Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

צמח צמיחה ושינוי בתיווך Agrobacterium פרחוני-מח ש של Extremophyte Schrenkiella parvula

doi: 10.3791/58544 Published: January 7, 2019

Summary

שינוי בתיווך Agrobacterium באמצעות שיטת פרחוני-מח ש יכול להיות מועסק בהצלחה כדי ליצור שורות הטרנסגניים יציב של המודל extremophyte Schrenkiella parvula. אנו מציגים פרוטוקול שונה מזו עבור תודרנית לבנה, בהתחשב גידול שונים והרגלי הפיזיולוגיות של extremophyte.

Abstract

Schrenkiella parvula הוא extremophyte הותאם מושם והאביוטיים שונים, כולל לחצים רעילות יון מרובים. למרות באיכות גבוהה גנומית המשאבים הזמינים כדי ללמוד איך הצמחים להתאים הסביבה מדגיש, ערכו כמודל גנומיקה תפקודית, כלי הגביל היעדרה של מערכת שינוי ריאלי. ב פרוטוקול זה, אנחנו לדווח על איך ליצור יציבה הטרנסגניים ס parvula קווים באמצעות שיטת פרחוני-מח ש בתיווך Agrobacterium. לשנות את פרוטוקול טרנספורמציה המשמש לבנה א עבור התכונות הייחודיות של S. parvula, כגון של הרגל פריחה ייווצרו ותוכן שעווה epicuticular גבוהה על עלים. בקצרה, ס parvula זרעים היו מרובדת ב 4 מעלות צלזיוס למשך חמישה ימים לפני השתילה. הצמחים גדלו ב- photoperiod אור 14 h ואת כהה 10שע 130 µmol מ'-2s-1 עוצמת אור, ב- 22 ° C עד 24 ° C. 8-9 צמחים בת שבוע עם התפרחות מרובות נבחרו לשינוי. התפרחות אלה היו טבולים ב פתרון חדירה של Agrobacterium tumefaciens GV3101, נושאת את פלסמיד pMP90RK . ביצענו שני סיבובים של פרח טובלים במרווח של 3-4 שבועות כדי להגביר את היעילות טרנספורמציה. הזרעים T1 היו נאספים, יבשים במשך ארבעה שבועות במיכל עם desiccants לפני הנביטה עבור המועמד מסך טרנספורמציה קווים. התנגדות באסטה שימש למסך T1 צמחים. ריססנו את הפתרון באסטה שלוש פעמים במרווח של שלושה ימים, החל מ- שני צמחים בת שבוע כדי לצמצם את תוצאות חיוביות שגויות. מבחן טיפה באסטה בוצעה ב ששרדו צמחים בודדים כדי לזהות נכון transformants חיובי. היעילות השינוי היה 0.033%, מניב 3-4 הצמחים הטרנסגניים לכל 10,000 זרעים T1 מופצות.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ב פרוטוקול זה, אנו מתארים את הצמיחה ואת הקמת קווי הטרנסגניים יציבה עבור דגם extremophyte Schrenkiella parvula. הזמינות של מערכת יעילה השינוי מהווה סימן היכר של כל דגם גנטי רב תכליתי. צמחים לשגשג בסביבות קיצוניות, התייחס כמו extremophytes, לספק משאב קריטי להבנת צמח עיבודים מושם סביבתיים. Schrenkiella parvula (לשעבר Thellungiella parvula , Eutrema parvulum) הוא אחד דגם extremophyte כזה, עם הרחבת משאבי גנומית1,2,3,4,5. עם זאת, השינוי פרוטוקולים לא עדיין דווחו עבור ס parvula במחקרים שפורסמו.

הגנום של parvula ס הוא הגנום extremophyte שפורסמו הראשון ב מצליבים (חרדל-כרוב משפחה) ומראה של synteny גנום הכוללת נרחב עם המודל הלא-extremophyte, תודרנית לבנה1. לכן, מחקרים השוואתיים בין לבנה א ס parvula יכול להפיק תועלת העושר של מחקרים גנטיים מתבצע על לבנה א לעשות השערות אינפורמטיבי על איך הגנום S. parvula יש התפתחו ומוסדרת אחרת להתמודד עם קיצוני סביבתי מדגיש5,6,7. ס parvula היא אחת ביותר מלח-סובלנית מינים (מבוסס על אדמת NaCl LD50) בין קרובי משפחה פראי ידועה של לבנה א8. בנוסף הסובלנות NaCl, ס parvula שורד, משלים את מחזור החיים שלו בנוכחות יונים מרובים מלח בריכוזים גבוהים רעיל צמחים רוב7. בתגובה הלחצים והאביוטיים שכיחה בבית גידולו הטבעי, זה התפתח תכונות שונות, ביניהם כמה נחקרו ביוכימית או פיזיולוגיים רמה 8,9,10, 11.

מאז 2010, היו מעל 400 פרסומים עמיתים-reveiwed ס parvula כמין היעד או השתמש בה השוואה עם הגנום צמחים אחרים. עם זאת, צוואר בקבוק ברור יכול להיות מזוהה עם מבט מקרוב של איזה סוג של מחקרים נערכו. הרוב המכריע של דוחות אלה לדבר על פוטנציאל השימוש parvula ס במחקרים עתידיים או להשתמש בו השוואתי גנומית או לימודים phylogenomic. בגלל העדר פרוטוקול הוכחה הרעיון טרנספורמציה הוקמה עבור S. parvula, זה לא נעשה שימוש במחקרים גנומית פונקציונלי, למרות שיש לאחד הגנומים הצמח באיכות הגבוהה ביותר זמין עד כה (> 5 מגהבייט contig N50) התאספו ו מבואר pseudomolecules ברמת כרומוזום1.

השיטה בתיווך Agrobacterium טרנספורמציה פרחוני-מח ש הפך השיטה באופן כללי ביותר בשימוש כדי ליצור קווים trasngenic לבנה א, הפיתוח של מערכת לשחזור של השינוי היה גורם קריטי להצלחתו בתור מודל גנטי12,13. עם זאת, לא כל המינים מצליבים הוכחו להיהפך בהצלחה באמצעות השיטה פרחוני-מח ש שפותחו עבור לבנה א. . במיוחד, המין השני לשושלת מצליבים הכוללים parvula ס כבר הסרבן פרחוני-מח ש טרנספורמציה המבוססת על שיטות14,15.

ההרגל צמיחה פריחה ייווצרו ס parvula, בשילוב עם מורפולוגיה עלים צרים שלה עשה את זה מאתגר לאמץ את השיטה טרנספורמציה פרחוני-מח ש בתיווך Agrobacterium רגיל. במחקר זה, אנו מדווחים על פרוטוקול ששונה שפיתחנו לשינוי לשחזור ס parvula.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. צימוח

  1. עיקור זרע (אופציונלי)
    1. להכין 50% מלבין מזוקק פעמיים מים (ddH2O) עם 1 או 2 טיפות של חומר ניקוי ללא יונית (ראה טבלה של חומרים) צינור 50 מ ל. היפוך ברכבת התחתית מספר פעמים כדי לערבב את הפתרון.
      הערה: עדיף לבצע עיקור זרע בזרימה שכבתית ארון עם משטח סטיריליים UV למשך 15 דקות.
    2. להוסיף את הפתרון אקונומיקה ~ 100-200 ס parvula זרעים צינור 1.5 מ ל. לערבב היטב ולתת את הצינור לשבת במשך 5 דקות.
    3. להסיר את המלבין הצינור ולהוסיף 70% אתנול. לשטוף את הזרעים על-ידי pipetting מספר פעמים ולאחר מכן להסיר מיד את הפתרון אתנול.
    4. לשטוף את הזרעים במים סטיריליים כדי להסיר עודפי אקונומיקה ואתנול, ולאחר מכן הסר את המים. חזור על השלב 5 עד 6 פעמים.
  2. ריבוד זרע
    1. לטבול את הזרעים במים מעוקר, ולאחסן במשך 5 עד 7 ימים ב- 4 מעלות צלזיוס. לחלופין, לזרוע זרעים יבשים לא מחוטאים ישירות על קרקע רטובה, ולמקם את המגש אדמה במשך 5 עד 7 ימים ב- 4 מעלות צלזיוס.
  3. גידול צמחים בהכנה של טרנספורמציה
    1. מילוי האדמה לערבב (ראה טבלה של חומרים) לתוך 7 x 6 ס מ2 סירים, להשרות את הסירים במים, לרסס מים מלמעלה כדי להבטיח מדיום הגידול רטוב בצורה אחידה. להוסיף 5-דשן חרוזים (ראה טבלה של חומרים) על פני אדמת כל סיר.
      הערה: ככל שאנו חווים, ס parvula גדל היטב על כל תערובת אדמה היכן לבנה א יכול לגדול.
    2. באמצעות קיסם רטוב, להעביר 20 ~ 25 זרעים לכל סיר על פני האדמה.
      הערה: שיטה נוחה היא לשים אצווה של 4 – 5 זרעים ארבע הפינות ומרכז של הסיר (איור 1, 15 יום, החלונית השמאלית).
    3. מכסים את המגש סיר עם כיפה ברורה כדי לשמור את הזרעים תחת לחות גבוהה במהלך הנביטה.
    4. לשמור את המגשים צמח בתוך תא הצמיחה עוצמת האור שוכן בגובה 130 µmol מ'−2 s− 1 אור, טמפרטורה 22 – 24 ° C ו h 14 לכל יום/10 h המחזור הלילה. הסר את הכיפות לאחר 7-10 ימים לאחר נביטה. מוסיפים מים בתחתית המגש לשמור על אדמת לחלח אחיד ברמה רצויה.
    5. לנכש שתילים נוספים ולהשאיר רק 4 – 5 שתילים בריאים לכל סיר טוב מופרדים זה מזה (איור 1, 15 יום, לוח נכון).
    6. בעדינות להשקות את הצמחים בכל יומיים, לדשן עם 0.2 x של הוגלנד פתרון16 פעם בשבועיים.
      הערה: שמירה על לחות הקרקע ברמה אחידה היא המפתח גדל parvula ס הפירסומים ובעקביות.
    7. להמשיך לגדל את הצמחים במשך 8-10 שבועות עד התפרחות מרובות לייצר 100 – 150 ניצנים פרחוני לכל צמח (איור 1, יום 60 – 80). ביום המתוכנן הטרנספורמציה מבוסס פרחוני-מח ש (שלב 4.5), הסר siliques בוגרת ומתפתחות כל הצמחים.

2. שיבוט רכיב גנטי/גנומית עניין לתוך וקטור לשינוי צמח

  1. להגביר את מקטע DNA היעד באמצעות פולימראז תגובת שרשרת (PCR)17 , המבודד מוצר ה-PCR באמצעות מיצוי של ג'ל קיט (ראה טבלה של חומרים) על פי פרוטוקול הערכה או כל שיטה אחרת המתאימה לטהר את הדנ א באמצעות agarose ג'ל אלקטרופורזה17,18. ודא את הרצף של המוצר PCR מבודד עד סנגר רצף19.
  2. שיבוט המוצר PCR הרצוי לתוך השיבוט וקטור והמרה הבונה משובטים לתוך המוסמכים e. coli תאים באמצעות שיבוט מבוסס טופואיזומראז קיט (ראה טבלה של חומרים) בעקבות הנחיות היצרן.
  3. להפיץ את µL 50 מוצרים טרנספורמציה במדיה לוריא-Bertani20 (LB) אגר התפתחות חיידקים (טבלה 1) עם אנטיביוטיקה מתאימה, למשל., 50 µg / mL Spectinomycin (ראה טבלה של חומרים), דגירה על 37 ° C בין לילה.
  4. למחרת, בחר מושבות יחידה 5 – 10, לחסן לתוך נוזלי בינוני ליברות עם אנטיביוטיקה מתאימה ולאחר דגירה ייבוש עדין ב 37 מעלות צלזיוס למשך הלילה.
  5. פלסמידים ולבודד באמצעות בידוד פלסמיד קיט (ראה טבלה של חומרים) וודא דרך רצף סנגר19 אם הרצף היעד מוגבר ב- 2.1 כראוי שוכפל.
  6. להעביר את המוצר PCR משובטים ומאומת על וקטור היעד של הצמח השינוי תואם המבוסס על רקומבינציה שיבוט (ראה טבלה של חומרים), באמצעות שילוב של אנזים recombinase קיט להלן (ראה טבלה של חומרים), ההדרכה היצרן ערכת. חזור מ שלב 2.3 לשלב 2.5 כדי לבודד ולוודא שיבוטים מחסה תקין פלסמיד בונה.

3. להפוך את וקטור לבנות לשינוי צמח Agrobacterium tumefaciens

  1. להפוך את פלסמיד של הבונה וקטור מ- 2.6 המתח tumefaciens א GV3101:pMP90RK21, אשר בנמלים גן עמידות ריפאמפיצין לבחירת רקע כרומוזומלית. להשתמש באנטיביוטיקה המתאימה, למשל Gentamycin או Kanamycin (ראה טבלה של חומרים), עבור הבחירה של צמח טרנספורמציה לבנות (פלסמיד Ti). פרוטוקול קצר לשינוי tumefaciens א ויה אלקטרופורציה כלולה בסעיף 3.2.
  2. Tumefaciens א שינוי על ידי אלקטרופורציה
    1. הפשרת המוסמכת תאים tumefaciens א 22 על קרח. מיקס 0.1 – 1 µg של פלסמיד שהוכנו 2.6, מומס 1 – 2 µL של ddH2O, עם תאים המוסמכת על קרח. להעביר את התערובת לתוך cuvette אלקטרופורציה (ראה טבלה של חומרים).
    2. לבצע אלקטרופורציה על התערובת של פלסמידים ותאים המוסמכת מ 3.2.1, באמצעות electroporator (ראה טבלה של חומרים) בעקבות הנחיות היצרן.
      הערה: לנקות את השטח של cuvette לפני שמתחילים את אלקטרופורציה.
    3. להעביר את התערובת התגובה cuvette צינור microcentrifuge המכיל 1.5 מ ל LB נוזל מערבבים היטב עם pipetting, תקופת דגירה של h 1 ב 28 ° C עם טלטול עדין.
  3. לחסן את טרנספורמציה tumefaciens א מ סעיף 3.2 על צלחות LB אנטיביוטיקה הבחירה המתאימה (למשל Kanamycin 25 µg / מל, Spectinomycin 50 µg / mL, Gentamycin 25 µg / mL, ו- 50 ריפאמפיצין µg / mL) דגירה -28 מעלות צלזיוס למשך 3 ימים.

4. Agrobacterium בתיווך טרנספורמציה של parvula ס

  1. לחסן את הסינגל הפך מושבות של צלחות לתוך 10 מ ל LB המדיה נוזלית המכילה אנטיביוטיקה (כמו 3.3) ב סטרילי 50 מל חרוט צינור (ראה טבלה של חומרים). תקופת דגירה של 24 ש ח בחודש חממה חזק (ראה טבלה של חומרים) ב 250 r.p.m. ב 28 º C.
  2. להעביר את הפתרון חיידקי 3.4.1 בקבוקון סטרילי 250 מ ל, להוסיף 40 מ"ל של מדיה נוזלי ליברות עם אנטיביוטיקה מתאימה, דגירה 12 שעות עד הצפיפות האופטית-גל nm 600 (OD600) מגיע בסביבות 2.0.
  3. Centrifuge tumefaciens א cultureat 3,100 x g עבור 10 דקות להסיר את תגובת שיקוע, מחדש להשעות את התרבות חיידקי ב- 40 מ"ל של פתרון חדירה tumefaciens א (טבלה 1).
  4. לדלל את resuspended tumefaciens א עם חדירה לפתרון יתר סופית600 של 0.8. להוסיף 25 µL של חומרים פעילי שטח פתרון (טבלה 1) ל- 50 מ של מדולל tumefaciens א פתרון ומיקס על ידי היפוך מספר פעמים.
  5. טובלים את פריחת הצמחים הפתרון tumefaciens א מוכן בסעיף 4.4 לשימוש ס' 20 פתרון חיידקי טריים לאחר טבילה תפרחת של שישה סירים. ודא כי כל הפרחים נמצאים בקשר עם הפתרון. Pipet פתרונות חיידקי ישירות על גבי פרחים הממוקמת בחלק התחתון של התפרחת, אם הם לא יכולים להיות הטבלתי את הפתרון.
    הערה: לשינוי בסיבוב הראשון, הקפד להסיר את כל siliques בוגרת ומתפתחות באמצעות סכין חדה או מספריים קטנות. אל תסיר siliques אם מבצע טרנספורמציה בפעם השנייה.

5. פוסט-טרנספורמציה צמח והטיפול הטרנספורמציה השניה

  1. הנח את הצמחים פרחוני טבול אופקית במגשים נקי עם כיפות כדי לכסות את הצמחים מקום בחדר חשוך צמיחה 1 – 2 ימים.
    הערה: שמירה הפרחים תחת לחה חשוב בשלב זה (איור 1, צמחים אחרי השינוי).
  2. הצמחים לחזור למצב מאוזן ולהעביר את הצמחים חדר צמיחה עם ה 14 לכל יום/10 שעה לכל מחזור לילה, 130 µmol-2 m s-1 עוצמת אור וטמפרטורה 22 עד 24 ° C.
  3. נטר התפרחות טבל בשבוע הבא. אם מספר משמעותי של פרחים בטל (איור 2), חזור על טבילה פרחוני (שלב 4) לאחר כ- 4 שבועות או לאחר מספר רב של פרחים פיתחו לאחרונה.
    הערה: בניגוד השלב הכנה של השינוי הראשון (שלב 1.3.7), אל תסיר הקיימים מראש או לפתח siliques (איור 2) לפני הסיבוב השני של טרנספורמציה.
  4. לגדל את הצמחים עד זרעים בוגר, הקציר זרעים ב ~ 21 שבועות.
  5. זרעים יבשים במשך 2-3 שבועות בטמפרטורת החדר בכלי אטום לאוויר עם מלא desiccants (ראה טבלה של חומרים).

6. בחירת Transformants חיובית

  1. לשתול את הזרעים T1 כמתואר על זרעים פראי סוג שלבים 1.2-1.3.
  2. לגדל את הצמחים עד לפתח העלים האמיתי הראשון 2, כ- 10-14 ימים לאחר נביטה.
  3. לבצע את הבחירה הראשונה להתנגדות קוטל עשבים (איור 3A ו- 3B) כפי שיפורט להלן.
    1. לדלל את glufosinate-אמוניום (11.3%) קוטל עשבים (או בסטה) (טבלה 1) כדי 1:1,000 (וי/v). תרסיס פתרון באסטה מדולל על השתילים, לכסות את הצמחים עם כיפות בן לילה.
    2. חזור על באסטה ריסוס 2 – 3 פעמים כל 5-7 ימים.
  4. לבצע את הבחירה השניה באמצעות מבחן באסטה-שחרור כפי שיפורט להלן.
    1. זיהוי צמחים לשרוד לאחר להיות ריסס 3 – 4 פעמים עם פתרון באסטה. לגדל את הצמחים עוד 2-3 שבועות עד 3-5 עלים לפתח פני שטח גדול יחסית.
    2. לבחור הגדול העלה בוגרת לכל צמח, לשפשף את פני השטח של העלה בעדינות עם האצבע כדי להסיר את שכבת שעווה, ומניחים על טיפה של הפתרון באסטה מדולל (מתוך שלב 6.3.1).
      הערה: סמן את המיקום של העלה להחיל עם הירידה באסטה על-ידי הצבת קלטת נייר על הגבעול הקרוב.
    3. לפקח על העלים להחיל עם הירידה באסטה סימנים של כמישה עד לשבוע אחד. בחר את הצמחים עם עלים מושפע הטיפות באסטה.
      הערה: עלים מצמחים הכי חיובי-false מתחיל לקמול בתוך יומיים, בעוד עלים של אמת-תוצאות חיוביות שלמים גם לאחר הירידה של באסטה פתרון מתייבש (איור 3C).
  5. אשר transformants חיובי באמצעות PCR גנומית.
    1. לאסוף 2-3 עלים של הצמחים לשרוד בשלב 6.4.5.
    2. תמצית דנ א גנומי מן העלים באמצעות שיטת CTAB23 או כל המתאים DNA החילוץ שיטה אחרת.
    3. לבצע PCR באמצעות חילוץ גנומית דגימות דנ א צמחים יעד פראי-סוג צמחים (כפקדי שלילי), הבונה פלסמיד מהשלב 3.1 (כמו פקד חיובי). להשתמש בזוג המתאים של PCR תחל ספיציפית הגן סמן סלקטיבית, למשל, עבור עמידים באסטה ג'ין (בר), TCAGCAGGTGGGTGTAGA (קדימה), GTCAACCACTACATCGAGACAA (הפוכה).
      1. עבור תחל ה-PCR דוגמה מיקוד הגן בר , השתמש התנאים PCR הבאים: השלב הראשוני דנטורציה ב 98 ° C ל 30 s; ואחריו 30 מחזורים של denaturing ב 98 ° C ל 30 s, חישול ב 59 ° C ל 30 s, והארכת ב-72 מעלות ל 30 s; והסיומת הסופי ב-72 מעלות במשך 5 דקות.
        הערה: כדי להבטיח החדרת T-DNA כולו, מומלץ גם ביצוע PCR גנומית באמצעות פריימר PCR מן הגן סמן סלקטיבית, פריימר PCR אחר ספציפי רצף המטרה משוכפלות הווקטור טרנספורמציה צמח בשלב
    4. לאשר הנוכחות של הגודל הצפוי של המוצר PCR מוגבר בר agarose ג'ל אלקטרופורזה17 על הדגימות היעד (איור 4א) כמו גם על-ידי קביעת רצף באמצעות19 של מוצר ה-PCR מבודד ההליך כמו שלב 2.1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

פיתחנו פרוטוקול טרנספורמציה המאפשרת קציר של T0 זרעים בתוך 150 ימים, באמצעות שיטה פרחוני-מח ש שונה מזו עבור לבנה א. איור 1 מציג סיכום של ציר זמן, ס parvula צמחים המייצגים את הבמה אופטימלית עבור ביצוע השינוי דרך פרחוני-מח ש. בחרנו ס parvula צמחים עם פרחים 70 –80 בתפרחות מרובים ב- 60-80 ימים לאחר נביטה כמו השלב היעד לשינוי. מספר קטן של פרחים פתוחים או מופרית קיימים siliques בשלב זה הוסרו לפני החדירה של tumefaciens א בשיטה פרחוני-מח ש. זיהום עם tumefaciens א הביא הפלה של פרחים (איור 2, סוגר (א)). Siliques מפותחים במלואם לאחר טבילה-פרחוני עשוי להכיל טרנספורמציה זרעים (איור 2, סוגר (b)). גם לאחר השינוי, ס parvula המשיך לפתח את התפרחות חדשים ופרחים ככל הצמחים הוחזקו בריא (איור 2, החצים הלבנים). עקב הרגל פריחה לא מוגדר, סיבוב שני של השינוי יכול להתבצע אם הצמח לא מראים סימנים של מתח או הזדקנות ביולוגית. איור 2 A ו- 2B להציג דוגמאות של צמחים parvula ס לאחר הסיבוב הראשון והשני של טרנספורמציה, בהתאמה, 25 ימים אחד מהשני. ב השינוי השני, siliques הקיימת אין להסירו כי הם עשויים להכיל הטרנסגניים זרעים. כמו כן, tumefaciens א יכולים להחיל pipetting הפתרון חדירה (טבלה 1) על גבי החדשים המתעוררים אשכולות פרחים, במקום חיטט הצילומים כל הפתרון, כדי למזער את הנזק כדי siliques מהרגע הראשון טרנספורמציה.

היעילות טרנספורמציה היא 0.033%, מניב 3-4 הצמחים הטרנסגניים לכל 10,000 זרעים T1 מופצות באמצעות פרוטוקול הנוכחי. הערכה זו מבוססת על ~ 50,000 T1 זרעים נבדק במהלך עשרה ניסיונות שינוי עצמאית. בעוד היעילות הוא נמוך יותר מזה של תודרנית לבנה, זה להשוות את הטרנספורמציה של עוד extremophyte צמח Eutrema salsugenium24 וחלק תודרנית לבנה ecotypes25. היעילות טרנספורמציה נוספת ניתן למטב באמצעות זנים Agrobacterium חלופי והשינויים של חומרים פעילי שטח ופתרונות הסתננות. הבאסטה מספר בדיקות ספריי ושחרור (שלבים 6.3 ו- 6.4) יהיה קריטי כדי לזהות transformants חיובי נכון להפחית את מספר הדגימות שנבדקו באמצעות אישור PCR בשלב 6.5 (איור 4א). אישור נוסף של השינוי ניתן לבדוק עם ביטוי גנים כתב, אם הרצף משובטים כוללת גן כתב (איור 4B).

Figure 1
איור 1 : ציר הזמן הטרנספורמציה S. parvula . אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: S. parvula צמחים לאחר השינוי לפי פרחוניות-dip. הצמחים היו המצולם 10 ימים לאחר הראשון פרחוני לטבול יום 60 (א) ו- 25 ימים אחרי השני סבב פרחוני-מח ש- 85 היום (ב'). חדירה עם Agrobacterium , ייתכן בטל פיתוח silique של פרחים כפי שמוצג מרובעים . Siliques מפותחים במלואם לאחר פרחוני-מח ש הם נוטים להכיל טרנספורמציה זרעים (מרובעים b). חיצים לבנים מציינים התפרחות ופרחים שזה עתה הגיח לאחר כל שינוי. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3 : מבחר transformants ס parvula מבוסס על התנגדות באסטה. (א) T1 שתילים לפני הריסוס באסטה. (B) עיגול אדום מציין transformant של המועמד ששרדו את הבחירה בסיבוב הראשון על ידי התרסיס באסטה. (ג) הבחירה הסיבוב השני על ידי באסטה טיפה הבדיקה. דוגמה של תוצאות חיוביות שגויות (החלונית העליונה) וצמחים מהונדס נכון (החלונית התחתונה) מוצגים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4 : אישור הטרנספורמציה S. parvula . (א) PCR הגברה של בר ג'ין מ גנומית DNAs מופק מצמחים ס parvula . ליין 1 ו- 13: גודל סמני; ליין 2: שליטה שלילי; ליין 3-5: פראי-סוג parvula ס ; ליין 6-10: הטרנסגניים ס parvula מועמדים; ליין 11, 12: וקטור שליטה. מסלולים 7, 8 ו 9 להדגים transformants חיובי. (B) דוגמה גאס כתב גנים ב חיובי parvula ס transformant. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

מדיה / פתרון מגיב כמות
מדיה התפתחות חיידקים לוריא-Bertani (ליברות) NaCl
טריפטון
תמצית שמרים
אגר (עבור לוחות)
ddH2O
10 גרם
10 גרם
5 g
20 גרם
955 mL
פתרון חדירה Agrobacterium MS מלח (1/4 x)
B5 ויטמינים (1 x)
סוכרוז (5%w/v)
MES
N6- benzylaminopurine (BA)
Silwet L-77 (0.05%v/v)
ה-pH
2.16 גרם
1 מ"ל
50 גרם
0.5 ג'י
10 ΜL
500 ΜL
5.7

טבלה 1: הרכב של התפתחות חיידקים מדיה ו- Agrobacterium פתרון הסתננות.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

מצב פיזיולוגי של הצמח משפיע באופן משמעותי את היעילות של טרנספורמציה25. שימוש בצמחים בריא וחסון לשינוי היא דרישה מרכזית לשינוי מוצלח ב ס parvula. מים או צמחים הדגיש האור יהיה פחות פרחים לעומת הצמחים בריא אידיאלי עבור טרנספורמציה (איור 1, במרכז החלונית). Parvula ס יכול לגדול על עוצמת האור פחות מ-130 µmol m s-2 -1, אבל הצמחים נוטים להיות frailer; צמחים כאלו יוביל יותר בוטלה פרחים בעקבות פרחוני-מח ש. ס parvula נוטה לבטל טבול Agrobacterium פרחים בקצב גבוה יותר מאשר לבנה א. לכן, כל צעד שנעשה כדי למזער פרחים מופלים כאשר טבול הפתרון חדירה tumefaciens א תורמת ליעילות גבוהה יותר שינוי. אנו ממליצים על תקופה קלה יותר מאשר h 14 לכל יום. לעתים קרובות, טרנספורמציה של לבנה א מתבצע על הצמחים הגדלים בתנאי יום ארוך (למשל אור 18 h ו- 6-אייץ ' כהה) או אפילו תחת תאורה רציפה. עם זאת, אנו למצוא כזה התוצאה פרקטיקות צמחים parvula ס פחות גמיש, להוביל יעילות נמוכה טרנספורמציה.

ניצני פרחים מיוצרים באופן רציף על הצירים תפרחת של ס' parvula (איור 2, החצים הלבנים). לכן, המאפשר טרנספורמציה של פרחים חדשים להגדיל באופן משמעותי את הסיכוי ללקות transformants חיובי. השני פרחוני-טבילה (שלב 5.3) אינו חיוני, אך בתוקף המוצע. עם זאת, השלב זה יחסית זמן רב בהשוואה לבנה א טובלים פרחוני, כי ס parvula מייצרת מספר צירים תפרחת.

פראי-סוג parvula ס אמנם רגיש באסטה, המסך הראשוני של transformants חיובי עם תרסיס בסטה (שלב 6.3) יעזבו 5 – 8 צמחים ששרד מתוך 100 זרעים מונבטים (איור 3א ו- 3B). רוב זה (> 80%) יהיו תוצאות חיוביות שגויות. זאת בעיקר בשל צורת העלים צרים ואת זווית עלה ס parvula, אשר לא מספקים מספיק משטח עלה באוריינטציה המתאים כדי לשמור את הפתרון באסטה עבור משך זמן מספיק להתבונן פנוטיפ. בנוסף, בשל התכנים שעווה גבוהה של פני העלים adaxial parvula ס'10, הוא נוטה ליצור משטח חסין יותר עבור באסטה. לכן, ההקרנה השנייה עבור חיובי transformants באמצעות טיפה באסטה על עלים בודדים (שלב 6.4, איור 3ג') היא צעד חיוני כדי למנוע PCR בדיקות על מאות תוצאות חיוביות שגויות (שלב 6.5).

בפרוטוקול הנוכחי נבחנה עם המתח tumefaciens א GV3101 נושאת את פלסמיד pMP90RK . שיפור היעילות של טרנספורמציה עם זנים אחרים tumefaciens א , כולל זנים ABI, LMG20, C58C1 Rifr, עם פלסמיד התקפה אלימה pMP90 דווח כדי להגדיל את יעילות טרנספורמציה לבנה א 25. כרוב מינים Eutrema taxonomically יותר קשורה קשר הדוק ס' parvula בהשוואה לבנה א1. לכן, tumefaciens א זן LBA4404 ששימש בהצלחה להפוך כרוב napus ואת המתח EHA105 אשר שימש בהצלחה להפוך Eutrema salsugineum עשויות להציע שינוי גבוה יותר יעילות יותר יעילות דווח על המתח כעת בשימוש26,27,28.

להפחית את הזמן ואת העבודה הנדרש על-ידי פרוטוקול טרנספורמציה היא גורם משמעותי נוסף בשיפור היעילות טרנספורמציה. הצבת טיפות בודדות של באסטה על עלים וניטור העלה במשך שבוע על מספר צמחים (שלב 6.4) הם מייגע. מאמץ בעתיד כדי להגביר את היעילות השינוי יכול לחפש הגנים המתאימים סמן לבחירה חלופי29.

הזמינות של פרוטוקול טרנספורמציה הוקמה יתקדמו באופן משמעותי היכולת שלנו לזהות גנים ומנגנונים חדשניים המאפשרים extremophyte צמחים דגם לשרוד והאביוטיים מדגיש מספר2,4. הרומן וריאציה גנטית parvula ס יספק מאגר רחב של וריאציה גנטית זה לא יכול להיות הנכרה וריאציית allelic הקולקטיבי מזוהה הגנים לחץ מגיבים במודל יחסית רגיש ללחץ, לבנה א פאן-הגנום5,6. לכן, שלנו פרחוני-מטבל לפי האות tumefaciens מתווכת טרנספורמציה פרוטוקול שפותח עבור parvula ס ימלא פער הצורך כלים כאלה ביצוע ניסויים גנומית פונקציונלי במודל extremophyte קשורה קשר הדוק א לבנה.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

עבודה זו נתמכה על ידי פרס הלאומית למדע MCB 1616827.

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).
צמח צמיחה ושינוי בתיווך Agrobacterium פרחוני-מח ש של Extremophyte <em>Schrenkiella parvula</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).More

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter