ° c lagern Alternativ getrocknete sterilisierte Saat direkt auf nassem Boden und das Boden-Tablett für 5 bis 7 Tage bei 4 ° C.
  3. Anbau von Pflanzen in Vorbereitung der transformation
    1. Füllen Sie der Boden mischen (siehe Tabelle der Materialien), 7 x 6 cm2 Töpfe, die Töpfe in Wasser einweichen und sprühen Sie Wasser von oben ein gleichmäßig nass Wachstumsmedium sicherzustellen. Fügen Sie 5 – Dünger Perlen (siehe Tabelle der Materialien), auf der Bodenoberfläche von jedem Pot.
      Hinweis: Soweit wir erfahren haben, wächst S. Parvula gut auf jede Erdmischung, wo A. Thaliana wachsen kann.
    2. Mit einem nassen Zahnstocher übertragen 20 ~ 25 Samen pro Topf auf der Bodenoberfläche.
      Hinweis: Eine bequeme Methode ist, legen Sie einen Stapel von 4 – 5 Samen in den vier Ecken und die Mitte des Topfes (Abbildung 1, Tag 15, linken).
    3. Decken Sie die Topf-Tablett mit eine klare Kuppel, die Samen während der Keimung unter hoher Luftfeuchtigkeit zu halten.
    4. Halten Sie die Pflanzentrays in einer Kammer Wachstum mit eine Lichtintensität auf 130 µmol m−2 s−1 Licht, 22 – 24 ° C Temperatur und 14 h pro Tag/10 h pro Nachtzyklus festgelegt. Entfernen Sie die Kuppeln ca. 7-10 Tage nach Keimung. Fügen Sie Wasser aus dem Boden der Schale, Boden befeuchtet gleichmäßig auf einem wünschenswerten Niveau zu halten.
    5. Merzen Sie zusätzliche Sämlinge und lassen Sie nur 4 – 5 gesunde Setzlinge pro Topf gut getrennt voneinander unterscheiden (Abbildung 1, Tag 15, rechts).
    6. Sanft alle zwei Tage gießen und düngen mit 0,2 x Hoagland Lösung16 einmal alle zwei Wochen.
      Hinweis: Die Bodenfeuchte auf einem gleichmäßigen Niveau zu halten ist der Schlüssel zu wachsenden S. Parvula konsequent und gesund.
    7. Weiter wachsen die Pflanzen für 8 – 10 Wochen bis mehrere Blütenstände 100 – 150 Blume Knospen pro Pflanze (Abbildung 1, Tag 60 – 80) produzieren. Am Tag geplant für die floral-förmige Basis Transformation (Schritt 4.5) entfernen Sie alle Reifen und den Entwicklungsländern Siliques aus den Pflanzen.

(2) Klonen das Gen/genomische Element von Interesse in einen Vektor Pflanzentransformation

  1. Verstärken der Ziel-DNA-Fragment mittels Polymerase-Kettenreaktion (PCR)17 und isolieren das PCR-Produkt mit einer Gel-Extraktion kit (siehe Tabelle der Materialien) entsprechend der Kit-Protokoll oder eine andere geeignete Methode, DNA mit Agarosegel zu reinigen Elektrophorese17,18. Überprüfen Sie die Reihenfolge der isolierten PCR-Produkt durch Sanger-Sequenzierung19.
  2. Klon der gewünschten PCR-Produkt in den Klonen Vektor und Transformation der geklonte Konstrukt in kompetente E. Coli Zellen durch ein Topoisomerase-basierte Klonen kit (siehe Tabelle der Materialien) nach Herstellerangaben.
  3. 50 µL Verarbeitungsprodukte auf Luria-Bertani20 (LB) Agar Bakterienwachstum Medien (Tabelle 1) mit geeigneten Antibiotika zu verbreiten z.B.., 50 µg / mL Spectinomycin (siehe Tabelle der Materialien), und bei 37 ° c inkubieren C über Nacht.
  4. Am nächsten Tag wählen Sie 5 – 10 einzelne Kolonien, in LB-Flüssigmedium mit geeigneten Antibiotika zu impfen und mit sanft schütteln über Nacht bei 37 ° C inkubieren.
  5. Isolieren Plasmide mit einem Plasmid-Isolierung kit (siehe Tabelle der Materialien) sowie durch Sanger-Sequenzierung19 zu prüfen, ob die Zielsequenz verstärkt in 2.1 ordnungsgemäß geklont wird.
  6. Übertragen der geklonte und verifizierte PCR-Produkt zu einem Ziel-Vektor für Pflanzentransformation kompatibel mit Rekombination basierende Klonen (siehe Tabelle der Materialien), mit einer Rekombinase-Enzym-Mix kit (siehe Tabelle der Materialien), im folgenden Anweisungen des Herstellers des Kit. Wiederholen Sie ab Schritt 2.3 Schritt 2.5 zu isolieren und Klone beherbergen richtige Plasmid Konstrukte zu überprüfen.

3. Umwandlung der Vektor konstruieren für Pflanzentransformation in Agrobacterium tumefaciens

  1. A. Tumefaciens Stamm GV3101:pMP90RK21, die eine Rifampicin-Resistenz-Gen für chromosomale Hintergrundauswahl birgt verwandeln Sie das Plasmid des Vektor-Konstrukts von 2,6. Verwenden Sie geeignete Antibiotika, z. B. Gentamycin oder Kanamycin (siehe Tabelle der Materialien), für die Auswahl der Anlage konstruieren Transformation (Ti-Plasmid). Ein kurzes Protokoll für A. Tumefaciens Transformation durch Elektroporation ist in Abschnitt 3.2 enthalten.
  2. A. Tumefaciens Transformation durch Elektroporation
    1. A. Tumefaciens kompetente Zellen22 auf Eis auftauen. Mix 0,1 – 1 µg des Plasmids vorbereitet von 2,6, aufgelöst in 1 – 2 µL DdH2O, mit kompetenten Zellen auf Eis. Übertragen Sie die Mischung in eine Küvette Elektroporation (siehe Tabelle der Materialien).
    2. Elektroporation auf die Mischung von Plasmiden und kompetente Zellen von 3.2.1, mit einer Electroporator durchführen (siehe Tabelle der Materialien) nach den Richtlinien des Herstellers.
      Hinweis: Reinigen Sie die Oberfläche der Küvette, vor Beginn der Elektroporation.
    3. Übertragen das Reaktionsgemisch aus der Küvette zu einem Microcentrifuge Schlauch, der enthält 1,5 mL des flüssigen LB und mischen Sie gut mit pipettieren und Inkubation für 1 h bei 28 ° C mit sanft schütteln.
  3. Impfen die transformierten A. Tumefaciens aus Abschnitt 3.2 auf LB-Platten mit entsprechenden Auswahl Antibiotika (z. B. Kanamycin 25 µg / mL, Spectinomycin 50 µg / mL, Gentamycin 25 µg / mL und Rifampicin 50 µg / mL) und 3 Tage bei 28 ° C inkubieren.

4. Agrobakterium-vermittelte Umwandlung von S. parvula

  1. Impfen die Single verwandelt Kolonien von Platten in 10 mL LB flüssiger Medien mit Antibiotika (die gleichen wie in 3.3) in einem steril 50 mL konische Rohr (siehe Tabelle der Materialien). 24 h in einem schütteln Inkubator inkubieren (siehe Tabelle der Materialien) auf 250 u/min. bei 28 ° C.
  2. Übertragen Sie die bakterielle Lösung von 3.4.1 auf eine sterile 250 mL Flasche, fügen Sie 40 mL LB flüssiger Medien mit geeigneten Antibiotika hinzu und inkubieren Sie 12 h bis die Extinktion bei 600 nm Wellenlänge (OD600) etwa 2,0 erreicht.
  3. Zentrifugieren Sie der A. Tumefaciens Cultureat 3.100 X g für 10 min. Entfernen des Überstands und wieder unterbrechen Sie die Bakterienkultur in 40 mL A. Tumefaciens eindringen Lösung (Tabelle 1).
  4. Verdünnen Sie die resuspendierte A. Tumefaciens eindringen Lösung für eine endgültige OD600 von 0,8. 50 mL verdünnten A. Tumefaciens 25 µL Tensid-Lösung (Tabelle 1) hinzufügen Lösung und Mix durch invertieren mehrmals.
  5. Tauchen Sie den Blütenstand der Pflanzen in der A. Tumefaciens Lösung 20 S. Verwendung einer frischen bakterielle Lösung nach dem Eintauchen Blütenstand aus sechs Töpfen im Abschnitt 4.4 vorbereitet. Stellen Sie sicher, dass alle Blumen in Kontakt mit der Lösung sind. Pipettieren bakterielle Lösungen direkt auf Blumen befindet sich im unteren Teil des Blütenstandes, wenn sie in die Lösung eingetaucht werden können nicht.
    Hinweis: Achten Sie für die Erstrunden-Transformation darauf, alle Reifen und den Entwicklungsländern Siliques mit einem scharfen Skalpell oder kleine Schere entfernen. Entfernen Sie Siliques nicht, wenn Verwandlung zum zweiten Mal durchführen.

5. Post-Transformation Pflanzenpflege und die zweite Verwandlung

  1. Legen Sie die Pflanzen Blumen getaucht horizontal in sauberen Schalen mit Kuppeln, abdecken der Pflanzen und in einem dunklen Wachstum-Zimmer für 1 – 2 Tagen.
    Hinweis: Halten die Blumen unter hoher Luftfeuchtigkeit ist wichtig in dieser Phase (Abbildung 1, Pflanzen nach der Transformation).
  2. Die Pflanzen in eine aufrechte Position zurück und übertragen Sie die Pflanzen auf ein Wachstum Zimmer mit 14 h pro Tag/10 h pro Nacht-Zyklus, 130 µmol m-2 s-1 Lichtintensität und 22 bis 24 ° C Temperatur.
  3. Überwachen Sie die eingetauchte Blütenstände in der Folgewoche. Wenn eine erhebliche Anzahl von Blumen (Abbildung 2) abbrechen, wiederholen Sie die florale Dip (Schritt 4) nach etwa 4 Wochen, oder wenn eine große Anzahl von Blumen neu entwickelt haben.
    Hinweis: Im Gegensatz zu der Vorbereitungsschritt für die erste Umwandlung (Schritt 1.3.7) entfernen Sie keine Vorerkrankungen oder Entwicklung von Siliques (Abbildung 2) vor dem zweiten Wahlgang der Transformation.
  4. Wachsen Sie die Pflanzen, bis die Samen reif und die Ernte Samen ~ 21 Wochen.
  5. Trockene Samen für 2 – 3 Wochen bei Raumtemperatur in einem luftdichten Behälter mit gefüllt mit Trockenmittel (siehe Tabelle der Materialien).

6. Auswahl der positiven Transformanten

  1. Pflanzen Sie die T1-Samen, wie für Wildtyp Samen in Schritten 1.2 bis 1.3 beschrieben.
  2. Wachsen Sie die Pflanzen, bis die ersten 2 Laubblätter, ca. 10 – 14 Tage nach der Keimung entwickeln.
  3. Führen Sie die erste Auswahl für Herbizid-Resistenz (Abbildung 3A und 3 b) siehe unten.
    1. Verdünnen Sie das Herbizid Glufosinat-Ammonium (11,3 %) (oder BASTA) (Tabelle 1), 1:1,000 (V/V). Die Sämlinge sprühen Sie BASTA Lösung verdünnt auf und decken Sie die Pflanzen mit Kuppeln über Nacht.
    2. BASTA Spritzen 2 – 3 Mal wiederholen alle 5-7 Tage.
  4. Durchführen Sie die zweite Auswahl mit einem BASTA-Drop-Test wie unten beschrieben.
    1. Pflanzen, die nach 3 – 4 Mal mit BASTA Lösung besprüht überleben zu identifizieren. Wachsen Sie die Pflanzen, für weitere 2 – 3 Wochen bis 3 – 5 Blätter eine relativ große Fläche entwickeln.
    2. Wählen Sie die größte Reifen Blatt pro Pflanze, reiben Sie die Oberfläche des Blattes vorsichtig mit einem Finger die Wachsschicht entfernen, und geben Sie einen Tropfen der verdünnten Lösung BASTA (aus Schritt 6.3.1).
      Hinweis: Markieren Sie die Stelle des Blattes, indem eine Papier-Klebeband auf den nächsten Stamm mit BASTA Tropfen angewendet.
    3. Überwachen Sie die Blätter mit der BASTA-Tropfen auf Anzeichen von welken bis zu eine Woche lang angewendet. Wählen Sie die Pflanzen mit Blättern von BASTA-Tropfen nicht betroffen.
      Hinweis: Blätter von Pflanzen am meisten falsch-positiven beginnen zu welken innerhalb von zwei Tagen, während die Blätter von wahr-positive intakt sind, auch nach oben (Abb. 3C) die Tropfen BASTA Lösung trocknet.
  5. Bestätigen Sie positive Transformanten mittels genomic PCR.
    1. Sammeln Sie 2 – 3 Blätter aus den überlebenden Pflanzen bei Schritt 6.4.5.
    2. Die Blätter mit CTAB Methode23 oder eine andere entsprechende DNA-Extraktion extrahieren Sie genomischen DNA.
    3. Durchführen Sie PCR mit extrahierten genomische DNA-Proben von Ziel-Pflanzen, Wildtyp Pflanzen (als Negativkontrollen) und das Plasmid-Konstrukt aus dem Schritt 3.1 (als Positivkontrolle). Verwenden Sie ein entsprechende paar PCR Primer spezifisch für das selektive Marker-gen, z. B., für BASTA-resistente Gene (Bar), TCAGCAGGTGGGTGTAGA (vorwärts) und GTCAACCACTACATCGAGACAA (rückwärts).
      1. Für die Beispiel-PCR-Primer auf das Bar -gen, verwenden die folgenden PCR-Bedingungen: der erste Denaturierung Schritt bei 98 ° C für 30 s; gefolgt von 30 Zyklen der Denaturierung bei 98 ° C für 30 s, Glühen bei 59 ° C für 30 s und Verlängerung bei 72 ° C für 30 s; und die letzte Erweiterung bei 72 ° C für 5 Minuten.
        Hinweis: Um die Einfügung der gesamten T-DNA zu gewährleisten, empfehlen wir Ihnen auch Durchführung von genomic PCR mit PCR-Primer von selektiver Marker-gen und ein weiterer PCR Primer spezifisch für die Zielsequenz auf der Anlage Transformationsvektor im Schritt geklont
    4. Bestätigen Sie das Vorhandensein von der erwarteten Größe des verstärkten Bar PCR Produktes durch Agarose-Gel-Elektrophorese-17 für die Ziel-Proben (Abb. 4A) sowie durch Sequenzierung der isolierten PCR Produkt19 mit das gleiche Verfahren wie in Schritt 2.1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Wir entwickelt eine Umwandlung Protokoll, die Ernte T0 Samen innerhalb von 150 Tagen kann, mit einer floralen-Dip-Methode aus, die für A. Thalianamodifiziert. Abbildung 1 zeigt eine Zusammenfassung der Chronik und S. Parvula Pflanzen, die die optimale Bühne für die Ausführung der Transformation durch blumig-Dip darstellen. Wir 70 –80 S. Parvula Blumenpflanzen in mehrere Blütenstände bei 60 bis 80 Tage nach der Keimung als der Zielphase für Transformation ausgewählt. Einige wenige der bereits bestehenden offenen oder befruchteten Blüten und Siliques zu diesem Zeitpunkt wurden vor dem Eindringen von A. Tumefaciens durch die floral-Dip-Methode entfernt. Infektion mit A. Tumefaciens führte zu Abtreibung von ein paar Blumen (Abbildung 2, Klammer (a)). Siliques voll entwickelt, nachdem die floral-Dip dürften die transformierte Samen (Abbildung 2, Halterung (b)) enthalten. Auch nach der Transformation S. Parvula weiterhin neue Blütenstände und Blüten zu entwickeln, solange die Pflanzen gesund (Abbildung 2, weiße Pfeile) gehalten wurden. Aufgrund dieser unbestimmten blühenden Gewohnheit kann eine zweite Runde der Transformation durchgeführt werden, wenn die Pflanze nicht Anzeichen von Stress oder Seneszenz aufweist. Abbildung 2 A und 2 b zeigen Beispiele von S. Parvula Pflanzen nach der ersten und zweiten Runde der Transformation, jeweils 25 Tage getrennt voneinander. In der zweiten Transformation sollte bestehender Siliques nicht gelöscht werden, da diese transgenen Saatguts enthalten können. Zudem können A. Tumefaciens angewendet werden durch die Infiltration Lösung (Tabelle 1) pipettieren auf neu entstehende Blütentrauben, statt eintauchen die gesamte schießen in die Lösung, um den Schaden zu minimieren, Siliques vom ersten Diese Transformation.

Die Transformationseffizienz ist 0,033 %, 3 – 4 transgene Pflanzen pro 10.000 T1 Samen vermehrt über das aktuelle Protokoll nachgeben. Diese Schätzung basiert auf ~ 50.000 T1 Samen während zehn unabhängige Transformation Versuche getestet. Während der Wirkungsgrad geringer als die von Arabidopsis Thalianaist, ist es vergleichbar mit der Transformation von einer anderen Extremophyte Pflanze Eutrema Salsugenium24 und einige der Arabidopsis Thaliana Ökotypen25. Die Transformationseffizienz kann weiter optimiert werden, durch die Verwendung alternativer Agrobacterium Stämme und Modifikationen von Tensid und Infiltration Lösungen. Die mehrere BASTA Spray- and -Drop-Tests (Stufen 6.3 und 6.4) werden kritisch zu wahre positiven Transformanten erkennen und reduzieren Sie die Anzahl der Proben mit der PCR-Bestätigung in Schritt 6.5 (Abb. 4A). Eine weitere Bestätigung der Transformation kann mit einem Reporter-gen-Expression, überprüft werden, wenn die geklonte Sequenz ein Reportergen (Abbildung 4B enthält).

Figure 1
Abbildung 1 : Chronik der S. Parvula Transformation. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: S. Parvula Pflanzen nach der Transformation von floral-DIP Pflanzen wurden fotografiert 10 Tage nach der ersten floral-Tauchen am Tag 60 (A) und 25 Tage nach der zweiten Runde der floral-Dip bei Tag 85 (B). Infiltration mit Agrobacterium kann Schote Entwicklung von Blumen abbrechen, wie in Klammern ein. Siliques voll entwickelt, nachdem floral-Dip dürften die transformierte Samen (Klammern b) enthalten. Weiße Pfeile zeigen, dass Blüten und Blütenstände nach jeder Transformation neu entstanden. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3 : Auswahl des S. Parvula Transformanten basierend auf BASTA Widerstand. (A) T1 Sämlinge vor der BASTA-Spray. (B) rote Kreis zeigt ein Kandidat Transformant überleben die Erstrunden-Auswahl durch das BASTA-Spray. (C) die Zweitrunden-Auswahl von BASTA Falltest. Ein Beispiel für Fehlalarme (Oberseite) und wahre transgener Pflanzen (untere Leiste) werden angezeigt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4 : Bestätigung der S. Parvula Transformation. (A) PCR Verstärkung des Bar -Gens aus genomischer DNA aus S. Parvula Pflanzen extrahiert. Bahn 1 und 13: Größe Markierungen; Bahn 2: negative Kontrolle; Bahn 3-5: Wildtyp S. Parvula ; Lane 6-10: transgene S. Parvula Kandidaten; Lane 11, 12: Vektor-Kontrolle. Die Bahnen 7, 8 und 9 sind beispielhaft positive Transformanten. (B) Beispiel für GUS -Reporter-gen-Expression in eine Positive S. Parvula Transformant. Bitte klicken Sie hier für eine größere Version dieser Figur.

Medien / Lösung Reagenz Betrag
Luria-Bertani (LB) Bakterienwachstum Medien NaCl
Tryptone
Hefeextrakt
Agar (für Platten)
DdH2O
10 g
10 g
5 g
20 g
955 mL
Agrobakterium Infiltration Lösung MS-Salz (1/4 X)
B5-Vitaminen (1 X)
Saccharose (5%w/v)
MES
N6- Benzylaminopurine (BA)
Silwet L-77 (0.05%v/v)
pH
2,16 g
1 mL
50 g
0,5 g
10 ΜL
500 ΜL
5.7

Tabelle 1: Zusammensetzung des Bakterienwachstums Medien und Agrobakterium Infiltration Lösung.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Der physiologische Zustand der Anlage beeinflusst maßgeblich die Effizienz der Umwandlung25. Die Verwendung von gesunde und kräftige Pflanzen für die Transformation ist eine wesentliche Voraussetzung für erfolgreiche Transformation in S. Parvula. Wasser oder leicht gestresste Pflanzen haben weniger Blüten, die im Vergleich zu den gesunden Pflanzen ideal für Transformation (Abbildung 1, Mittelkonsole). S. Parvula kann bei einer Lichtintensität wachsen weniger als 130 µmol m-2 s-1, aber die Pflanzen tendenziell schwächer; solche Pflanzen führt zu mehr Blumen floral-Dip nach abgebrochen. S. Parvula tendenziell Agrobacterium getaucht Blumen mit einer höheren Rate als Abbrechen A. Thaliana. Jeden Schritt, abgebrochene Blumen, wenn Sie in der A. Tumefaciens eindringen Lösung eingetaucht zu minimieren trägt somit zu einer höheren Effizienz der Umwandlung. Wir empfehlen eine leichte Periode nicht mehr als 14 h pro Tag. Oft erfolgt Umwandlung von A. Thaliana Pflanzen in einem langen Tage Zustand (z. B. leichte 18 h und 6 h dunkel) oder auch unter Dauerlicht. Aber wir solche Praktiken Ergebnis in weniger belastbar S. Parvula Pflanzen gefunden und führen zu einer niedrigen Transformationseffizienz.

Blütenknospen werden kontinuierlich auf den Blütenstand Achsen der S. Parvula (Abbildung 2, weiße Pfeile) produziert. Ermöglicht die Transformation der neuen Blumen würde die Chance auf positive Transformanten daher deutlich erhöhen. Ein zweiten floral-Dip (Schritt 5.3) ist nicht notwendig, aber dringend empfohlen. Allerdings ist dieser Schritt relativ zeitaufwendig im Vergleich zu A. Thaliana floral eintauchen, weil S. Parvula mehrere Blütenstand Achsen produziert.

Wildtyp S. Parvula ist empfindlich gegen BASTA, obwohl das Einstiegsbild positiven Transformanten mit BASTA-Spray (Schritt 6.3) 5 – 8 Überlebende Pflanzen aus 100 Samen gekeimte (Abbildung 3A und 3 b) verlassen wird. Die meisten davon (> 80 %) werden Fehlalarme. Dies ist weitgehend auf die schmale Blattform und die Blatt-Winkel von S. Parvula, die keine ausreichende Blattoberfläche in eine entsprechende Orientierung auf die BASTA-Lösung für eine ausreichende Dauer zu beobachten, einen Phänotyp zu behalten bieten. Darüber hinaus aufgrund der hohen Wachsanteil der adaxial Blattoberfläche von S. Parvula10tendenziell es mehr undurchlässige Oberfläche für BASTA zu schaffen. Daher ist das zweite Screening für positive Transformanten mit einem BASTA Tropfen auf einzelnen Blättern (Schritt 6.4, Abbildung 3C) ein wesentlicher Schritt zur PCR Tests an Hunderten von Fehlalarmen (Schritt 6.5) zu vermeiden.

Das aktuelle Protokoll wurde mit dem A. Tumefaciens Stamm GV3101 tragen das Plasmid pMP90RK getestet. Die Effizienz der Umwandlung kann verbessert werden, mit anderen A. Tumefaciens Stämmen, einschließlich Stämme ABI, LMG20 und C58C1 Rifr, mit dem pMP90 Virulenz Plasmid berichtet, Transformationseffizienz in A. Thaliana zu erhöhen 25. Brassica und Eutrema Arten sind taxonomisch mehr eng mit S. Parvula im Vergleich zu A. Thaliana1. A. Tumefaciens belasten daher LBA4404, die erfolgreich eingesetzt wurde, zu transformieren, Brassica Napus und die Belastung, die EHA105, die erfolgreich verwendet wurde, um Eutrema Salsugineum verwandeln eine höhere Umwandlung anbieten können Wirkungsgrad als die gemeldeten Effizienz der Sorte verwendet derzeit26,27,28.

Reduzieren den Zeit- und Arbeitsaufwand durch eine Transformation-Protokoll ist ein weiterer wichtiger Faktor bei der Verbesserung der Transformationseffizienz. Platzieren einzelne BASTA Tropfen auf den Blättern und Überwachung das Blatt für eine Woche auf mehreren Pflanzen (Schritt 6.4) sind langweilig. Eine zukünftige Anstrengungen zur Steigerung der Effizienz der Umwandlung könnten für entsprechende alternative auswählbare Markierung Gene29suchen.

Die Verfügbarkeit eines etablierten Transformation-Protokolls wird erheblich voraus unsere Fähigkeit zu identifizieren Gene und neuartige Mechanismen, mit die Extremophyte Modellpflanzen zu mehreren abiotischen Stress2,4überleben können. Neuartige genetischer Variation in S. Parvula bieten einen größeren Pool von genetische Variation, die aus der kollektiven allelische Variante als Stress-responsive Gene in das Modell relativ Stress-Sensitive, A. Thaliana abgebaut werden kann nicht Pan-Genom5,6. Daher wird unsere floral-Dip nach A. Tumefaciens Umwandlung Protokoll für S. Parvula entwickelt vermittelten eine Lücke für die Notwendigkeit solcher Werkzeuge in einem Extremophyte Modell eng mit A. funktionelle Genomik Experimente durchführen Thaliana.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Diese Arbeit wurde durch den National Science Foundation Award MCB 1616827 unterstützt.

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).
Pflanzen Sie Wachstum und Agrobakterium-vermittelten Floral-Dip Transformation des Extremophyte <em>Schrenkiella parvula</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).More

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter