Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Pianta di crescita e trasformazione di Floral-dip mediata da Agrobacterium della Extremophyte Schrenkiella parvula

doi: 10.3791/58544 Published: January 7, 2019

Summary

Trasformazione mediata da Agrobacterium utilizzando un metodo floreale-dip può essere impiegato con successo per creare linee transgeniche stabile del modello extremophyte Schrenkiella parvula. Vi presentiamo un protocollo modificato da quello per Arabidopsis thaliana, considerando le abitudini differenti di sviluppo e caratteristiche fisiologiche della extremophyte.

Abstract

Schrenkiella parvula è un extremophyte adattato a diversi stress abiotici, tra cui molteplici sollecitazioni di tossicità dello ione. Nonostante alta qualità risorse genomiche disponibili per studiare come adattano le piante per ambientale sottolinea, suo valore come un modello di genomica funzionale e strumento è stata limitata dalla mancanza di un sistema di trasformazione fattibile. In questo protocollo, segnaliamo come generare transgenici stabile S. parvula linee utilizzando un metodo di floreale-dip mediata da Agrobacterium. Abbiamo modificato il protocollo di trasformazione usato per a. thaliana per rappresentare caratteristiche uniche di S. parvula, come un'abitudine di fioritura indeterminato e un contenuto di cere epicuticolari alta sulle foglie. In breve, S. parvula semi sono stati stratificati a 4 ° C per cinque giorni prima della piantatura. Piante sono state coltivate in un fotoperiodo di una luce 14h e 10 h scuro e un 130 µmol m-2s-1 intensità della luce, a 22 ° C a 24 ° C. Otto a nove settimane piante con infiorescenze multiple sono stati selezionati per la trasformazione. Queste infiorescenze sono stati immersi in una soluzione di infiltrazione di Agrobacterium tumefaciens GV3101 portando il plasmide pMP90RK . Abbiamo effettuato due giri del fiore di immersione con un intervallo di tre o quattro settimane per aumentare l'efficienza di trasformazione. I semi T1 sono stati raccolti e asciugati per quattro settimane in un contenitore con materiale essicante prima germinazione alla schermata per candidato trasformato le linee. Resistenza a BASTA era usata per selezionare piante T1. Abbiamo spruzzato la soluzione BASTA tre volte con un intervallo di tre giorni a partire da due settimana-vecchi impianti per ridurre i falsi positivi. È stata eseguita una prova di caduta BASTA sopravvivere singole piante per identificare il vero positivo trasformanti. L'efficienza di trasformazione era 0,033%, producendo piante transgeniche di 3 – 4 per 10.000 semi T1 propagate.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In questo protocollo, descriviamo la crescita e la creazione di linee transgeniche stabili per il modello extremophyte Schrenkiella parvula. La disponibilità di un sistema efficiente trasformazione è un marchio di garanzia di qualsiasi modello genetico versatile. Piante che prosperano in ambienti estremi, di cui come extremophytes, fornire una risorsa fondamentale per comprendere gli adattamenti della pianta agli stress ambientali. Schrenkiella parvula (precedentemente Thellungiella parvula ed Eutrema parvulum) è uno di questi modelli extremophyte, con espansione risorse genomiche1,2,3,4,5. Tuttavia, protocolli di trasformazione non sono ancora stati segnalati per S. parvula negli studi pubblicati.

Il genoma di S. parvula è il primo genoma di extremophyte pubblicato in Brassicaceae (famiglia senape-cavolo) e Mostra un'ampia sintenia genoma globale con il modello di non-extremophyte, Arabidopsis thaliana1. Così, gli studi comparativi tra a. thaliana e S. parvula potrebbero beneficiare della ricchezza di studi genetici su a. thaliana formulare delle ipotesi ben informativi su come si è evoluto e regolato il genoma di s. parvula in modo diverso per affrontare estremi ambientali sottolinea5,6,7. S. parvula è una delle specie più sale-tolleranti (basati su terreno NaCl LD50) tra parenti selvatici noti di a. thaliana8. Oltre la tolleranza di NaCl, S. parvula sopravvive e completa il suo ciclo di vita in presenza di ioni più sale alle alte concentrazioni tossiche per la maggior parte delle piante7. In risposta agli stress abiotici prevalente nel suo habitat naturale, si sono evoluto varie caratteristiche, tra cui molti sono stati studiati i biochimici o fisiologico livello 8,9,10, 11.

Dal 2010, ci sono state oltre 400 pubblicazioni peer-reveiwed utilizzato S. parvula come specie bersaglio o in un confronto con altri genomi delle piante. Tuttavia, un collo di bottiglia chiaro potrebbe essere identificato con uno sguardo più attento di che tipo di studi sono stati condotti. La maggior parte di questi rapporti discuterà l'uso potenziale di S. parvula negli studi futuri o utilizzarlo in genomica comparativa o phylogenomic studi. A causa della mancanza di un protocollo di proof-of-concept trasformazione stabilito per S. parvula, non è stato utilizzato in studi di genomica funzionale, pur avendo uno dei genomi di pianta più alti di qualità ad oggi disponibili (> 5 Mb contig N50) assemblato e annotato in pseudomolecules livello del cromosoma1.

Il metodo di trasformazione mediata da Agrobacterium di floreale-dip è diventato il metodo più ampiamente usato per creare linee di trasngenic in a. thaliana, e lo sviluppo di un sistema riproducibile di trasformazione era un fattore critico di successo come un modello genetico12,13. Tuttavia, non tutte le specie di Brassicaceae hanno dimostrate di essere trasformata con successo utilizzando il metodo floreale-dip sviluppato per a. thaliana. Appositamente, la specie di Brassicaceae Lineage II che includono S. parvula è stato ricalcitrante a trasformazione base floreale-dip metodi14,15.

L'abitudine di crescita indeterminato fioritura di S. parvula, combinato con la sua morfologia foglia stretta ha reso impegnativo di adottare il metodo standard mediata da Agrobacterium floreale-tuffo trasformazione. In questo studio, segnaliamo il protocollo modificato che abbiamo sviluppato per riproducibile trasformazione di S. parvula.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. pianta crescita

  1. Sterilizzazione di seme (opzionale)
    1. Preparare 50% candeggina in acqua bidistillata (ddH2O) con 1 o 2 gocce di un detergente non ionico (Vedi Tabella materiali) in una provetta da 50 mL. Capovolgere la provetta diverse volte per miscelare la soluzione.
      Nota: È preferibile effettuare la sterilizzazione di seme in un flusso laminare con una superficie di UV sterilizzata per 15 min.
    2. Aggiungere la soluzione di candeggina al ~ 100 – 200 S. parvula semi in una provetta da 1,5 mL. Mescolare accuratamente e lasciare riposare per 5 min.
    3. Rimuovere la candeggina dal tubo e aggiungere etanolo al 70%. Lavare i semi di pipettaggio più volte e quindi rimuovere la soluzione di etanolo immediatamente.
    4. Lavare i semi in acqua sterilizzata per rimuovere etanolo e candeggina in eccesso, quindi rimuovere l'acqua. Ripetere questo passaggio 5 o 6 volte.
  2. Stratificazione di seme
    1. Immergere i semi in acqua sterilizzata e memorizzare per 5-7 giorni a 4 ° C. In alternativa, seminare i semi secchi non sterilizzati direttamente sul terreno bagnato e mettere la vaschetta di terreno per 5-7 giorni a 4 ° C.
  3. Piante che crescono in preparazione della trasformazione
    1. Riempire il terreno mescolare (Vedi Tabella materiali) in vasi di 7 x 6 cm2 , immergere i vasi in acqua e spruzzare acqua dalla parte superiore per garantire una crescita uniformemente umido medio. Aggiungere 5 – fertilizzante Perline (Vedi Tabella materiali) sulla superficie del suolo di ogni piatto.
      Nota: Per quanto abbiamo sperimentato, S. parvula cresce bene su qualsiasi mix di terreno dove possono crescere a. thaliana .
    2. Utilizzando uno stuzzicadenti bagnato, trasferire 20 ~ 25 semi per vaso sulla superficie del suolo.
      Nota: Una pratica conveniente è quello di mettere una serie di 4 – 5 semi in quattro angoli e al centro del piatto (Figura 1, giorno 15, pannello di sinistra).
    3. Coprire il vassoio piatto con una cupola trasparente per tenere i semi sotto alta umidità durante la germinazione.
    4. Tenere i vassoi di pianta in una camera di crescita con un'intensità luminosa impostata alle 130 luce µmol m− 2 s− 1 , temperatura di 22 – 24 ° C e 14 ore al giorno/10 h per ciclo di notte. Rimuovere le cupole dopo 7-10 giorni dopo la germinazione. Aggiungere l'acqua dalla parte inferiore del vassoio per mantenere il terreno inumidito in modo uniforme a livello desiderabile.
    5. Estirpare le piantine supplementare e lasciare solo 4 – 5 sano piantine per vaso ben separato gli uni dagli altri (Figura 1, giorno 15, pannello di destra).
    6. Delicatamente le piante di acqua ogni due giorni e fertilizzare con 0,2 x soluzione16 di Hoagland una volta ogni due settimane.
      Nota: Mantenere l'umidità del terreno ad un livello uniforme è chiave alla crescente S. parvula costantemente e in modo sano.
    7. Continuano a crescere le piante per 8 – 10 settimane fino alla più infiorescenze producono 100 – 150 gemme floreali per pianta (Figura 1, giorno: 60 – 80). Il giorno previsto per la trasformazione di base floreale-dip (punto 4.5), è necessario rimuovere tutte le silique mature e in via di sviluppo dalle piante.

2. clonazione del Gene/genomica elemento di interesse in un vettore per la trasformazione della pianta

  1. Amplificare il frammento di DNA bersaglio usando polimerasi reazione a catena (PCR)17 e isolare il prodotto PCR utilizzando un'estrazione del gel kit (Vedi Tabella materiali) secondo il protocollo di kit o qualsiasi altro metodo appropriato per purificare il DNA utilizzando gel dell'agarosi l'elettroforesi17,18. Verificare la sequenza del prodotto della PCR isolato attraverso di sequenziamento Sanger19.
  2. Clone del prodotto di PCR desiderato nella clonazione vettoriale e trasformazione il costrutto clonato in competente Escherichia coli cellule utilizzando una clonazione di topoisomerasi-based kit (Vedi Tabella materiali) seguendo le linee guida del produttore.
  3. 50 µ l di prodotti trasformati sul supporto della crescita batterica della agar del20 (LB) di Luria-Bertani (tabella 1) con gli antibiotici adatti, di diffondere ES., 50 µ g / mL spectinomicina (Vedi Tabella materiali) e incubare a 37 ° C durante la notte.
  4. Il giorno seguente, selezionare 5 – 10 singole colonie, inoculare in terreno liquido LB con gli antibiotici adatti e incubare con agitazione delicata a 37 ° C durante la notte.
  5. Plasmidi isolare utilizzando un isolamento di plasmide kit (Vedi Tabella materiali) e verificare attraverso di sequenziamento Sanger19 se la sequenza di destinazione amplificata 2.1 viene duplicata correttamente.
  6. Trasferire il prodotto PCR clonato e verificato per un vettore di destinazione per la trasformazione di impianto compatibile con clonazione di ricombinazione-based (Vedi Tabella materiali), utilizzando un mix di enzima recombinase kit (Vedi Tabella materiali), seguente istruzioni del fabbricante kit. Ripetere dal passo 2.3 al passo 2,5 a isolare e verificare cloni che harboring costrutti di plasmide adeguato.

3. trasformare il vettore costruire per impianto trasformazione in Agrobacterium tumefaciens

  1. Trasformare il plasmide del costrutto vettoriale da 2,6 il ceppo di a. tumefaciens GV3101:pMP90RK21, che harbors un gene di resistenza di rifampicina per selezione sfondo cromosomiche. Utilizzare gli antibiotici adatti, ad esempio gentamicina o kanamicina (Vedi Tabella materiali), per la selezione dell'impianto di trasformazione costruire (plasmide Ti). Un protocollo breve per la trasformazione di a. tumefaciens tramite elettroporazione è incluso nella sezione 3.2.
  2. A. tumefaciens trasformazione mediante elettroporazione
    1. Scongelare i di cellule competenti di a. tumefaciens 22 sul ghiaccio. Mix: 0,1 – 1 µ g del plasmide preparato da 2,6, disciolto in 1-2 µ l di ddH2O, con cellule competenti sul ghiaccio. Trasferire il composto ottenuto in una cuvetta di elettroporazione (Vedi Tabella materiali).
    2. Eseguire l'elettroporazione sulla miscela di plasmidi e cellule competenti da 3.2.1, utilizzando un electroporator (Vedi Tabella materiali) seguendo le linee guida del produttore.
      Nota: Pulire la superficie della provetta prima di iniziare l'elettroporazione.
    3. Trasferire la miscela di reazione dalla cuvette ad un tubo del microcentrifuge contenente 1,5 mL di LB liquido e mescolare bene con il pipettaggio e incubare per 1 h a 28 ° C con agitazione delicata.
  3. Inoculare il trasformato a. tumefaciens dalla sezione 3.2 su piastre LB contenenti antibiotici selezione appropriata (ad esempio kanamicina 25 µ g / mL, spectinomicina 50 µ g / mL, la gentamicina 25 µ g / mL e rifampicina 50 µ g / mL) e incubare a 28 ° C per 3 giorni.

4. trasformazione mediata da Agrobacterium di S. parvula

  1. Inoculare il singolo trasformato colonie da piastre in 10 mL di LB media liquidi contenenti antibiotici (lo stesso come in 3.3) in una sterile 50 mL conica del tubo (Vedi Tabella materiali). Incubare per 24 h in un incubatore d'agitazione (Vedi Tabella materiali) a 250 giri/minuto a 28 ° C.
  2. Trasferire la soluzione batterica da 3.4.1 in una beuta sterile 250 mL, aggiungere 40 mL di liquido LB media con gli antibiotici adatti e incubare 12h fino a quando la densità ottica a 600 Nm (OD600) raggiunge circa 2.0.
  3. Centrifugare il a. tumefaciens cultureat 3.100 x g per 10 min. rimuovere il surnatante e risospendere la coltura batterica in 40 mL di soluzione di a. tumefaciens infiltrazione (tabella 1).
  4. Diluire il sedimento a. tumefaciens con soluzione di infiltrazione a un finale OD600 di 0,8. Aggiungere 25 µ l di soluzione di tensioattivo (tabella 1) in 50 mL di diluito a. tumefaciens soluzione e mescolare capovolgendo più volte.
  5. Immergere l'infiorescenza delle piante nella soluzione a. tumefaciens preparata nella sezione 4.4 per 20 s. uso una soluzione batterica fresca dopo la immersione infiorescenza da sei pentole. Assicurarsi che tutti i fiori sono a contatto con la soluzione. Soluzioni batteriche di dispensare direttamente sui fiori che si trova nella parte inferiore dell'infiorescenza, se essi non può essere immerso nella soluzione.
    Nota: Per la trasformazione del primo turno, assicurarsi di rimuovere tutte le silique mature e in via di sviluppo, utilizzando un bisturi affilato o piccole forbici. Non rimuovere silique se eseguendo la trasformazione per la seconda volta.

5. post-trasformazione impianto cura e la seconda trasformazione

  1. Posizionare le piante floreali-tuffato orizzontalmente in vaschette pulite con cupole per coprire le piante e posto in una stanza di crescita scuro per 1 – 2 giorni.
    Nota: Mantenere i fiori sotto alto-umidità è importante in questa fase (Figura 1, piante dopo la trasformazione).
  2. Restituire le piante in posizione verticale e trasferire le piante in una camera di crescita con un 14 h al giorno/10 h per ciclo di notte, 130 intensità luminosa di µmol m-2 s-1 e 22-24 ° C di temperatura.
  3. Monitorare le infiorescenze tuffate nella settimana successiva. Se un numero significativo di fiori abort (Figura 2), ripetere il tuffo floreale (passaggio 4) dopo circa 4 settimane o dopo un gran numero di fiori hanno recentemente sviluppato.
    Nota: A differenza di fase di preparazione per la prima trasformazione (punto 1.3.7), non rimuovere pre-esistenti o in via di sviluppo silique (Figura 2) prima del secondo turno di trasformazione.
  4. Crescere le piante fino a quando i semi maturano e raccolgono i semi a ~ 21 settimane.
  5. Semi secchi per 2 – 3 settimane a temperatura ambiente in un contenitore ermetico con riempito con materiale essicante (Vedi Tabella materiali).

6. selezione dei trasformanti positivo

  1. Piantare i semi T1 come descritto per i semi di tipo selvaggio nei passaggi da 1.2 a 1.3.
  2. Crescere le piante fino a sviluppano le prime 2 foglie vere, circa il 10 – 14 giorni dopo la germinazione.
  3. Eseguire la prima selezione per la resistenza agli erbicidi (Figura 3A e 3B) come dettagliato qui sotto.
    1. Diluire l'erbicida glufosinato-ammonio (11,3%) (o BASTA) (tabella 1) per 1:1,000 (v/v). Spruzzare la soluzione diluita BASTA sulle piantine e coprire le piante con cupole durante la notte.
    2. Ripetere BASTA spruzzare 2-3 volte ogni 5 – 7 giorni.
  4. Eseguire la seconda selezione utilizzando un test di caduta BASTA come dettagliato di seguito.
    1. Identificare le piante che sopravvivono dopo essere stato spruzzato 3 – 4 volte con soluzione BASTA. Coltivare le piante per un altro 2-3 settimane fino a 3 – 5 foglie sviluppano una superficie relativamente grande.
    2. Selezionare la più grande foglia adulta per pianta, strofinare la superficie della foglia delicatamente con le dita per rimuovere lo strato di cera e mettere una goccia di soluzione diluita BASTA (dal punto 6.3.1).
      Nota: Segnare la posizione della foglia applicata con la goccia BASTA inserendo un nastro di carta sul gambo più vicino.
    3. Monitorare le foglie applicate con la goccia BASTA per segni di avvizzimento fino ad una settimana. Selezionare le piante con foglie inalterati dalle gocce BASTA.
      Nota: Foglie da piante più falsi positivi cominciano ad appassire entro due giorni, mentre le foglie da true-positivi sono intatte anche dopo la goccia di soluzione BASTA si prosciuga (Figura 3C).
  5. Conferma positiva trasformanti mediante PCR genomic.
    1. Raccogliere 2 – 3 foglie dalle piante sopravvissute al punto 6.4.5.
    2. Estrarre il DNA di genomic dalle foglie utilizzando il metodo CTAB23 o qualsiasi altro appropriato metodo di estrazione del DNA.
    3. Eseguire PCR utilizzando campioni di DNA genomici estratti da piante bersaglio, piante di selvaggio-tipo (come controllo negativo) e il costrutto di plasmide dal passaggio 3.1 (come controllo positivo). Utilizzare una coppia appropriata degli iniettori di PCR specifici per il gene marcatore selettivo, ad esempio, per gene BASTA-resistenti (bar), TCAGCAGGTGGGTGTAGA (avanti) e GTCAACCACTACATCGAGACAA (inverso).
      1. Per gli iniettori PCR esempio mira il gene bar , utilizzare le seguenti condizioni PCR: il punto di denaturazione iniziale a 98 ° C per 30 s; seguiti da 30 cicli di denaturazione a 98 ° C per 30 s, ricottura a 59 ° C per 30 s e l'estensione a 72 ° C per 30 s; e l'estensione finale a 72 ° C per 5 min.
        Nota: Per garantire l'inserimento del T-DNA intero, si consiglia di eseguire anche PCR genomic utilizzando un primer PCR da gene marcatore selettivo e clonato un altro primer PCR specifico nella sequenza di destinazione per il vettore di trasformazione della pianta al passo
    4. Confermare la presenza della dimensione prevista del prodotto della PCR amplificati bar da elettroforesi su gel di agarosio17 per i campioni di obiettivo (Figura 4A) nonché ordinando il prodotto PCR isolato,19 utilizzando la stessa procedura come descritto al punto 2.1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Abbiamo sviluppato un protocollo di trasformazione che consente la raccolta dei semi di T0 entro 150 giorni, utilizzando un metodo di floreale-dip modificato da quello di a. thaliana. La figura 1 Mostra un riepilogo della timeline e S. parvula piante che rappresentano la fase ottima per l'esecuzione della trasformazione attraverso floreale-dip. Abbiamo scelto S. parvula piante con fiori di 70 -80 in più infiorescenze a 60-80 giorni dopo la germinazione come la fase di destinazione per la trasformazione. Un piccolo numero di fiori aperti o fertilizzati pre-esistenti e silique in questa fase sono stati rimossi prima l'infiltrazione di a. tumefaciens mediante il metodo floreale-dip. L'infezione con a. tumefaciens ha provocato l'aborto di alcuni fiori (Figura 2, staffa (a)). Silique completamente sviluppato dopo il floreale-dip sono probabili contenere semi trasformati (Figura 2, staffa (b)). Anche dopo la trasformazione, S. parvula ha continuato a sviluppare nuove infiorescenze e fiori fino a quando le piante sono state mantenute sani (Figura 2, frecce bianche). A causa di questa abitudine di fioritura indeterminato, un secondo ciclo di trasformazione può essere eseguito se la pianta non mostra segni di stress o senescenza. Figura 2 A e 2B mostrano esempi di piante S. parvula dopo il primo e il secondo turno di trasformazione, rispettivamente, 25 giorni oltre a vicenda. Nella seconda trasformazione, silique esistente non dovrebbero essere rimosso perché possono contenere sementi transgeniche. Inoltre, a. tumefaciens può essere applicato pipettando la soluzione di infiltrazione (tabella 1) sui nuovi emergenti i mazzi di fiori, anziché l'intero reportage di immersione nella soluzione, per ridurre al minimo i danni a silique dal primo trasformazione.

L'efficienza di trasformazione è 0,033%, producendo piante transgeniche di 3 – 4 per 10.000 semi T1 propagati usando il protocollo corrente. Questa stima si basa su ~ 50.000 semi T1 testati durante i dieci tentativi di trasformazione indipendente. Mentre l'efficienza è più bassa di quella di Arabidopsis thaliana, è paragonabile alla trasformazione di un altro extremophyte pianta Eutrema salsugenium24 e alcuni dell'Arabidopsis thaliana ecotipi25. L'efficienza di trasformazione può essere ulteriormente ottimizzato utilizzando alternativo Agrobacterium ceppi e le modifiche di tensioattivo e infiltrazione di soluzioni. Le BASTA più test di spruzzo e goccia (punti 6.3 e 6.4) sarà fondamentale per identificare il vero positivo trasformanti e ridurre il numero di campioni testati utilizzando la conferma di PCR nel passaggio 6.5 (Figura 4A). Un'ulteriore conferma della trasformazione può essere controllata con un'espressione del gene reporter, se la sequenza clonata include un gene reporter (Figura 4B).

Figure 1
Figura 1 : Timeline di trasformazione S. parvula . Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: S. parvula piante dopo la trasformazione da floreale-DIP. Piante sono stati fotografati a 10 giorni dopo il primo floreale-tuffo al giorno 60 (A) e a 25 giorni dopo il secondo turno di floreale-tuffo al giorno 85 (B). Infiltrazione con Agrobacterium può interrompere lo sviluppo anemofila dei fiori come indicato in parentesi un. Silique completamente sviluppato dopo floreale-dip sono probabili contenere semi trasformati (staffe b). Frecce bianche indicano fiori e infiorescenze di recente emersero dopo ogni trasformazione. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 : Selezione dei trasformanti S. parvula basata sulla resistenza BASTA. (A) T1 piantine prima lo spray BASTA. (B) cerchio rosso indica un candidato transformant sopravvivere la selezione del primo turno lo spray BASTA. Test di caduta (C), la selezione del secondo turno di BASTA. Sono riportato un esempio di falsi positivi (pannello superiore) e piante transgeniche veri (pannello inferiore). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4 : Conferma della trasformazione S. parvula . (A), PCR amplificazione del gene bar da DNAs genomic estratto dalle piante S. parvula . Corsia 1 e 13: dimensioni marcatori; Corsia 2: controllo negativo; Lane 3-5: selvaggio-tipo S. parvula ; 6-10 di Lane: transgenici S. parvula candidati; Lane 11, 12: controllo vettoriale. Corsie, 7, 8 e 9 esemplificano trasformanti positivo. (B) esempio di espressione di gene reporter GUS in modo positivo e S. parvula transformant. Clicca qui per visualizzare una versione più grande di questa figura.

Media / soluzione Reagente Importo
Coltura batterica di Luria-Bertani (LB) NaCl
TRYPTONE
Estratto di lievito
Agar (per piastre)
ddH2O
10 g
10 g
5 g
20 g
955 mL
Soluzione di infiltrazione dell'agrobatterio Sale di MS (1/4 x)
Vitamine B5 (1x)
Saccarosio (5%w/v)
MES
N.6- benzylaminopurine (BA)
Del silwet L-77 (0.05%v/v)
pH
2,16 g
1 mL
50 g
0,5 g
10 Μ l
500 ΜL
5.7

Tabella 1: composizione media di crescita batterica e Agrobacterium soluzione di infiltrazione.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Lo stato fisiologico della pianta influenza significativamente l'efficienza di trasformazione25. L'utilizzo di piante sane e vigorose per trasformazione è un requisito chiave per la trasformazione di successo in S. parvula. Acqua o luce piante stressati avrà meno fiori rispetto alle piante sane ideale per la trasformazione (Figura 1, pannello centrale). S. parvula può crescere con un'intensità di luce inferiore a 130 µmol m-2 s-1, ma le piante tendono ad essere più fragili; tali piante porterebbe a più interrotta fiori seguendo floreale-dip. S. parvula tende ad interrompere Agrobacterium-tuffato fiori ad un tasso più elevato a. thaliana. Di conseguenza, ogni passo compiuto per ridurre al minimo i fiori abortiti quando immerso nella soluzione di infiltrazione di a. tumefaciens contribuisce a una maggiore efficienza di trasformazione. Si consiglia un periodo di luce non superiore a 14 ore al giorno. Spesso, la trasformazione di a. thaliana è eseguita su piante coltivate in una condizione di giorno lungo (ad es. 18 h luce e buio 6 h) o anche sotto luce continua. Tuttavia, abbiamo trovato tale risultato di pratiche in meno resistente S. parvula piante e porterà a un'efficienza di trasformazione basso.

Boccioli di fiori sono continuamente prodotte sugli assi infiorescenza di S. parvula (Figura 2, frecce bianche). Pertanto, consentendo la trasformazione di nuovi fiori aumenterebbe significativamente la probabilità di ottenere positivi trasformanti. Un secondo floreale-dip (punto 5.3) non è essenziale, ma fortemente consigliata. Tuttavia, questo passaggio è relativamente in termini di tempo rispetto alla immersione floreale di a. thaliana , perché S. parvula produce più assi di infiorescenza.

Selvaggio-tipo S. parvula è sensibile a BASTA, anche se la schermata iniziale per trasformanti positivo con spray BASTA (punto 6.3) lascerà 5 – 8 impianti sopravvissuti fuori 100 semi germinati (Figura 3A e 3B). La maggior parte di questo (> 80%) saranno falsi positivi. Ciò è in gran parte dovuto la forma della foglia stretta e l'angolo di foglia di S. parvula, che non forniscono sufficiente superficie fogliare in un orientamento adeguato per mantenere la soluzione BASTA per una durata sufficiente osservare un fenotipo. Inoltre, a causa del contenuto di cera della superficie adassiale foglia di parvula S.10, tende a creare una superficie più impervia per BASTA. Di conseguenza, la seconda proiezione per positivo trasformanti utilizzando una goccia BASTA su singole foglie (punto 6.4, Figura 3C) è un passo essenziale per evitare PCR test su centinaia di falsi positivi (passo 6.5).

Il protocollo attuale è stato testato con il ceppo di a. tumefaciens GV3101 portando il plasmide pMP90RK . L'efficienza di trasformazione può essere migliorata con altri ceppi di a. tumefaciens , compresi i ceppi ABI, LMG20 e C58C1 Rifr, con il plasmide di virulenza pMP90 segnalato per aumentare l'efficienza di trasformazione in a. thaliana 25. Brassica ed Eutrema specie tassonomicamente sono più strettamente imparentate con s. parvula rispetto ad a. thaliana1. Di conseguenza, a. tumefaciens ceppo LBA4404 che è stato usato con successo per trasformare Brassica napus e il ceppo EHA105 che è stato utilizzato con successo per trasformare Eutrema salsugineum può offrire una maggiore trasformazione l'efficienza che l'efficienza segnalata del ceppo utilizzato attualmente26,27,28.

Riducendo il tempo e la manodopera necessaria da un protocollo di trasformazione è un altro fattore significativo nel miglioramento dell'efficienza di trasformazione. Immissione di singole BASTA gocce sulle foglie e la foglia di monitoraggio per una settimana su impianti multipli (punto 6.4) sono noiosi. Un futuro sforzo per aumentare l'efficienza di trasformazione potrebbe cercare di marcatore selezionabile alternativi appropriati geni29.

La disponibilità di un protocollo di trasformazione stabilito avanzerà notevolmente la nostra capacità di identificare geni e nuovi meccanismi che consentono di extremophyte piante modello sopravvivere più stress abiotici2,4. Variazione genetica romanzo in S. parvula fornirà un ampio pool di variazione genetica che non può essere estratta dalla variante allelica collettiva identificata come lo stress-geni nel modello relativamente sensibili allo stress, a. thaliana Pan-genoma5,6. Pertanto, nostro floreale-dip basata a. tumefaciens mediata protocollo di trasformazione sviluppato per S. parvula riempirà un gap per la necessità di tali strumenti eseguire esperimenti di genomici funzionali in un modello di extremophyte strettamente a A. thaliana.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Questo lavoro è stato supportato da un premio della National Science Foundation 1616827 MCB.

Materials

Name Company Catalog Number Comments
Agar VWR International, Radnor, PA 90000-762 Bacto Agar Soldifying Agent, BD Diagnostics
B5 vitamins Sigma-Aldrich, St. Louis, MO G1019 Gamborg’s Vitamin Solution
Desiccant W A Hammond Drierite, Xenia, OH 22005 Indicating DRIERITE 6 mesh
Destination vector for plant transformation TAIR Vector:6531113857 pKGWFS7
Electroporation cuvette USA Scientific 9104-5050 Electroporation cuvette, round cap, 0.2 cm gap
Electroporator BIO-RAD Laboratories, Hercules, CA 1652100 MicroPulser Electroporator
Fertilizer beads Osmocote Garden, Marysville, OH N/A Osmocote Smart-Release Plant Food Flower & Vegetable
Gel extraction kit iNtRON Biotechnology, Boston, MA 17289 MEGAquick-spin Total fragment DNA purification kit
Gentamicin Sigma-Aldrich, St. Louis, MO G1914-5G Gentamicin sulfate
Glufosinate-ammonium (11.3%) herbicide (BASTA) Bayer environmental science, Montvale, NJ N/A FINALE herbicide
Kanamycin VWR International, Radnor, PA 200004-444 Kanamycin monosulfate
MES Bioworld, Dublin, OH 41320024-2 MES, Free Acid
MS salt MP Biomedicals, Santa Anna, CA 092621822 Hoagland's modified basal salt mixture
N6-benzylaminopurine (BA)  Sigma-Aldrich, St. Louis, MO B3274 6-Benzylaminopurine solution
NaCl Sigma-Alrich S7653 Sodium chloride
Non-ionic detergent Sigma-Aldrich, St. Louis, MO 9005-64-5 TWEEN 20 
Plasmid isolation kit Zymo Research, Irvine, CA D4036 Zyppy Plasmid Kits
Recombinase enzyme mix kit Life Technology 11791-020 Gateway LR Clonase II Enzyme mix
Rifampicin Sigma-Aldrich, St. Louis, MO R3501-1G Rifampicin, powder, ≥ 97% (HPLC)
Shaking incubator ThermoFisher Scientific, Waltham, MA SHKE4450 MaxQ 4450 Benchtop Orbital Shakers
Soil mix Sun Gro SUN239223328CFLP Sun Gro Metro-Mix 360 Grower Mix
Spectinomycin VWR International, Radnor, PA IC15206705
Sterile 50 mL conical tubes USA Scientific, Ocala, FL 1500-1811 50 mL conical screw cap tubes, copolymer, racks, sterile
Sucrose VWR International, Radnor, PA 57-50-1 Sucrose, ACS
Surfactant solution Lehle seeds, Round Rock, TX VIS-02 Silwet L-77
Topoisomerase-based cloning kit Life Technologies, Carlsbad, CA K240020 pENTR/D-TOPO Cloning Kit, with One Shot TOP10 Chemically Competent E. coli
Tryptone VWR International, Radnor, PA 90000-282 BD Bacto Tryptone, BD Biosciences
Yeast Extract VWR International, Radnor, PA 90000-722  BD Bacto Yeast Extract, BD Biosciences

DOWNLOAD MATERIALS LIST

References

  1. Dassanayake, M., et al. The genome of the extremophile crucifer Thellungiella parvula. Nature Genetics. 43, (9), 913-918 (2011).
  2. Oh, D. -H., Dassanayake, M., Bohnert, H. J., Cheeseman, J. M. Life at the extreme: lessons from the genome. Genome Biology. 13, (3), 241 (2012).
  3. Whited, J. The Next Top Models. Cell. 163, (1), 18-20 (2015).
  4. Dassanayake, M., Yun, D. O. D., Bressan, R. A., Cheeseman, J. M., Bohnert, J. H. The scope of things to come: New paradigms in biotechnology. Plant Biotechnology and Agriculture: Prospects for the 21st Century. 19-34 (2009).
  5. Dittami, S. M., Tonon, T. Genomes of extremophile crucifers: New platforms for comparative genomics and beyond. Genome Biology. 13, (8), 166 (2012).
  6. Amtmann, A. Learning from evolution: Thellungiella generates new knowledge on essential and critical components of abiotic stress tolerance in plants. Molecular Plant. 2, (1), 3-12 (2009).
  7. Oh, D. -H., Hong, H., Lee, S. Y., Yun, D. -J., Bohnert, H. J., Dassanayake, M. Genome structures and transcriptomes signify niche adaptation for the multiple-ion-tolerant extremophyte Schrenkiella parvula. Plant Physiology. 164, (4), 2123-2138 (2014).
  8. Orsini, F., et al. A comparative study of salt tolerance parameters in 11 wild relatives of Arabidopsis thaliana. Journal of Experimental Botany. 61, (13), 3787-3798 (2010).
  9. Uzilday, B., Ozgur, R., Sekmen, A. H., Yildiztugay, E., Turkan, I. Changes in the alternative electron sinks and antioxidant defence in chloroplasts of the extreme halophyte Eutrema parvulum (Thellungiella parvula) under salinity. Annals of Botany. 115, (3), 449-463 (2015).
  10. Teusink, R. S., Rahman, M., Bressan, R. A., Jenks, M. A. Cuticular waxes on Arabidopsis thaliana close relatives Thellungiella halophila and Thellungiella parvula. International Journal of Plant Sciences. 163, (2), 309-315 (2002).
  11. Jarvis, D. E., Ryu, C. H., Beilstein, M. A., Schumaker, K. S. Distinct roles for SOS1 in the convergent evolution of salt tolerance in Eutrema salsugineum and Schrenkiella parvula. Molecular Biology and Evolution. 31, (8), 2094-2107 (2014).
  12. Clough, S. J., Bent, A. F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant Journal. 16, (6), 735-743 (1998).
  13. Koornneef, M., Meinke, D. The development of Arabidopsis as a model plant. Plant Journal. 61, (6), 909-921 (2010).
  14. Bai, J., Wu, F., Mao, Y., He, Y. In planta transformation of Brassica rapa and B. napus via vernalization-infiltration methods. Protocol Exchange. 10, 1028 (2013).
  15. Sparrow, P. A. C., Goldsack, C. M. P., Østergaard, L. Transformation technology in the Brassicaceae. Genetics and Genomics of the Brassicaceae. 505-525 (2011).
  16. Hoagland, D. R., Arnon, D. I. The water-culture method for growing plants without soil. California Agricultural Experiment Station Circular. 347, (347), 1-32 (1950).
  17. Saiki, R., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, (4839), 487-491 (1988).
  18. Sun, Y., Sriramajayam, K., Luo, D., Liao, D. J. A Quick, cost-free method of purification of dna fragments from agarose gel. Journal of Cancer. 3, 93-95 (2012).
  19. Sanger, F., Nicklen, S., Coulson, A. R. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 74, (12), 5463-5467 (1977).
  20. Bertani, G. Studies on Lysogenesis I. The mode of phage liberation by lysogenic Eschericia coli. Journal of Bacteriolgy. 62, (3), 293-300 (1951).
  21. Koncz, C., Martini, N., Szabados, L., Hrouda, M., Bachmair, A., Schell, J. Specialized vectors for gene tagging and expression studies. Plant Molecular Biology Manual. 53-74 (1994).
  22. Weigel, D., Glazebrook, J. Transformation of Agrobacterium using electroporation. Cold Spring Harbor Protocols. 2006, (30), (2006).
  23. Murray, M. G., Thompson, W. F. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Research. 8, (19), 4321-4326 (1980).
  24. Inan, G. Salt cress. a halophyte and cryophyte Arabidopsis relative model system and its applicability to molecular genetic analyses of growth and development of extremophiles. Plant Physiol. 135, (3), 1718-1737 (2004).
  25. Ghedira, R., De Buck, S., Nolf, J., Depicker, A. The efficiency of Arabidopsis thaliana floral dip transformation is determined not only by the Agrobacterium strain used but also by the physiology and the ecotype of the dipped plant. Molecular Plant-Microbe Interactions. 26, (7), 823-832 (2013).
  26. Shaohong, F. U., Xianya, W. E. I., Yingze, N. I. U., Shixing, G. U. O. Transformation of Brassica napus with the method of floral-dip. Biotechnology: Genomics and Its Applications. 45-49 (2005).
  27. Li, J., Tan, X., Zhu, F., Guo, J. A rapid and simple method for Brassica napus floral-dip transformation and selection of transgenic plantlets. International Journal of Biology. 2, (1), 127 (2010).
  28. Li, H. Q., Xu, J., Chen, L., Li, M. R. Establishment of an efficient Agrobacterium tumefaciens-mediated leaf disc transformation of Thellungiella halophila. Plant Cell Reports. 26, (10), 1785-1789 (2007).
  29. Wu, G., Rossidivito, G., Hu, T., Berlyand, Y., Poethig, R. S. Traffic lines: New tools for genetic analysis in Arabidopsis thaliana. Genetics. 200, (1), 35-45 (2015).
Pianta di crescita e trasformazione di Floral-dip mediata da Agrobacterium della Extremophyte <em>Schrenkiella parvula</em>
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).More

Wang, G., Pantha, P., Tran, K. N., Oh, D. H., Dassanayake, M. Plant Growth and Agrobacterium-mediated Floral-dip Transformation of the Extremophyte Schrenkiella parvula. J. Vis. Exp. (143), e58544, doi:10.3791/58544 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter