Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

ניתוח קוואזי-metagenomic של סלמונלה מזון, סביבתית דגימות

doi: 10.3791/58612 Published: October 25, 2018

Summary

כאן, אנו מציגים פרוטוקול להכין דגימות דנ א מזון, סביבתית microbiomes זיהוי מתואמת, subtyping של חיידקי סלמונלה דרך רצף quasimetagenomic. שימוש משולב של העשרת תרבות, immunomagnetic ההפרדה (IMS) ועקירה מרובים הגברה (מד א) מאפשרת ריכוז אפקטיבי של DNA גנומי סלמונלה מזון ודוגמאות סביבתיים.

Abstract

רצף קוואזי-metagenomics מתייחס ניתוח המבוסס על רצף של microbiomes שונה של מזון ודוגמאות סביבתיים. ב פרוטוקול זה, microbiome השינוי נועד להתרכז הדנ א של מזהם הפתוגן והקאה היעד כדי להקל על הזיהוי ו subtyping לנגיף בזרימת עבודה בודד. כאן, אנחנו מסבירים ומדגימים הצעדים הכנה דגימה לניתוח קוואזי-metagenomics של סלמונלה enterica מן המזון נציג ודוגמאות סביבתי כולל נבטי אלפלפה, פלפל שחור גרוס, בשר בקר, עוף חזה מטליות סביבתיים. דוגמאות הן נתון קודם העשרת תרבות של סלמונלה עבור מקוצר, הניתנים לשינוי משך (h 4 – 24). סלמונלה תאים ואז באופן סלקטיבי נלכדים מתרבות העשרה על-ידי immunomagnetic ההפרדה (IMS). לבסוף, הזחה מרובים הגברה (מד א) מבוצע כדי להגביר את ה-DNA של התאים שנתפסו-IMS. פלט ה-DNA של פרוטוקול זה יכול רציף על ידי פלטפורמות רצף תפוקה גבוהה. ניתן לבצע ניתוח ה-PCR כמותי אופציונלי כדי להחליף את רצף לגילוי סלמונלה או להעריך את הריכוז של סלמונלה DNA לפני רצף.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Metagenomics רצף תיאורטית מאפשר זיהוי מתואמת subtyping של פתוגנים והקאה. עם זאת, דוגמאות מזון מציגים אתגרים לניתוח הפתוגן על ידי רצף ישירה של microbiome האוכל. ראשית, והקאה פתוגנים נוכחים לעתים קרובות ברמות נמוכות בדגימות מזון. רוב השיטות לזיהוי מהיר זמינים מסחרית עדיין דורשים h 8 – 48 culturing להעשיר את הפתוגן לתאים לזיהוי רמה1. שנית, מזונות רבים מכילים תאים microflora שופע ו/או מזון שהופך והקאה הפתוגן DNA חלק קטן של מזון metagenome, יעד חמקמק עבור זיהוי ו subtyping ישיר metagenomic רצף ה-DNA.

שינוי של מזון microbiomes דווחה כדי לאפשר ריכוז משמעותי של פתוגן והקאה דנ א כדי להקל על זיהוי מבוסס על רצף של שיגה לייצור הרעלן Escherichia coli2,3 ו- סלמונלה enterica4. כי שינוי המזון microbiomes הם עדיין תערובות של מינים שונים של חיידקים, רצף שלהם נקראת כמו ניתוח קוואזי-metagenomic4. Microbiome השינוי יכול להתבצע על ידי תרבות העשרה לבד2,3 או בשילוב עם immunomagnetic ההפרדה (IMS), מספר הזחה הגברה (מד א)4,5. IMS יכול ללכוד באופן סלקטיבי תאים הפתוגן מתרבות ההעשרה בעזרת מצופים נוגדן beads מגנטי. מד א ניתן להפיק כמויות מספיקות של דנ א גנומי רצף דרך ה-DNA פולימראז יעילים ביותר ɸ296. מד א-IMS אפשרה זיהוי הפתוגן תלויית תרבות של דגימות קליניות7, וקיצור של העשרת תרבות לגילוי קוואזי-metagenomic subtyping של חיידקי סלמונלה דגימות מזון4.

המטרה הכוללת של שיטה זו היא להכין את ה-DNA קוואזי-metagenomic של דוגמאות מזון כדי לאפשר ריכוז ממוקד של דנ א גנומי סלמונלה וזיהוי הבאים subtyping של החומר סלמונלה על ידי רצף. בהשוואה בשיטות הרגילות סלמונלה זיהוי8,9 , subtyping10, הגישה quasimetagenomic יכול לקצר משמעותית את משך העבודה של מזון מזוהם ודוגמאות הסביבה כדי מולקולרית תתי סוגים של המחלה על ידי המאחד השני בדרך כלל מופרדים ניתוחים לתוך זרימת עבודה יחידה. שיטה זו שימושית במיוחד עבור יישומים כגון והקאה פרוץ התגובה אחרים חקירות האחורי של מעקב שבו פתוגן עמיד subtyping נדרש בנוסף זיהוי הפתוגן, אספקה מהיר אנליטי הוא חשוב.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. הכנת הדוגמא

הערה: דוגמאות מזון מוכנים מראש העשרה לפי המדריך מעבדה מיקרוביולוגיה (מלג) של ארצות הברית מחלקת של חקלאות בטיחות המזון ואת פיקוח שירות (USDA-FSIS)11 בקטריולוגית ידני אנליטי (BAM) של המזון, סמים המינהל (FDA)12.

  1. גילוח ורחיצה כירורגית מקום חלק 25 גרם מזון דגימת כגון פלפל שחור, חזה עוף, בשר בקר טחון, נבטי אלפלפה או ספוגית סביבתיים לתוך שקית בלנדר המעבדה סטרילית עם מסנן מובנה. הכן של ספוגית סביבתיים על ידי גילוח ורחיצה כירורגית הרטבה ספוג עם מרק העשרה (רפפורט-Vassiliadis, RV). לאחר מכן, גרור את הספוגית מעל כל פני השטח או אזור מוגדר מראש ומקם אותה לתוך שקית בלנדר מעבדה.

Figure 1
איור 1: מזון נציג ודוגמאות סביבתיים זיהוי קוואזי-metagenomics, subtyping של חיידקי סלמונלה. דוגמאות מוצבים שקיות מסנן סטרילי צנטריפוגות יחד עם מרק RV. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

  1. לערבב ביסודיות כל מדגם 25 גרם 225 מ ל RV העשרה מרק באמצעות עיסוי בלנדר או יד מעבדה עבור 30 s.
    הערה: וריאציות של מרק RV כמומלץ על ידי מלג ובום עשוי לשמש בהתאם סוגי מדגם.
  2. דגירה להעשרת-דוגמת מרק תערובת ב חממה מעבדה ב 42 ° C עבור 4 – 24 h.
  3. לאחר דגירה, לאסוף subsample 50 מ ל מרק העשרה מהצד המסוננת של התיק בשפופרת צנטרפוגה נפרד 50 מ.
  4. Centrifuge את הצינור ב- 100 גרם x 10 דקות להוציא פסולת מוצקה homogenate.
  5. לשחזר את תגובת שיקוע בקפידה כדי 50 מ ל חדש צנטריפוגה שפופרת ואת centrifuge הצינורות ב 3,000 – 6,000 g x 10 דקות להתאושש תא גלולה.
  6. (אופציונלי) למחוק את תגובת שיקוע לשטוף בגדר על ידי re-השעיה ב 5 מ של מים Peptone Buffered (BPW), centrifuge הצינורות ב 3,000 – 6,000 g × 10 דקות.
    הערה: BPW יכול שהוכנו על ידי המסת 10 גרם של peptone, 5 גר' נתרן כלורי, 3.5 g של ניתרן פוספט, ו- 1.5 גר' monopotassium פוספט 1 L של מים מזוקקים. ה-pH הסופי צריך להתאימו כך 7.2 ± 0.2 ב 25 º C. ניתן להשתמש גם אוטוקלב-121 ºC במשך 15 דקות BPW זמינים מסחרית.
  7. למחוק את תגובת שיקוע, מחדש להשעות את צניפה ב 5 מ של BPW.

2. Immunomagnetic (IMS) והגליונות הזחה מרובים הגברה (מד א)

הערה: למניעת זיהום צולב בין דגימות, בעבודות אבטחה של ארון, לשנות פיפטה טיפים לכל שפופרת, להימנע מלגעת ברכבת התחתית עם פיפטה וכן אין מקום צינורות צמודים מעמד מגנטי במהלך השלב כביסה.

  1. להפשיר מראש המאגר מדגם ועל המאגר התגובה הערכה מד א על קרח או ב 4 ° C.
  2. לערבב 1 מ"ל של תא מחדש על תנאי הצניפה ב BPW עם μL 20 שלסלמונלה חרוזים אנטי - 1.5 mL microcentrifuge צינורות ומניחים אותו על המיקסר מסתובבת במשך 30 דקות בטמפרטורת החדר.
    הערה: פלורה תחרותי חלקיקים שומן, חלבונים בבגדר resuspended יכולים להפריע IMS. דילול של גלולה תא מחדש על תנאי ב BPW שימושי להפחית את אובדןסלמונלה מתחמי חרוז - מדוכן מגנטי במהלך שטיפת מדרגות.
  3. להכניס הצינורות הדוכן מגנטי ולאפשר 3 דקות עבור התאוששות נאותה של חרוזים על-ידי היפוך ארון התקשורת מספר פעמים לרכז את החרוזים לתוך גלולה בצד של הצינור.
  4. לשמור על הצינורות על הדוכן מגנטי. האחות וזורקים את תגובת שיקוע כל שפופרת, כמו גם את הנוזל הנותר ב קאפ כל שפופרת.
    הערה: יש להיזהר לא להפריע בגדר של חרוזים IMS על הקיר בצד של הצינור נגד המגנט.
  5. הסר בעל שפופרת של הדוכן מגנטי להוסיף 1 מ"ל שטיפת מאגר (PBS המכילה 0.05% (v/v) polysorbate 20), היפוך מספר פעמים כדי להסיר הלא ספציפית מחייבת חיידקים מן המתחם.
  6. חזור על שלבים 2.3-2.5 פעמיים.
  7. לאחר לשטוף את 3rd , לבצע הפרדה מגנטית הסופי של חרוזים מאת לחזור על השלבים 2.3 – 2.4. להסיר את צינורות מתלה מגנטי ומניחים microfuge 1 s כדי לסובב את החרוזים. אז, במקום הצינורות בארון מגנטי במשך 3 דקות לפני הסרת כל מאגר לשארי שטיפת.
  8. מחדש להשעות אתסלמונלה מתחמי חרוז - ב-9 μL דוגמת המאגר, דגירה ב 95 מעלות צלזיוס למשך 3 דקות עבור דנטורציה.
  9. לאחר קירור עד 4 ° C על קרח, לשלב עם μL 9 תגובה מאגר פלוס 1 μL של האנזים לערבב ולהשאיר על קרח.
  10. ב הצנטרפוגה תרמי, דגירה צינורות ב 30 מעלות צלזיוס במשך 2 h עבור הגברה, ואחריו חימום-65 מעלות צלזיוס למשך 10 דקות כדי להשבית את האנזים וקריר עד 4 ° C על קרח.
  11. להעריך את כמות ואיכות המוצרים מד א על ידי מדידת את ריכוז הדנ א ואת טוהר (260/280 יחס > 1.8) על מכשיר fluorospectrometer.
    הערה: בגלל הכריכה לא ספציפית של חרוזים IMS, הדנ א של אורגניזמים שאינם סלמונלה עשויה להיות נוכח המוצרים מד א, אך זה אינו משפיע על ניתוח במורד הזרם.
  12. חנות המוצרים הסופיים (20 μL) ב-20 ° C עד לשימוש בזמן אמת PCR ו/או ספריה לקראת רצף quasimetagenomics.

3. בזמן אמת PCR

הערה: שלב זה הוא אופציונלי עבור 1) מזהה את סלמונלה ללא subtyping, ו- 2) הערכת איכות מדגם לפני רצף quasimetagenomics.

  1. להכין μL 18 של תערובת PCR לכל דגימה, המכיל מאסטר PCR אוניברסלי לערבב (10 μL), להעביר פריימר (2 μL, 900 ננומטר), הפוך פריימר (2 μL, 900 ננומטר), בדיקה (2 μL, 250 nM), ומים כיתה מולקולרית (2 μL).
    הערה: סלמונלה-לנוקלאוטידים ספציפי (לפנים: CTCACCAGGAGATTACAACATGG, הפוך: AGCTCAGACCAAAAGTGACCATC), בדיקה נועדו להגביר את רצף 94-bp בתוך הגן ttr (GenBank ההצטרפות לא. AF 282268)13.
  2. לערבב את המוצר מד א מ שלב 2.12 על ידי בעדינות pipetting למעלה ולמטהסלמונלה מתחמי חרוז - יחד עם נוזלי כדי ליצור השעיה. להוסיף 2 μL של ההשעיה לתוך μL 18 תערובת PCR.
  3. הפעלת PCR בזמן אמת באמצעות פרוטוקול ה-PCR אופטימיזציה בזמן אמת, קביעת שתי תקופות המעצר, אחד ב 50 מעלות צלזיוס למשך 2 דקות והשני ב 95 מעלות צלזיוס למשך 10 דקות, ואחריו 40 מחזורי 95 ° C עבור 15 s ו- 60 ° C 60 s.
  4. חישוב מחזור הסף (Ct), שהוא מספר מחזורים הדרושות על ידי קרינה פלואורסצנטית מהדנ מוגבר לחצות את קו סף.
    הערה: נקבע קו סף בשלב ליניארי בין קו הבסיס הרמה של החלקות הגברה של דגימות. תוצאות שליליות תואמות לערכים Ct מעל 40 או דגימות עם Ct ערכים גבוהים יותר של שליטה שלילי.

4. ספריית לקראת רצף Quasimetagenomic

הערה: המוצרים מד א יכול להיות רציף על ידי שני קצר לקרוא, לקרוא הרבה זמן (nanopore) רצף פלטפורמות. להשתמש בגירסה העדכנית ביותר של ה-DNA ספריית ערכות ההכנה שסופקו על-ידי היצרנים של פלטפורמות רצף. לבצע הכנה ספריית דנ א על פי הוראות היצרנים. השתמש 2D נמוך קלט גנומית DNA בפרוטוקול להכנה ספריית פלטפורמה רצף ארוך-קריאה5. הכנה ספריה עבור פלטפורמת רצף קצר-קריאה, שינויים מזעריים פרוטוקול של היצרן ניתנים להלן.

  1. עקוב אחר שיטות הכנה ספרייה תקנית על-ידי הוספת מאגר פתרונות ריאגנטים מוצרים מד א. ΜL 40 של המוצרים מד א רצף מוכנה להעביר צלחת חדשה ולהוסיף 20 μL של ה-PCR טיהור חרוזים מכל קידוח.
  2. דגירה את הצלחת בטמפרטורת החדר במשך 10 דקות מבלי לרעוד.
  3. לשטוף את החרוזים עם 80% אתנול ויבש את החרוזים למשך 12 דקות.
  4. מחדש להשעות חרוזים יבשים ב- 53 μL resuspension מאגר, דגירה למשך 2 דקות מבלי לרעוד.
  5. לדלל, מאגר ספריות בעקבות ההוראה של היצרן.
    הערה: pM 10 איחדו, ספריית שפגע בסימני מוכן כעת היה לסדרם.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

לפני quasimetagenomic רצף, ניתן להעריך את הכמות הכוללת ואת טוהר המוצרים IMS-מד א על-ידי fluorospectrometer (טבלה 1).

העשרה זמן (h) ערך ct ריכוז (ng/ul) טוהר (260/280)
Brand A 4 24.71 812.91 1.89
8 25.80 900.36 1.87
12 15.41 753.88 1.84
המותג B 4 20.63 872.61 1.87
8 22.61 993.41 1.87
12 19.08 954.44 1.87

טבלה 1: הערכת האיכות והכמות של ה-DNA דוגמאות עבור רצף קוואזי-metagenomic. סלמונלה תאים חוסנו ב- 25 גרם חזה עוף מבושל של שני מותגים-Inoculated CFU/ג 1 דוגמאות היו מועשר ב- RV עבור 4, 8 ו- 12 שעות לפני IMS-מד א.

הערכת כמות יישוב של סלמונלה דנ א יכול להתבצע על ידי PCR בזמן אמת (טבלה 1 ו- 2 איור), המגישה גם כחלופה לגילוי סלמונלה אם subtyping לא נחוצה.

Figure 2
איור 2: PCR בזמן אמת עבור הערכה זיהוי או לטעום סלמונלה עבור רצף קוואזי-metagenomics. עקומות הגברה של PCR בזמן אמת של סלמונלה DNA במוצרים IMS-מד א לאחר h 4, 8 ו- 12 של העשרה זמן מוצגים. דוגמה לאחר רק 2 h העשרה כלולה גם. סלמונלה תאים (0.27 CFU/g) היו חוסנו 25 גרם חזה עוף מבושל של שני מותגים A ו- B אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Fluorospectrometer קריאות לאפשר הערכה ראשונית של הכנת הדוגמא. ריכוז של מד א-IMS מוצרים שהוכנו סלמונלה חזה עוף מזוהמים דגימות נע בין 701.54 ל 945.86 ng/µL, טוען כי ה-DNA דוגמת מוגבר. על פי הנחיות היצרן, הריכוז דגימת דנ א המינימלי בקיצור לקרוא ולקרוא זמן רצף הוא 0.2 ng/µL 1 µg, בהתאמה. 260/280 היחס נע בין 1.85 אל 1.88 (טבלה 1), מציג טוהר גבוהה של דגימות ה-DNA עם רמות נמוכות של חלבון זיהום.

ערכים נמוכים יותר Ct מצביעות על ריכוז גבוה של סלמונלה DNA גנומי במדגם. כפי שמוצג בטבלה 1 ו- 2 איור, Ct של מד א-IMS מוצרים כאמור הירידה בערכי העשרה הזמן גדל. קודמות שלנו לימוד4, כאשר ערכי Ct היו נמוכות יותר מאשר 25, הרוב (> 50%) של SE הגנום היה סביר היה לסדרם, serotype חיזוי של רצף raw קריאות היה מוצלח.

העשרת תרבות לא מוצלח או IMS עלולה לגרום בערכים Ct גבוה יחסית המציין ריכוז נמוך של סלמונלה DNA גנומי במדגם הסופי כפי שמוצג באיור2. הדבר יכול להתרחש למרות הריכוז הגבוה של ה-DNA טוהר המוצרים IMS-מד א כפי שהוצע על ידי קריאות fluorospectrometer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

בשל שפע לעתים קרובות נמוכה נוכחות בהומוגנית של סלמונלה מזון, סביבתית דגימות, העשרת תרבות לפני IMS-מד א הכרחי עדיין זיהוי סלמונלה , subtyping; לכן שלב קריטי של הפרוטוקול. כדי לזהות תנאים אופטימליים כדי להגביר את השפע של סלמונלה יחסית דוגמת רקע פלורה, עשויים להעריך העשרה שונים מדיה לדוגמאות ספציפיות. על-פי מלג ובום, סלקטיבי בינוני כגון מרק RV והן באמצעי לא בררניים כגון מרק לקטוז ומים peptone במאגר יכול לשמש סלמונלה העשרה של דוגמאות מזון. השימוש של RV-42 ° C יוערכו שלנו המחקר הקודם4 סלמונלה העשרה בשר עוף מבושל, חסה, פלפל שחור כדי לתמוך quasimetagenomic ניתוח של המחלה. על פי ה-FDA בום, AOAC precollaborative8,9מחקרים שיתופי14,15, RV מומלץ לניתוח של מזונות גבוהים עומס מיקרוביאלי מיקרוביאלי ונמוך.

משך הזמן האופטימלי של העשרת תרבות תלוי גורמים רבים, כגון סוג הדגימה, רמת זיהום סלמונלה , מצב פיזיולוגי הזיהום סלמונלה . לדוגמה, כאשר רמות נמוכות של סלמונלה (לדוגמה, < 1 CFU/g) תאים קיימים במדגם בשר, תחת לחץ קירור, זמן העשרה יותר (למשל, > 12 שעות) עשוי להיות נחוץ כדי להחיות ולהעשיר את התאים סלמונלה . מספקת שפע של סלמונלה microbiome ששונה מוביל כיסוי הולם רצף הגנום מזהם סלמונלה , אשר יכול לאפשר פולימורפיזם נוקלאוטיד יחיד ברמת המתח (הסנ פ) הקלדת4. העשרת תרבות קצר יותר (למשל, פחות מ- 12 שעות) הוא אפשרי על איתור מהיר5 או serotyping של סלמונלה4.

רמות גבוהות יותר של זיהום סלמונלה ו/או יותר העשרת תרבות של דגימות מזון מזוהם עלול לגרום ריכוז גבוה של מזון שונה microbiomes, אשר יובילו להורדת ערכי Ct מ- DNA גנומי סלמונלה ניתוח ה-PCR בזמן אמת. Ct ערכים להציג קורלציה שלילית עם רצף כיסוי של הגנום מזהם4 סלמונלה , ולכן יכול לשמש עבור אופטימיזציה ושינוי של זרימת העבודה. הניסיון שלנו תרבות העשרה, במיוחד את האורך של זה, לעתים קרובות המוקד של פתרון בעיות מאמצים. לדוגמה, הערך Ct של המוצר IMS-מד א מתוך מדגם חזה עוף מבושל היה גבוה יחסית-35.94 (איור 1). דוגמה זו היה מחוסן עם 2.5 CFU/g של תאים SE, מודגרות ב- BPW ב 37 ° C עבור ה 2 רצף של דוגמה זו לא סיפקה מספיק כיסוי של הגנום SE כדי לאפשר חיזוי serotype. לשם השוואה, היו כל הדגימות אחרים עם 4 שעות או יותר העשרה בהצלחה serotyped quasimetagenomic רצף נתונים (מידע לא מוצג).

לאחר רצף, אנו ממליצים באמצעות הקראקן16 לזיהוי סלמונלה הקראת עבור נוסף ביואינפורמטיקה ניתוחים. צינור CFSAN הסנ פ17 ו SeqSero18 יכול לשמש עבור הסנ פ הקלדת ו serotyping חיזוי של קריאות רצף raw, בהתאמה.

טכניקה זו quasimetagenomic יש מספר מגבלות. ראשית, ה-DNA ריכוז והטוהר של מוצרים IMS-מד א נמדדת fluorospectrometer יש להשתמש רק כסמן ראשוני של הכנת הדוגמא הנכונה. בשל יעילות גבוהה של מד א, כמויות זעירות של DNA קלט יכולים הגברה יספיק רצף הגנום כולו19. לכן, דגימות די אן איי גבוהה של איכות וכמות עדיין ניתן להפיק גם אם העשרה תרבות או IMS מצליח להתרכז ביעילות תאים סלמונלה . הניתוח PCR בזמן אמת האופציונלי מספק הערכה יישוב ואינפורמטיבי יותר של זרימת העבודה הכנת המדגם כולו. שנית, קשה-עד-תרבות סלמונלה תאים, כגון קיימא אבל חיידקים nonculturable (VBNC)20, אולי לא לגדול במהלך העשרת תרבות. לכן, תאים אלה ייתכן לא יזוהו על-ידי השיטה שלנו.

לסיכום, לעומת שיטות מסורתיות, שיטת הכנה מדגם והתפיסה רצף קוואזי-metogenomic שלנו יכול לאפשר צמצום משמעותי של המפנה אנליטית של סלמונלה-שזוהמו מזון, סביבתית דגימות עמיד subtyping של מזהמים חיידק הסלמונלה . בנוסף סלמונלה, טכניקה זו יש פוטנציאל להיות זיהוי יישומית מהירה, מתואמת, subtyping פתוגנים אחרים והקאה.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים מצהירים כי יש להם אינטרסים כלכליים אין מתחרים.

Acknowledgments

המחברים רוצה להודות מארק האריסון, הירש גוון של האוניברסיטה של גאורגיה למתן בחביבות המתח חיידקי ותמיכה אחרים במחקר זה.

Materials

Name Company Catalog Number Comments
Laboratory blender bag w/filter VWR 10048-886
Buffered peptone water Oxoid Micorbiology Products CM0509
Rappaport Vassiliadis broth Neogen Acumedia 7730A
Polysorbate 20  Millipore Sigma P9416 Tween 20
Stomacher blender Seward  30010108
Centrifuge Fisher Scientific 75005194
50 mL Centrifuge tubes Fisher Scientific 05-539-6
Thermal Cycler Techne Prime EW-93945-13
StepOne Real-Time Thermal cycler Applied Biosystems 4.76357
AMPure XP beads Beckman Coulter A63881 PCR purification beads; mix well before use; store at 4 °C
Nextera XT library prep kit Illumina FC-131-1024 Store at -80 °C
MinIon library prep kit Oxford Nanopore SQK-LSK108 Store at -80 °C
NanoDrop Thermo Scientific ND-2000
Dynabead Anti-Salmonella beads Applied Biosystems 71002 Vortex well prior to use
Illustra GenomiPhi V2 DNA amplification kit (MDA kit)
-Sample buffer
-Reaction buffer
-Enzyme mix
GE Healthcare 25-6600-30 Store at -80 °C
HulaMixer Invitrogen 15920D
DynaMag magnetic rack Invitrogen 12321D
TaqMan Universal PCR mastermix Applied Biosystems 4304437 Mix well before use; store at 4 °C
Microfuge Fisher Scientific 05-090-100

DOWNLOAD MATERIALS LIST

References

  1. Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens. Critical Reviews in Food Science and Nutrition. 56, (9), 1519-1531 (2016).
  2. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach. Applied and Environmental Microbiology. 81, (23), 8183-8191 (2015).
  3. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS One. 11, (12), e0167870 (2016).
  4. Hyeon, J. Y., et al. Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples. Applied and Environmental Microbiology. (2017).
  5. Hyeon, J. Y., Deng, X. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification. Food Microbiology. 63, 111-116 (2017).
  6. Hosono, S., et al. Unbiased whole-genome amplification directly from clinical samples. Genome Research. 13, (5), 954-964 (2003).
  7. Seth-Smith, H. M., et al. Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture. Genome Research. 23, (5), 855-866 (2013).
  8. Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method. Journal of Food Protection. 75, (2), 400-404 (2012).
  9. Jacobson, A. P., Hammack, T. S., Andrews, W. H. Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method. Journal of AOAC International. 91, (5), 1083-1089 (2008).
  10. Deng, X., et al. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. Journal of Clinical Microbiology. 53, (1), 212-218 (2015).
  11. Anonymous. Microbiology Laboratory Guidebook. Available from: https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook (2018).
  12. Andrews, W. H., Wang, H., Jacobson, A., Hammack, T. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella. Available from: https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm (2018).
  13. Malorny, B., et al. Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology. 70, (12), 7046-7052 (2004).
  14. June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study. Journal of AOAC International. 78, (2), 375-380 (1995).
  15. Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load. Journal of Food Protection. 62, (1), 16-21 (1999).
  16. Wood, D. E., Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biology. 15, (3), R46 (2014).
  17. Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data. PeerJ Computer Science. 1, (e20), (2015).
  18. Zhang, S., et al. Salmonella serotype determination utilizing high-throughput genome sequencing data. Journal of Clinical Microbiology. 53, (5), 1685-1692 (2015).
  19. Rodrigue, S., et al. Whole genome amplification and de novo assembly of single bacterial cells. PLoS One. 4, (9), e6864 (2009).
  20. Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria. Front Public Health. 2, 103 (2014).
ניתוח קוואזי-metagenomic של <em>סלמונלה</em> מזון, סביבתית דגימות
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).More

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter