Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

संयंत्र विकास और एग्रोबेक्टीरियम-Extremophyte Schrenkiella parvula की मध्यस्थता पुष्प डुबकी परिवर्तन

doi: 10.3791/58544 Published: January 7, 2019

Summary

एग्रोबेक्टीरियम-मध्यस्थता परिवर्तन एक पुष्प डुबकी विधि का उपयोग सफलतापूर्वक extremophyte मॉडल Schrenkiella parvulaके स्थिर ट्रांसजेनिक लाइनों बनाने के लिए नियोजित किया जा सकता है । हम एक Arabidopsis थालियानाके लिए है कि से संशोधित प्रोटोकॉल मौजूद, विभिंन विकास की आदतों और extremophyte की शारीरिक विशेषताओं पर विचार ।

Abstract

Schrenkiella parvula एक extremophyte विभिंन अजैव तनाव के लिए अनुकूलित है, कई आयन विषाक्तता तनाव सहित । उच्च गुणवत्ता जीनोमिक के बावजूद अध्ययन के लिए उपलब्ध संसाधनों कैसे पौधों पर्यावरण तनाव के लिए अनुकूल है, एक कार्यात्मक जीनोमिक्स मॉडल और उपकरण के रूप में अपने मूल्य एक व्यवहार्य परिवर्तन प्रणाली की कमी से सीमित कर दिया गया है । इस प्रोटोकॉल में, हम कैसे स्थिर ट्रांसजेनिक एस parvula लाइनों उत्पंन करने के लिए एक एग्रोबेक्टीरियम मध्यस्थता पुष्प डुबकी विधि का उपयोग कर रिपोर्ट । हम इस तरह के एक अस्पष्ट फूल की आदत और पत्तियों पर एक उच्च epicuticular मोम सामग्री के रूप में एस parvula, के अद्वितीय लक्षण के लिए खाते के लिए एक. थालियाना के लिए इस्तेमाल किया परिवर्तन प्रोटोकॉल संशोधित । संक्षेप में, एस parvula बीज रोपण से पहले पांच दिनों के लिए 4 डिग्री सेल्सियस पर स्तरीकृत थे । पौधों एक 14 एच प्रकाश और 10 एच अंधेरे और एक १३० µmol एम-2एस-1 प्रकाश की तीव्रता, 22 डिग्री सेल्सियस से 24 डिग्री सेल्सियस पर के एक photoperiod में बड़े हो गए थे । आठ से नौ सप्ताह के कई फूलना के साथ पुराने पौधों को परिवर्तन के लिए चुना गया । इन फूलना एग्रोबेक्टीरियम tumefaciens GV3101 pMP90RK प्लाज्मिड ले जाने के एक घुसपैठ समाधान में डूबा हुआ था । हम परिवर्तन दक्षता बढ़ाने के लिए तीन से चार सप्ताह के अंतराल के साथ फूल सूई के दो दौर प्रदर्शन किया । T1 बीज एकत्र किए गए थे और एक कंटेनर में चार सप्ताह के लिए अंकुरण से पहले desiccants के लिए स्क्रीन करने के लिए उंमीदवार बदल लाइनों के लिए सूख गया । बसटा के लिए प्रतिरोध T1 संयंत्रों स्क्रीन करने के लिए इस्तेमाल किया गया था. हम तीन बार दो सप्ताह पुराने पौधों पर शुरू करने के लिए झूठी सकारात्मक कम करने के लिए तीन दिनों के अंतराल के साथ बसटा समाधान छिड़काव किया । एक बसटा ड्रॉप परीक्षण व्यक्तिगत पौधों जीवित रहने पर प्रदर्शन किया गया था सच सकारात्मक transformants की पहचान । परिवर्तन दक्षता ०.०३३% थी, 3-4 ट्रांसजेनिक संयंत्रों प्रति १०,००० T1 बीज प्रचारित उपज ।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

इस प्रोटोकॉल में, हम विकास और extremophyte मॉडल Schrenkiella parvulaके लिए स्थिर ट्रांसजेनिक लाइनों की स्थापना का वर्णन । एक कुशल परिवर्तन प्रणाली की उपलब्धता किसी भी बहुमुखी आनुवंशिक मॉडल की एक बानगी है । पौधों है कि चरम वातावरण में पनपे, extremophytes के रूप में भेजा, पर्यावरण तनाव को समझने के संयंत्र रूपांतरों के लिए एक महत्वपूर्ण संसाधन प्रदान करते हैं । Schrenkiella parvula (पूर्व Thellungiella parvula और Eutrema parvulum) एक ऐसे extremophyte मॉडल है, जीनोमिक संसाधनों के विस्तार के साथ1,2,3,4,5। हालांकि, परिवर्तन प्रोटोकॉल अभी तक प्रकाशित अध्ययनों में S. parvula के लिए रिपोर्ट नहीं किया गया है ।

एस parvula का जीनोम Brassicaceae में पहली बार प्रकाशित extremophyte जीनोम (सरसों गोभी परिवार) है और गैर extremophyte मॉडल, Arabidopsis थालियाना1के साथ एक व्यापक समग्र जीनोम synteny से पता चलता है । इस प्रकार, ए. थालियाना और एस parvula के बीच तुलनात्मक अध्ययन आनुवंशिक अध्ययन के धन से लाभ सकता है एक. थालियाना पर प्रदर्शन के लिए कैसे एस parvula जीनोम विकसित और विनियमित है पर जानकारीपूर्ण परिकल्पना करना अलग चरम पर्यावरण तनाव के साथ सामना करने के लिए5,6,7एस parvula सबसे अधिक नमक सहिष्णु प्रजातियों में से एक है (मिट्टी NaCl LD50 के आधार पर) एक. थालियाना8के ज्ञात जंगली रिश्तेदारों के बीच । NaCl सहिष्णुता के अलावा, एस parvula बचता है और उच्च सबसे अधिक पौधों7को विषाक्त सांद्रता पर एकाधिक नमक आयनों की उपस्थिति में अपने जीवन चक्र पूरा करती है । अजैव अपने प्राकृतिक निवास स्थान में प्रचलित तनाव के जवाब में, यह विभिंन लक्षण है, जो बीच में कई जैव रासायनिक या शारीरिक स्तर 8,9,10में अध्ययन किया गया है विकसित की है, 11.

२०१० के बाद से, वहां ४०० सहकर्मी-reveiwed प्रकाशनों पर किया गया है कि एक लक्ष्य प्रजातियों के रूप में प्रयुक्त एस parvula या अंय संयंत्र जीनोम के साथ एक तुलना में यह प्रयोग किया जाता है । हालांकि, एक स्पष्ट टोंटी अध्ययन के किस प्रकार का आयोजन किया गया है के एक करीब देखो के साथ पहचाना जा सकता है । इन रिपोर्टों के बहुमत भविष्य के अध्ययन में एस parvula के संभावित उपयोग पर चर्चा या तुलनात्मक जीनोमिक या phylogenomic अध्ययन में इसका इस्तेमाल करते हैं । एक सबूत की कमी के कारण अवधारणा परिवर्तन एस parvulaके लिए स्थापित प्रोटोकॉल, यह कार्यात्मक जीनोमिक अध्ययन में इस्तेमाल नहीं किया गया है, उच्चतम गुणवत्ता संयंत्र की तारीख के लिए उपलब्ध जीनोम में से एक होने के बावजूद (> 5 एमबी contig N50) इकट्ठे और गुणसूत्र में व्याख्या-स्तर pseudomolecules1

एग्रोबेक्टीरियम-मध्यस्थता पुष्प डुबकी परिवर्तन विधि एक. थालियानामें trasngenic लाइनों बनाने के लिए सबसे मोटे तौर पर इस्तेमाल विधि बन गया है, और परिवर्तन की एक reproducible प्रणाली के विकास के रूप में अपनी सफलता में एक महत्वपूर्ण कारक था आनुवंशिक मॉडल12,13। तथापि, नहीं सभी Brassicaceae प्रजातियों को सफलतापूर्वक एक. थालियानाके लिए विकसित पुष्प डुबकी विधि का उपयोग कर तब्दील किया जा दिखाया गया है । विशेष रूप से, Brassicaceae वंश द्वितीय प्रजातियों कि एस parvula शामिल किया गया है करने के लिए अड़ियल है पुष्प-डुबकी आधारित परिवर्तन विधियों14,15

एस parvulaके अस्पष्ट फूल विकास की आदत, इसकी संकीर्ण पत्ती आकृति विज्ञान के साथ संयुक्त यह मानक एग्रोबेक्टीरियम मध्यस्थता पुष्प डुबकी परिवर्तन विधि को अपनाने के लिए चुनौतीपूर्ण बना दिया है. इस अध्ययन में, हम संशोधित प्रोटोकॉल हम एस parvulaके reproducible परिवर्तन के लिए विकसित किया है की रिपोर्ट ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. पौधे की वृद्धि

  1. बीज नसबंदी (ऐच्छिक)
    1. डबल आसुत जल में ५०% ब्लीच तैयार (ddH2हे) 1 या एक गैर के 2 बूंदें ईओण डिटर्जेंट के साथ ( सामग्री की तालिकादेखें) एक ५० मिलीलीटर ट्यूब में । ट्यूब उल्टे कई बार समाधान मिश्रण करने के लिए ।
      नोट: यह 15 मिनट के लिए एक यूवी निष्फल सतह के साथ एक लामिना प्रवाह कैबिनेट में बीज नसबंदी का संचालन करने के लिए बेहतर है ।
    2. एक १.५ मिलीलीटर ट्यूब में ~ 100-200 एस parvula बीज के लिए ब्लीच समाधान जोड़ें । अच्छी तरह से मिश्रण और ट्यूब 5 मिनट के लिए बैठते हैं ।
    3. ट्यूब से ब्लीच निकालें और ७०% इथेनॉल जोड़ें । बीज को कई बार pipetting करके धो लें और फिर इथेनॉल का घोल तुरंत निकाल दें ।
    4. अतिरिक्त ब्लीच और इथेनॉल को हटाने के लिए निष्फल पानी में बीज धो लें, फिर पानी निकाल दें । इस चरण को 5 से 6 बार दोहराएं ।
  2. बीज स्तरीकरण
    1. निष्फल पानी में बीज विसर्जित कर दिया, और 5 से 7 दिनों के लिए 4 डिग्री सेल्सियस पर स्टोर । वैकल्पिक रूप से, गीला मिट्टी पर सीधे सूख बीज बोना, और 5 से 7 दिनों के लिए 4 डिग्री सेल्सियस पर मिट्टी की ट्रे जगह है ।
  3. परिवर्तन की तैयारी में बढ़ रहे पौधे
    1. मिट्टी का मिश्रण भरें ( सामग्री की तालिकादेखें) में 7 x 6 cm2 बर्तन, पानी में बर्तन लेना, और ऊपर से पानी का छिड़काव करने के लिए एक समान रूप से गीला विकास के माध्यम सुनिश्चित करते हैं । जोड़ें 5 – उर्वरक मोती ( सामग्री की तालिकादेखें) प्रत्येक पॉट की मिट्टी की सतह पर ।
      नोट: जहां तक हम अनुभव किया है, एस parvula किसी भी मिट्टी के मिश्रण पर अच्छी तरह से बढ़ता है जहां A. थालियाना विकसित कर सकते हैं ।
    2. एक गीला दंर्तखोदनी का प्रयोग, 20 ~ मिट्टी की सतह पर पॉट प्रति 25 बीज हस्तांतरण ।
      नोट: एक सुविधाजनक अभ्यास के चार कोनों में 4-5 बीज और बर्तन के केंद्र (चित्रा 1, 15 दिन, बाएं पैनल) के एक बैच डाल दिया है ।
    3. अंकुरण के दौरान बीजों को उच्च आर्द्रता में रखने के लिए स्पष्ट गुंबद के साथ पॉट ट्रे को ढक दें ।
    4. १३० µmol एम− 2 एस− 1 लाइट, 22 – 24 डिग्री सेल्सियस तापमान, और 14 घंटे प्रति रात के चक्र के लिए 10 ज के साथ एक विकास कक्ष में पौध ट्रे रखें । अंकुरण के बाद 7-10 दिनों के बाद गुंबदों को हटा दें । एक वांछनीय स्तर पर एक समान रूप से गीला मिट्टी रखने के लिए ट्रे के तल से पानी जोड़ें ।
    5. अतिरिक्त अंकुरों बाहर खरपतवार और केवल 4-5 पॉट प्रति स्वस्थ अंकुर अच्छी तरह से एक दूसरे से अलग छोड़ (चित्रा 1, 15 दिन, सही पैनल) ।
    6. धीरे पौधों हर दो दिनों में पानी और 0.2 x है Hoagland समाधान16 एक बार हर दो सप्ताह के साथ खाद ।
      नोट: एक समान स्तर पर मिट्टी की नमी रखने से बढ़ती एस parvula लगातार और स्वस्थ करने के लिए महत्वपूर्ण है ।
    7. के लिए पौधों को विकसित करने के लिए जारी रखें 8-10 सप्ताह तक कई फूलना 100 का उत्पादन-संयंत्र प्रति 150 पुष्प कलियों (चित्रा 1, दिन 60-80). पुष्प-डुबकी आधारित परिवर्तन (कदम ४.५) के लिए योजना बनाई दिन पर, सभी परिपक्व और पौधों से siliques के विकास को दूर ।

2. संयंत्र परिवर्तन के लिए एक सदिश में जीन/जीनोमिक के हित के तत्व क्लोनिंग

  1. पोलीमरेज़ चेन रिएक्शन (पीसीआर)17 का उपयोग कर लक्ष्य डीएनए टुकड़ा बढ़ाना और एक जेल निष्कर्षण किट का उपयोग कर पीसीआर उत्पाद को अलग ( सामग्री की तालिकादेखें) किट प्रोटोकॉल या किसी अन्य उपयुक्त विधि के अनुसार डीएनए को शुद्ध करने के लिए agarose जेल का उपयोग ट्रो१७,१८. पृथक पीसीआर उत्पाद के अनुक्रम को सैंज sequencing19के माध्यम से सत्यापित करें ।
  2. क्लोनिंग वेक्टर में वांछित पीसीआर उत्पाद क्लोन और बदल क्लोन एक चतुर्थ तोपोइसोमेरसे आधारित क्लोनिंग किट का उपयोग कर सक्षम ई. कोलाई कोशिकाओं में निर्माण ( सामग्री की तालिकादेखें) निर्माता के दिशानिर्देशों के बाद ।
  3. फैले ५० Luria पर रूपांतरित उत्पादों के µ एल-20 Bertani (पौंड) के लिए उपयुक्त एंटीबायोटिक दवाओं के साथ बैक्टीरियल विकास मीडिया (तालिका 1), उदाहरणके लिए, ५० µ जी/एमएल Spectinomycin ( सामग्री की तालिकादेखें), और ३७ डिग्री पर मशीन सी रातोंरात ।
  4. अगले दिन, 5 का चयन करें-10 एकल कालोनियों, उपयुक्त एंटीबायोटिक दवाओं के साथ तरल पौंड मध्यम में inoculate, और ३७ ° c रातोंरात पर कोमल मिलाते हुए के साथ गर्मी ।
  5. अलग plasmids एक प्लाज्मिड आइसोलेशन किट का उपयोग कर ( सामग्री की तालिकादेखें) और के माध्यम से सत्यापित करें कि क्या लक्ष्य अनुक्रम २.१ में परिवर्धित ठीक से क्लोन है ।
  6. क्लोन और सत्यापित पीसीआर उत्पाद हस्तांतरण एक गंतव्य के लिए सदिश के लिए संयंत्र परिवर्तन के साथ संगत पुनर्संयोजन आधारित क्लोनिंग ( सामग्री की तालिकादेखें), एक recombinase एंजाइम मिक्स किट का उपयोग कर ( सामग्री की तालिकादेखें), निंनलिखित किट निर्माता के निर्देश । चरण २.३ से चरण २.५ को अलग करने के लिए दोहराएँ और उचित प्लाज्मिड निर्माण हार्बर क्लोन सत्यापित.

3. बदलने वेक्टर एग्रोबेक्टीरियम tumefaciens में संयंत्र परिवर्तन के लिए निर्माण

  1. tumefaciens तनाव GV3101: pMP90RK21 है , जो रिफैंपिसिन पृष्ठभूमि के चयन के लिए एक गुणसूत्र प्रतिरोध जीन बंदरगाह में २.६ से निर्माण वेक्टर के प्लाज्मिड रूपांतरण । उपयोग उचित एंटीबायोटिक दवाओं, जैसे गेन्तमयसीं या कनमीसिन ( सामग्री की तालिकादेखें), संयंत्र परिवर्तन के चयन के लिए निर्माण (Ti प्लाज्मिड) । electroporation के माध्यम से एक. tumefaciens परिवर्तन के लिए एक संक्षिप्त प्रोटोकॉल खंड ३.२ में शामिल है ।
  2. A. tumefaciens परिवर्तन by electroporation
    1. गल A. tumefaciens सक्षम कोशिकाओं को बर्फ पर22 . मिश्रण 0.1 – 1 २.६ से तैयार प्लाज्मिड के µ जी, 1 में भंग-2 µ एल के ddH2हे, बर्फ पर सक्षम कोशिकाओं के साथ. एक electroporation cuvette में मिश्रण स्थानांतरण ( सामग्री की तालिकादेखें) ।
    2. 3.2.1 से plasmids और सक्षम कोशिकाओं के मिश्रण पर electroporation प्रदर्शन, एक electroporator ( सामग्री की तालिकादेखें) का उपयोग कर निर्माता के दिशानिर्देशों का पालन ।
      नोट: electroporation शुरू करने से पहले cuvette की सतह को साफ कर लीजिये ।
    3. cuvette से एक microcentrifuge ट्यूब है कि तरल पौंड की १.५ मिलीलीटर और pipetting के साथ अच्छी तरह से मिश्रण और कोमल झटकों के साथ 28 डिग्री सेल्सियस पर 1 ज के लिए गर्मी से प्रतिक्रिया मिश्रण हस्तांतरण ।
  3. Inoculate (जैसे कनमीसिन 25 µ जी/एमएल, Spectinomycin ५० µ जी/एमएल, गेन्तमयसीं 25 µ जी/एमएल, और रिफैंपिसिन ५० µ जी/एमएल) और 3 दिन के लिए 28 डिग्री सेल्सियस पर मशीन-(जैसे उचित चयन एंटीबायोटिक दवाओं युक्त पौंड प्लेटों पर धारा ३.२ से tumefaciens ।

4. एस. parvula के एग्रोबेक्टीरियम-मध्यस्थता परिवर्तन

  1. Inoculate एक बाँझ ५० मिलीलीटर शंकु ट्यूब में (एक ही ३.३ में के रूप में) युक्त £ तरल मीडिया के 10 मिलीलीटर में प्लेटों से एकल रूपांतरित कालोनियों ( सामग्री की तालिकादेखें) । एक मिलाते हुए मशीन में 24 घंटे के लिए मशीन ( सामग्री की तालिकादेखें) पर २५० r.p. m । में 28 डिग्री सेल्सियस ।
  2. 3.4.1 से एक बाँझ २५० मिलीलीटर कुप्पी करने के लिए बैक्टीरियल समाधान हस्तांतरण, उपयुक्त एंटीबायोटिक दवाओं के साथ पौंड तरल मीडिया के ४० मिलीलीटर जोड़ने, और ६०० एनएम तरंग दैर्ध्य (आयुध डिपो६००) में ऑप्टिकल घनत्व तक 12 एच मशीन २.० के आसपास पहुंचता है ।
  3. 10 मिनट के लिए a. tumefaciens cultureat ३,१०० x g केंद्रापसारक । supernatant को हटा दें और जीवाणु संस्कृति को tumefaciens घुसपैठ समाधान (तालिका 1) के ४० मिलीलीटर में पुनः निलंबित करें ।
  4. ०.८ के एक अंतिम आयुध डिपो६०० के लिए घुसपैठ समाधान के साथ resuspend a. tumefaciens पतला । surfactant समाधान (तालिका 1) के 25 µ एल जोड़ें पतला ए. tumefaciens समाधान और कई बार पलटने से मिश्रण की ५० मिलीलीटर ।
  5. tumefaciens में पौधों के फूलना डुबकी 20 एस के लिए ४.४ अनुभाग में तैयार समाधान । छह बर्तनों से फूलना सूई के बाद एक ताजा जीवाणु समाधान का प्रयोग करें । सुनिश्चित करें कि सभी फूल समाधान के साथ संपर्क में हैं । प्लास्टिक जीवाणु समाधान फूलना के निचले हिस्से में स्थित फूलों पर सीधे अगर वे समाधान में डूबा नहीं किया जा सकता है ।
    नोट: पहले दौर के परिवर्तन के लिए, सभी परिपक्व हटाने और एक तेज स्केलपेल या छोटे कैंची का उपयोग कर siliques के विकास के लिए सुनिश्चित करें । दूसरी बार के लिए परिवर्तक प्रदर्शन siliques निकालें नहीं ।

5. पद परिवर्तन संयंत्र देखभाल और दूसरा परिवर्तन

  1. पौधों और 1-2 दिनों के लिए एक अंधेरे में विकास के कमरे में जगह को कवर करने के लिए गुंबद के साथ साफ ट्रे में पुष्प-डूबा पौधों को रखें ।
    नोट: उच्च आर्द्रता के तहत फूल रखते हुए इस स्तर पर महत्वपूर्ण है (चित्रा 1, परिवर्तन के बाद पौधों).
  2. पौधों को एक ईमानदार स्थिति में लौटें और पौधों को प्रति दिन 14 घंटे के साथ एक विकास कक्ष में स्थानांतरित करें/10 घंटे प्रति रात चक्र, १३० µmol एम-2 एस-1 प्रकाश तीव्रता और 22 से 24 डिग्री सेल्सियस तापमान ।
  3. अगले सप्ताह में डूबा हुआ फूलना पर नजर रखें । यदि फूलों की एक महत्वपूर्ण संख्या निरस्त (चित्रा 2), के बारे में 4 सप्ताह के बाद या फूलों की एक बड़ी संख्या में नव विकसित किया है के बाद पुष्प डुबकी (चरण 4) दोहराएं ।
    नोट: पहले परिवर्तन (चरण 1.3.7) के लिए तैयारी चरण के विपरीत, परिवर्तन के दूसरे दौर से पहले पूर्व-मौजूदा या विकासशील siliques (चित्रा 2) को न निकालें ।
  4. बीज परिपक्व और फसल बीज पर ~ 21 सप्ताह तक पौधों को विकसित ।
  5. desiccants से भरे हुए हवा बद डब्बे में कमरे के तापमान पर 2-3 सप्ताह के लिए सूखे बीज ( सामग्री की तालिकादेखें) ।

6. सकारात्मक Transformants का चयन

  1. १.३ से १.२ चरणों में जंगली प्रकार के बीज के लिए वर्णित के रूप में T1 बीज संयंत्र ।
  2. अंकुरण के बाद पहले 2 सच्चे पत्तों का विकास, लगभग 10 – 14 दिनों तक पौधों को उगाना ।
  3. herbicide प्रतिरोध के लिए पहला चयन करें (चित्रा 3A और 1 बी) के रूप में नीचे विस्तृत ।
    1. glufosinate-अमोनियम को पतला करें (११.३%) herbicide (या बसटा) (तालिका 1) से 1:1000 (v/ अंकुर पर बसटा समाधान पतला स्प्रे और रात भर गुंबद के साथ पौधों को कवर किया ।
    2. दोहराएं बसटा छिड़काव 2-3 बार हर 5-7 दिन ।
  4. नीचे विस्तृत के रूप में एक बसटा-ड्रॉप परीक्षण का उपयोग करते हुए दूसरा चयन करें ।
    1. पौधों कि बसटा समाधान के साथ 3-4 बार छिड़काव किया जा रहा है के बाद जीवित है की पहचान करें । एक और 2 के लिए पौधों को विकसित-3 सप्ताह तक 3-5 पत्ते एक अपेक्षाकृत बड़े सतह क्षेत्र का विकास ।
    2. संयंत्र प्रति सबसे बड़ा परिपक्व पत्ती का चयन करें, एक उंगली से धीरे पत्ती की सतह रगड़ मोम की परत को दूर करने के लिए, और पतला बसटा समाधान की एक बूंद जगह (6.3.1 कदम से) ।
      नोट: निकटतम स्टेम पर एक कागज टेप रखकर बसटा ड्रॉप के साथ लागू पत्ती के स्थान को चिह्नित करें ।
    3. एक सप्ताह तक के लिए मुरझाने के संकेत के लिए बसटा ड्रॉप के साथ लागू पत्तियों की निगरानी करें । बसटा बूंदों से अप्रभावित पत्तियों वाले पौधों का चयन करें ।
      नोट: सबसे झूठे-सकारात्मक पौधों से पत्ते दो दिनों के भीतर मुरझाने लगते हैं, जबकि सच्चे-सकारात्मक से पत्ते बसटा समाधान की बूंद के बाद भी बरकरार रहते है (चित्रा 3सी) ।
  5. जीनोमिक पीसीआर का प्रयोग करते हुए पॉजिटिव transformants की पुष्टि करें ।
    1. कदम 6.4.5 पर जीवित पौधों से 2-3 पत्तियों लीजिए ।
    2. CTAB विधि23 या किसी भी अन्य उचित डीएनए निष्कर्षण विधि का उपयोग कर पत्तियों से जीनोमिक डीएनए निकालें.
    3. प्रदर्शन पीसीआर लक्ष्य पौधों से निकाले जीनोमिक डीएनए नमूनों का उपयोग कर, जंगली प्रकार के पौधों (नकारात्मक नियंत्रण के रूप में), और प्लाज्मिड ३.१ कदम से निर्माण (एक सकारात्मक नियंत्रण के रूप में) । चयनित मार्कर जीन के लिए विशिष्ट पीसीआर प्राइमरों की एक उपयुक्त जोड़ी का प्रयोग करें, उदाहरण के लिए, बसटा प्रतिरोधी जीन (बार), TCAGCAGGTGGGTGTAGA (आगे) और GTCAACCACTACATCGAGACAA (रिवर्स) के लिए ।
      1. उदाहरण के लिए पीसीआर प्राइमर बार जीन लक्ष्यीकरण, निंनलिखित पीसीआर शर्तों का उपयोग करें: ९८ ° c पर प्रारंभिक विकार कदम 30 एस के लिए; 30 एस के लिए ९८ ° c पर denaturing के 30 चक्र के बाद, 30 एस के लिए ५९ डिग्री सेल्सियस पर एनीलिंग, और 30 एस के लिए ७२ ° c पर विस्तार; और 5 मिनट के लिए ७२ ° c पर अंतिम विस्तार ।
        नोट: पूरे टी डीएनए के सम्मिलन सुनिश्चित करने के लिए, हम भी प्रदर्शन जीनोमिक पीसीआर चयनित मार्कर जीन से एक पीसीआर प्राइमर का उपयोग कर और एक अन्य पीसीआर प्राइमर लक्ष्य अनुक्रम के लिए विशेष कदम पर संयंत्र परिवर्तन वेक्टर क्लोन करने के लिए की सिफारिश
    4. agarose जेल ट्रो17 द्वारा प्रवर्धित बार पीसीआर उत्पाद के अपेक्षित आकार की उपस्थिति की पुष्टि करें लक्ष्य नमूनों (चित्रा 4) के साथ-साथ अलग पीसीआर उत्पाद19 का उपयोग कर अनुक्रमण द्वारा चरण २.१ में के रूप में एक ही प्रक्रिया है ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

हम एक परिवर्तन प्रोटोकॉल है कि १५० दिनों के भीतर टी0 बीज की कटाई में सक्षम बनाता है विकसित, एक पुष्प डुबकी उस से एक. थालियानाके लिए संशोधित विधि का उपयोग कर । चित्रा 1 समयरेखा और एस parvula पौधों है कि पुष्प-डुबकी के माध्यम से परिवर्तन को क्रियान्वित करने के लिए इष्टतम चरण का प्रतिनिधित्व का एक सारांश से पता चलता है । हम ७० के साथ एस parvula संयंत्रों का चयन-८० फूल एकाधिक फूलना में 60-80 दिनों के परिवर्तन के लिए लक्ष्य मंच के रूप में अंकुरण के बाद । इस अवस्था में पूर्व-विद्यमान खुले या निषेचित फूलों तथा siliques की एक छोटी-सी संख्या को पुष्प-डुबकी विधि द्वारा tumefaciens की घुसपैठ से पहले हटा दिया गया. एक. tumefaciens के साथ संक्रमण कुछ फूल (चित्रा 2, ब्रैकेट (एक)) के गर्भपात में हुई । Siliques पूरी तरह से विकसित करने के बाद पुष्प-डुबकी के लिए परिवर्तित बीज (चित्रा 2, ब्रैकेट (बी)) शामिल होने की संभावना है । परिवर्तन के बाद भी, एस parvula के रूप में पौधों को स्वस्थ रखा गया था जब तक नए फूलना और फूल विकसित करने के लिए जारी (चित्रा 2, सफेद तीर). इस अस्पष्ट फूल की आदत के कारण, अगर संयंत्र तनाव या वार्धक्य के लक्षण नहीं दिखा है परिवर्तन के एक दूसरे दौर प्रदर्शन किया जा सकता है । चित्रा 2 एक और बी . एस. parvula संयंत्रों के उदाहरण परिवर्तन के पहले और दूसरे दौर के बाद, क्रमशः, 25 दिन के अलावा एक दूसरे से दिखाओ । दूसरे परिवर्तन में, मौजूदा siliques नहीं निकाला जाना चाहिए क्योंकि वे ट्रांसजेनिक बीज शामिल हो सकते हैं । इसके अलावा, ए tumefaciens घुसपैठ समाधान pipetting द्वारा लागू किया जा सकता है (तालिका 1) नए उभरते फूल समूहों पर, के बजाय समाधान में पूरे शूटिंग सूई, पहले से siliques को नुकसान को कम करने के लिए परिवर्तन.

परिवर्तन दक्षता ०.०३३% है, जो १०,००० T1 बीज प्रति 3-4 ट्रांसजेनिक संयंत्रों वर्तमान प्रोटोकॉल का उपयोग कर प्रचारित उपज है । यह अनुमान ~ ५०,००० T1 बीज दस स्वतंत्र परिवर्तन के प्रयास के दौरान परीक्षण पर आधारित है । जबकि दक्षता Arabidopsis थालियानाकी तुलना में कम है, यह एक और extremophyte संयंत्र के परिवर्तन के लिए तुलनीय है Eutrema salsugenium24 और Arabidopsis थालियाना ecotypes 25के कुछ । परिवर्तन दक्षता आगे वैकल्पिक एग्रोबेक्टीरियम उपभेदों और surfactant और घुसपैठ समाधान के संशोधनों का उपयोग करके अनुकूलित किया जा सकता है । मल्टीपल बसटा स्प्रे और ड्रॉप टेस्ट (स्टेप्स ६.३ और ६.४) में सच पॉजिटिव transformants की पहचान करने और स्टेप ६.५ में पीसीआर पुष्टिकरण का इस्तेमाल करते हुए परीक्षण किए गए नमूनों की संख्या को कम करने के लिए महत्वपूर्ण होगा (चित्रा 4) । परिवर्तन की पुष्टि के आगे एक संवाददाता जीन अभिव्यक्ति के साथ की जांच की जा सकती है, अगर क्लोन अनुक्रम एक रिपोर्टर जीन (चित्रा 4बी) भी शामिल है ।

Figure 1
चित्रा 1 : एस parvula परिवर्तन की समयरेखा । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: एस parvula पौधों पुष्प-डुबकी द्वारा परिवर्तन के बाद । पौधों के 10 दिन पहले पुष्प-स्नान के बाद दिन में ६० (एक) और 25 दिन पुष्प-डुबकी के दूसरे दौर के बाद दिन ८५ () पर फोटो खिंचवाने थे । एग्रोबेक्टीरियम के साथ घुसपैठ के रूप में एककोष्ठक में दिखाया फूल के silique विकास निरस्त हो सकता है । Siliques पूर्ण रूप से विकसित के बाद पुष्प-डुबकी बदल बीज (कोष्ठक बी) को शामिल करने की संभावना है । सफेद तीर फूल और नए सिरे से प्रत्येक परिवर्तन के बाद उभरा में संकेत मिलता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3 : बसटा प्रतिरोध के आधार पर एस parvula transformants का चयन । () T1 बसटा स्प्रे से पहले अंकुर । () लाल वृत्त एक उंमीदवार बसटा स्प्रे द्वारा पहले दौर के चयन जीवित परिवर्तन इंगित करता है । () बसटा ड्रॉप टेस्ट द्वारा दूसरे दौर का चयन. झूठी सकारात्मक (शीर्ष पैनल) और सच ट्रांसजेनिक पौधों (निचले पैनल) का एक उदाहरण दिखाया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्र 4 : एस parvula परिवर्तन की पुष्टि । () एस parvula संयंत्रों से निकाली गई जीनोमिक DNAs से बार जीन का पीसीआर प्रवर्धन. लेन 1 और 13: आकार मार्करों; लेन 2: नकारात्मक नियंत्रण; लेन 3-5: वंय-प्रकार एस parvula ; लेन 6-10: ट्रांसजेनिक एस parvula उंमीदवार; लेन 11, 12: वेक्टर नियंत्रण । फि ल्म 7, 8, व 9 उदाहरण देना पॉजिटिव transformants । () एक सकारात्मक एस parvula रूपांतरण में गस रिपोर्टर जीन अभिव्यक्ति का उदाहरण । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

मीडिया समाधान/ अभिकर्मक राशि
Luria-Bertani (पौंड) बैक्टीरियल विकास मीडिया Nacl
Tryptone
खमीर निकालें
आगर (प्लेट्स के लिए)
ddHहे
10 ग्राम
10 ग्राम
5 ग्राम
20 ग्राम
९५५ एमएल
एग्रोबेक्टीरियम घुसपैठ का हल एमएस नमक (1/
B5 विटामिन (1x)
सुक्रोज (5% w/
एमईएस
N6-benzylaminopurine (BA)
Silwet L-७७ (0.05% v/
फोन
२.१६ छ
1 मिलीलीटर
५० छ
०.५ छ
10 µ l
५०० μL
५.७

तालिका 1: बैक्टीरियल विकास मीडिया की संरचना और एग्रोबेक्टीरियम घुसपैठ समाधान ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

संयंत्र की शारीरिक स्थिति में काफी परिवर्तन की दक्षता को प्रभावित करता है25. परिवर्तन के लिए स्वस्थ और जोरदार पौधों का उपयोग एस parvulaमें सफल परिवर्तन के लिए एक महत्वपूर्ण आवश्यकता है । पानी या प्रकाश बल दिया पौधों कम फूल परिवर्तन के लिए आदर्श स्वस्थ पौधों की तुलना में होगा (1 चित्रा, केंद्र पैनल) । एस parvula एक हल्की तीव्रता से कम १३० µmol एम-2 एस-1से बढ़ सकता है, लेकिन पौधों को कमजोर हो जाते हैं; ऐसे पौधों को पुष्प-डुबकी के बाद अधिक निरस्त फूलों का नेतृत्व करना होता है. एस parvula एक. थालियाना से अधिक दर पर एग्रोबेक्टीरियम-डूबा फूल निरस्त करने के लिए जाता है । इसलिए, हर कदम के लिए रोके गए फूल को ंयूनतम जब में डूबा tumefaciens घुसपैठ समाधान एक उच्च परिवर्तन दक्षता के लिए योगदान देता है । हम एक प्रकाश अवधि के प्रति दिन 14 घंटे से अधिक नहीं की सिफारिश । अक्सर, थालियाना के परिवर्तन एक लंबे दिन की हालत में हो पौधों पर किया जाता है (जैसे 18 एच प्रकाश और 6 एच डार्क) या यहां तक कि निरंतर प्रकाश में । हालांकि, हम कम लचीला में ऐसी प्रथाओं परिणाम पाया parvula संयंत्रों और एक कम परिवर्तन दक्षता के लिए सीसा ।

फूल कलियों लगातार एस parvula (चित्रा 2, सफेद तीर) के फूलना कुल्हाड़ियों पर उत्पादित कर रहे हैं । इसलिए, नए फूलों के परिवर्तन की अनुमति काफी सकारात्मक transformants होने की संभावना में वृद्धि होगी । एक दूसरे पुष्प-डुबकी (चरण ५.३) आवश्यक नहीं है, लेकिन दृढ़ता से सुझाव दिया । हालांकि, इस कदम अपेक्षाकृत समय लेने के लिए की तुलना में है थालियाना पुष्प सूई, क्योंकि एस parvula कई फूलना कुल्हाड़ियों का उत्पादन ।

जंगली-प्रकार एस parvula बसटा के प्रति संवेदनशील है, हालांकि बसटा स्प्रे के साथ सकारात्मक transformants के लिए प्रारंभिक स्क्रीन (चरण ६.३) 5-8 जीवित पौधों के बाहर १०० बीज अंकुरित (आंकड़ा 3एक और 4 बी) छोड़ देंगे । इस (> 80%) के अधिकांश झूठी सकारात्मक हो जाएगा । यह काफी हद तक संकीर्ण पत्ती आकार और एस parvulaके पत्ती कोण है, जो एक उचित अभिविंयास में पर्याप्त पत्ती सतह प्रदान नहीं करने के लिए एक phenotype का पालन करने के लिए एक पर्याप्त अवधि के लिए बसटा समाधान बनाए रखने के कारण है । इसके अतिरिक्त, एस parvula10की adaxial पत्ती सतह के उच्च मोम सामग्री के कारण, यह बसटा के लिए एक अधिक अभेद्य सतह बनाने के लिए जाता है । इसलिए, व्यक्तिगत पत्तियों पर एक बसटा ड्रॉप का उपयोग कर सकारात्मक transformants के लिए दूसरी स्क्रीनिंग (चरण ६.४, चित्रा 3सी) झूठी सकारात्मक (चरण ६.५) के सैकड़ों पर पीसीआर परीक्षण से बचने के लिए एक आवश्यक कदम है ।

वर्तमान प्रोटोकॉल pMP90RK प्लाज्मिड ले tumefaciens तनाव GV3101 के साथ परीक्षण किया गया था । परिवर्तन की दक्षता के साथ अंय ए tumefaciens उपभेदों, उपभेदों अबी, LMG20, और C58C1 Rifr, pMP90 डाह प्लाज्मिड के साथ सुधार किया जा सकता है के साथ एक. थालियाना में परिवर्तन दक्षता बढ़ाने की सूचना दी 25. थालियाना1की तुलना में Brassica और Eutrema प्रजातियों को एस parvula से अधिक बारीकी से taxonomically जाता है । इसलिए, Brassica napus और EHA105 Eutrema को ट्रांस्फ़ॉर्म करने के लिए सफलतापूर्वक उपयोग किया गया है जो दबाव salsugineum को ट्रांस्फ़ॉर्म करने के लिए a. tumefaciens दबाव सफलतापूर्वक उपयोग किया गया था जो एक उच्च परिवर्तन प्रस्तुत कर सकता है वर्तमान में26,27,28इस्तेमाल तनाव की रिपोर्ट दक्षता से दक्षता ।

एक परिवर्तन प्रोटोकॉल द्वारा आवश्यक समय और परिश्रम को कम करने परिवर्तन दक्षता में सुधार लाने में एक और महत्वपूर्ण कारक है । पत्तियों पर व्यक्तिगत बसटा बूंदें रखने और कई पौधों पर एक सप्ताह के लिए पत्ती की निगरानी (६.४ कदम) थकाऊ रहे हैं । एक भविष्य में परिवर्तन दक्षता बढ़ाने के प्रयास उपयुक्त वैकल्पिक चयन मार्कर जीन29के लिए खोज सकता है ।

एक स्थापित परिवर्तन प्रोटोकॉल की उपलब्धता बहुत हमारे जीन और उपंयास तंत्र की पहचान है कि extremophyte मॉडल संयंत्रों की अनुमति के लिए कई अजैव तनाव2,4से बचने की क्षमता अग्रिम होगा । एस parvula में उपंयास आनुवंशिक भिंनता आनुवंशिक भिंनता है कि सामूहिक allelic अपेक्षाकृत तनाव संवेदनशील मॉडल, ए थालियाना में तनाव प्रतिक्रियाशील जीन के रूप में पहचान की भिंनता से खनन नहीं किया जा सकता है की एक व्यापक पूल प्रदान करेगा पान-जीनोम,. इसलिए, हमारे पुष्प-स्नान आधारित ए. tumefaciens मध्यस्थता परिवर्तन प्रोटोकॉल एस parvula के लिए विकसित ऐसे उपकरणों के लिए एक extremophyte बारीकी से संबंधित एक मॉडल में कार्यात्मक जीनोमिक प्रयोगों प्रदर्शन करने के लिए की आवश्यकता के लिए एक अंतर भरना होगा. थालियाना

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

यह काम एक राष्ट्रीय विज्ञान फाउंडेशन पुरस्कार म्क्ब १६१६८२७ द्वारा समर्थित किया गया था ।

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).
संयंत्र विकास और एग्रोबेक्टीरियम-Extremophyte <em>Schrenkiella parvula</em> की मध्यस्थता पुष्प डुबकी परिवर्तन
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).More

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter