Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

खाद्य और पर्यावरणीय नमूनों से साल्मोनेला का अर्ध-metagenomic विश्लेषण

doi: 10.3791/58612 Published: October 25, 2018

Summary

यहां, हम एक प्रोटोकॉल प्रस्तुत करने के लिए भोजन और पर्यावरण microbiomes से डीएनए नमूने तैयार करने के लिए और quasimetagenomic अनुक्रमण के माध्यम से साल्मोनेला के के उपलेखन का पता लगाने । संस्कृति संवर्धन के संयुक्त उपयोग, immunomagnetic जुदाई (आईएमएस), और कई विस्थापन प्रवर्धन (एमडीए) भोजन और पर्यावरण के नमूनों से साल्मोनेला जीनोमिक डीएनए की प्रभावी एकाग्रता की अनुमति देता है ।

Abstract

अर्ध-metagenomics अनुक्रमण खाद्य और पर्यावरणीय नमूनों की संशोधित microbiomes के अनुक्रमण आधारित विश्लेषण करने के लिए संदर्भित करता है । इस प्रोटोकॉल में, microbiome संशोधन एक लक्ष्य के जीनोमिक डीएनए ध्यान केंद्रित करने के लिए डिज़ाइन किया गया है foodborne रोगज़नक़ contaminant एक कार्यप्रवाह में रोगज़नक़ के पता लगाने और उपलेखन की सुविधा के लिए. यहां, हम समझाने और अल्फला अंकुरित, जमीन काली मिर्च, जमीन बीफ़, चिकन स्तन सहित प्रतिनिधि खाद्य और पर्यावरणीय नमूनों से साल्मोनेला enterica के अर्ध-metagenomics विश्लेषण के लिए नमूना तैयारी कदम का प्रदर्शन और पर्यावरणीय झाड़ू । नमूने पहले एक छोटा और समायोज्य अवधि (4-24 एच) के लिए साल्मोनेला के संस्कृति संवर्धन के अधीन हैं । साल्मोनेला कोशिकाओं को तो चुनिंदा immunomagnetic जुदाई (आईएमएस) द्वारा संवर्धन संस्कृति से कब्जा कर रहे हैं । अंत में, एकाधिक विस्थापन प्रवर्धन (एमडीए) आईएमएस से डीएनए बढ़ाना-कोशिकाओं पर कब्जा किया है । इस प्रोटोकॉल के डीएनए उत्पादन उच्च प्रवाह अनुक्रमण प्लेटफार्मों द्वारा अनुक्रम किया जा सकता है । एक वैकल्पिक मात्रात्मक पीसीआर विश्लेषण साल्मोनेला का पता लगाने के लिए अनुक्रमण की जगह या अनुक्रमण से पहले साल्मोनेला डीएनए की एकाग्रता का आकलन करने के लिए किया जा सकता है ।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Metagenomics अनुक्रमण सैद्धांतिक रूप से foodborne रोगजनकों के ठोस पहचान और टाइपिंग की अनुमति देता है । हालांकि, खाद्य नमूनों खाद्य microbiome के प्रत्यक्ष अनुक्रमण द्वारा रोगज़नक़ विश्लेषण करने के लिए चुनौतियों वर्तमान । सबसे पहले, foodborne रोगजनकों अक्सर भोजन के नमूनों में निम्न स्तर पर मौजूद हैं । व्यावसायिक रूप से उपलब्ध तेजी से पता लगाने के अधिकांश तरीकों अभी भी 8-48 एच संवर्धन एक जासूसी स्तर1के लिए रोगज़नक़ कोशिकाओं को समृद्ध करने की आवश्यकता है । दूसरा, कई खाद्य पदार्थ प्रचुर मात्रा में माइक्रोफ्लोरा कोशिकाओं और/या भोजन डीएनए, foodborne रोगजनक डीएनए खाद्य metagenome का एक छोटा सा अंश और पता लगाने और प्रत्यक्ष metagenomic अनुक्रमण द्वारा उपलेखन के लिए एक मायावी लक्ष्य बना रहे हैं ।

खाद्य microbiomes के संशोधन के लिए पर्याप्त एकाग्रता की अनुमति दी गई है foodborne रोगज़नक़ डीएनए के अनुक्रमण आधारित पता लगाने की सुविधा के लिए शिगा विष के उत्पादन ई कोलाई2,3 और साल्मोनेला enterica4. क्योंकि संशोधित खाद्य microbiomes अभी भी अलग माइक्रोबियल प्रजातियों के मिश्रण हैं, उनके अनुक्रमण अर्ध metagenomic विश्लेषण4के रूप में किया जाता है । Microbiome संशोधन संस्कृति संवर्धन अकेले2,3 या immunomagnetic जुदाई (आईएमएस) और एकाधिक विस्थापन प्रवर्धन (एमडीए)4,5के साथ संयोजन में द्वारा किया जा सकता है । आईएमएस चुनिंदा एंटीबॉडी-लेपित चुंबकीय मोतियों के माध्यम से संवर्धन संस्कृति से रोगज़नक़ कोशिकाओं पर कब्जा कर सकते हैं । एमडीए बहुत कुशल ɸ29 डीएनए पोलीमरेज़6के माध्यम से अनुक्रमण के लिए जीनोमिक डीएनए के पर्याप्त मात्रा में उत्पन्न कर सकते हैं. आईएमएस-एमडीए ने संस्कृति-नैदानिक नमूने से स्वतंत्र रोगज़नक़ पता लगाने की अनुमति दी है7, और अर्ध के लिए संस्कृति संवर्धन का छोटा metagenomic का पता लगाने और खाद्य नमूनों में साल्मोनेला के उपलेखन4

इस विधि का समग्र लक्ष्य साल्मोनेला जीनोमिक डीएनए और बाद में पता लगाने और अनुक्रमण द्वारा साल्मोनेला contaminant के उपलेखन के लक्षित एकाग्रता की अनुमति देने के लिए भोजन के नमूनों से अर्ध-metagenomic डीएनए तैयार करने के लिए है । साल्मोनेला डिटेक्शन के लिए मानक तरीकों की तुलना में8,9 और टंकण10, quasimetagenomic दृष्टिकोण काफी प्रदूषित भोजन और पर्यावरण के नमूनों से बदलाव समय छोटा कर सकते है एक ही कार्यप्रवाह में दो आम तौर पर अलग विश्लेषण को एकीकृत करके रोगज़नक़ के आणविक उपप्रकार । इस विधि foodborne प्रकोप प्रतिक्रिया और अन्य ट्रेस वापस जांच के रूप में अनुप्रयोगों के लिए विशेष रूप से उपयोगी है जहां मजबूत रोगजनक टाइपिंग रोगज़नक़ का पता लगाने और तेजी से विश्लेषणात्मक बदलाव के अलावा आवश्यक है महत्वपूर्ण है ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. नमूना तैयारी

नोट: खाद्य नमूनों को पूर्व संवर्धन के लिए तैयार कर रहे है के अनुसार सूक्ष्म जीव विज्ञान प्रयोगशाला गाइडबुक (MLG) अमेरिका के कृषि खाद्य सुरक्षा और निरीक्षण सेवा (USDA-FSIS)11 और अमेरिका के खाद्य जीवाणु विश्लेषणात्मक मैनुअल (BAM) के विभाग और औषधि प्रशासन (एफडीए)12.

  1. Aseptically इस तरह काली मिर्च, चिकन स्तन, जमीन बीफ़, और अल्फला अंकुरित या एक अंतर्निहित फिल्टर के साथ एक बाँझ प्रयोगशाला ब्लेंडर बैग में एक पर्यावरण झाड़ू के रूप में खाद्य नमूना के एक 25 ग्राम भाग जगह है । aseptically संवर्धन शोरबा (Rappaport-Vassiliadis, आर. वी.) के साथ एक स्पंज गीला द्वारा एक पर्यावरण झाड़ू तैयार करते हैं । फिर, पूरी सतह या पूर्व निर्धारित क्षेत्र पर झाड़ू खींचें और यह एक प्रयोगशाला ब्लेंडर बैग में जगह है ।

Figure 1
चित्रा 1: प्रतिनिधि खाद्य और साल्मोनेलाके अर्ध-metagenomics का पता लगाने और उपलेखन के लिए पर्यावरणीय नमूने । नमूनों में आर. वी. शोरबा के साथ बाँझ फिल्टर पेट बैग में रखा जाता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

  1. 30 एस के लिए अच्छी तरह से एक प्रयोगशाला ब्लेंडर या हाथ की मालिश का उपयोग कर आर. वी. संवर्धन शोरबा के २२५ मिलीलीटर के साथ प्रत्येक 25 ग्राम नमूना मिश्रण
    नोट: MLG और BAM द्वारा अनुशंसित के रूप में RV शोरबा के वेरिएंट नमूना प्रकार के आधार पर इस्तेमाल किया जा सकता है ।
  2. मशीन नमूना-संवर्धन एक प्रयोगशाला मशीन में ४२ डिग्री सेल्सियस में शोरबा मिश्रण के लिए 4-24 एच ।
  3. मशीन के बाद, एक अलग ५० एमएल केंद्रापसारक ट्यूब में बैग के फ़िल्टर की ओर से संवर्धन शोरबा के एक ५० मिलीलीटर नमूना ले लीजिए ।
  4. homogenate में ठोस मलबे को हटाने के लिए 10 मिनट के लिए १०० x g पर ट्यूब केंद्रापसारक ।
  5. ठीक करने के लिए एक नया ५० एमएल केंद्रापसारक ट्यूब और 3000 पर ट्यूबों-10 मिनट के लिए 6000 x जी के लिए सेल गोली ठीक हो जाना supernatant ।
  6. वैकल्पिक supernatant त्यागें और पुनः द्वारा गोली धोने-सस्पेंशन Peptone पानी (BPW) के 5 मिलीलीटर में और 3000 पर ट्यूबों-6000 × 10 मिनट के लिए जी केंद्रापसारक ।
    नोट: BPW peptone के 10 ग्राम, सोडियम क्लोराइड के 5 ग्राम, disodium फॉस्फेट के ३.५ ग्राम, और आसुत जल के 1 एल में monopotassium फॉस्फेट के १.५ ग्राम भंग करके तैयार कर सकते हैं । अंतिम पीएच ७.२ ± ०.२ 25 डिग्री सेल्सियस पर समायोजित किया जाना चाहिए । 15 मिनट के लिए १२१ º c पर आटोक्लेव । व्यावसायिक रूप से उपलब्ध BPW का उपयोग भी किया जा सकता है.
  7. supernatant त्यागें और BPW के 5 मिलीलीटर में गोली फिर से निलंबित ।

2. Immunomagnetic जुदाई (आईएमएस) और एकाधिक विस्थापन प्रवर्धन (एमडीए)

नोट:-नमूने के बीच क्रॉस-दूषण को रोकने के लिए, एक सुरक्षा कैबिनेट में काम करते हैं, प्रत्येक ट्यूब के लिए पिपेट सुझावों को बदलने के लिए, पिपेट के साथ ट्यूब को छूने से बचने के लिए, और ट्यूबों एक साथ बंद नहीं जगह चुंबकीय स्टैंड में धोने कदम के दौरान ।

  1. नमूना बफर और बर्फ पर या अग्रिम में 4 डिग्री सेल्सियस पर एमडीए किट से प्रतिक्रिया बफर गल ।
  2. BPW में १.५ मिलीलीटर microcentrifuge ट्यूबों में विरोधीसाल्मोनेला मोतियों की 20 μL के साथ फिर से निलंबित सेल गोली की 1 मिलीलीटर मिक्स और इसे घूर्णन मिक्सर पर कमरे के तापमान पर 30 मिनट के लिए जगह है ।
    नोट: प्रतिस्पर्धी वनस्पति, वसा कण, और resuspend कर गोली में प्रोटीन आईएमएस के साथ हस्तक्षेप कर सकते हैं । BPW में पुनः निलंबित सेल गोली के कमजोर पड़ने से धोने चरणों के दौरान चुंबकीय स्टैंड से मनका-साल्मोनेला परिसरों के नुकसान को कम करने में सहायक है ।
  3. चुंबकीय स्टैंड में ट्यूबों डालें और रैक कई बार पलटना द्वारा मोती के उचित वसूली के लिए 3 मिनट की अनुमति के लिए ट्यूब की ओर एक गोली में मोती ध्यान ।
  4. चुंबकीय स्टैंड पर ट्यूबों रखें । महाप्राण और प्रत्येक ट्यूब से supernatant त्याग, साथ ही एक ट्यूब की टोपी में शेष तरल ।
    नोट: चुंबक के खिलाफ ट्यूब की ओर दीवार पर आईएमएस मोतियों की गोली परेशान करने के लिए नहीं सावधान रहना ।
  5. चुंबकीय स्टैंड से ट्यूब धारक निकालें और धोने बफर के 1 मिलीलीटर जोड़ें (०.०५% (वी/वी) polysorbate 20) और कई बार पलटना परिसर से गैर विशेष रूप से बाध्यकारी बैक्टीरिया को दूर करने के लिए ।
  6. दोहराएं चरण 2.3-2.5 दो बार ।
  7. 3आरडी धोने के बाद, दोहरा कदम 2.3 – 2.4 द्वारा मोतियों की अंतिम चुंबकीय जुदाई प्रदर्शन । चुंबकीय रैक से ट्यूबों निकालें और उंहें 1 एस के लिए एक microfuge में जगह मोतियों नीचे स्पिन । फिर, किसी भी अवशिष्ट धोने बफर हटाने से पहले 3 मिनट के लिए चुंबकीय रैक में ट्यूबों जगह है ।
  8. मनका-साल्मोनेला परिसरों नमूना बफर के 9 μL में और विकार के लिए 3 मिनट के लिए ९५ डिग्री सेल्सियस पर मशीन को फिर से निलंबित ।
  9. बर्फ पर 4 डिग्री सेल्सियस के लिए ठंडा करने के बाद, एंजाइम मिश्रण की प्रतिक्रिया बफर प्लस 1 μL के 9 μL के साथ गठबंधन और बर्फ पर रखने के लिए ।
  10. एक थर्मल साइकिल चालक में, 30 डिग्री सेल्सियस पर के लिए 2 घंटे के लिए प्रवर्धन, हीटिंग के बाद ६५ ° c में एंजाइम को निष्क्रिय करने के लिए और बर्फ पर 4 डिग्री सेल्सियस शांत करने के लिए गर्मी ट्यूब ।
  11. एक fluorospectrometer साधन पर डीएनए एकाग्रता और पवित्रता (260/280 अनुपात > १.८) को मापने के द्वारा एमडीए उत्पादों की मात्रा और गुणवत्ता का आकलन करें ।
    नोट: आईएमएस मोतियों की गैर विशिष्ट बंधन के कारण, साल्मोनेला के अलावा अन्य जीवों से जीनोमिक डीएनए एमडीए उत्पादों में मौजूद होने की संभावना है, लेकिन यह बहाव विश्लेषण को प्रभावित नहीं करता है.
  12. वास्तविक समय पीसीआर और/या quasimetagenomics अनुक्रमण के लिए पुस्तकालय की तैयारी के लिए उपयोग जब तक अंतिम उत्पादों (20 μL) पर-20 डिग्री सेल्सियस स्टोर ।

3. रीयल टाइम पीसीआर

नोट: यह चरण 1 के लिए वैकल्पिक है) साल्मोनेला का पता लगाने के बिना टाइपिंग, और 2) quasimetagenomics अनुक्रमण करने से पहले नमूना गुणवत्ता का आकलन.

  1. प्रति नमूना 18 μL तैयार करें, जिसमें यूनिवर्सल पीसीआर मास्टर मिक्स (10 μL), फॉरवर्ड प्राइमरी (2 μL, ९०० एनएम), रिवर्स प्राइमर (2 μL, ९०० एनएम), जांच (2 μL, २५० एनएम), और आणविक ग्रेड वाटर (2 μL) शामिल हैं ।
    नोट: साल्मोनेला-विशिष्ट oligonucleotide प्राइमरों (फॉरवर्ड: CTCACCAGGAGATTACAACATGG, रिवर्स: AGCTCAGACCAAAAGTGACCATC) और जांच के लिए ttr जीन के भीतर एक ९४-बीपी अनुक्रम बढ़ाना डिजाइन किए गए थे (GenBank प्रवेश नहीं । AF २८२२६८)13.
  2. एक निलंबन बनाने के लिए तरल के साथ धीरे pipetting ऊपर और नीचे मनका-साल्मोनेला परिसरों द्वारा कदम २.१२ से एमडीए उत्पाद मिक्स । निलंबन के 2 μL को पीसीआर मिक्सचर के 18 μL में डालें ।
  3. एक अनुकूलित वास्तविक समय पीसीआर प्रोटोकॉल का उपयोग कर वास्तविक समय पीसीआर भागो, दो होल्डिंग अवधि, 2 मिनट के लिए ५० डिग्री सेल्सियस पर एक और ९५ डिग्री सेल्सियस पर एक दूसरे के लिए 10 मिनट के लिए, ९५ ° c के ४० चक्र के बाद के लिए 15 एस और ६० डिग्री सेल्सियस के लिए ६० एस ।
  4. दहलीज चक्र की गणना (सीटी), जो प्रवर्धित डीएनए से प्रतिदीप्ति के लिए आवश्यक चक्र सीमा रेखा को पार करने के लिए की संख्या है ।
    नोट: सीमा रेखा आधार रेखा और नमूनों के प्रवर्धन भूखंडों के पठार के बीच रैखिक चरण में सेट है । नकारात्मक परिणाम ४० या सीटी मूल्यों नकारात्मक नियंत्रण की तुलना में अधिक के साथ नमूनों पर सीटी मूल्यों के अनुरूप है ।

4. Quasimetagenomic अनुक्रमण के लिए पुस्तकालय की तैयारी

नोट: एमडीए उत्पादों दोनों कम पढ़ा और लंबे समय तक पढ़ा (ट्विटर) sequencing प्लेटफार्मों द्वारा अनुक्रम किया जा सकता है । sequencing प्लेटफार्मों के निर्माताओं द्वारा प्रदान की डीएनए पुस्तकालय तैयारी किट के नवीनतम संस्करण का प्रयोग करें । ' निर्माताओं के निर्देश के अनुसार डीएनए लाइब्रेरी तैयारी करते हैं । लंबी पढ़ी जाने वाली sequencing प्लेटफ़ॉर्म5के लिए लाइब्रेरी तैयारी के लिए 2d कम-इनपुट जीनोमिक डीएनए प्रोटोकॉल का उपयोग करें । लघु-पठन sequencing प्लेटफ़ॉर्म के लिए लायब्रेरी तैयारी के लिए, निर्माता के प्रोटोकॉल में छोटे संशोधन नीचे दिए गए हैं ।

  1. एमडीए उत्पादों के लिए बफर समाधान और रिएजेंट जोड़कर मानक पुस्तकालय तैयारी विधियों का पालन करें । एक नई प्लेट के लिए अनुक्रमण prepped एमडीए उत्पादों के ४० μL स्थानांतरण और प्रत्येक अच्छी तरह से पीसीआर शोधन मोतियों की 20 μL जोड़ें ।
  2. मिलाते हुए बिना 10 मिनट के लिए कमरे के तापमान पर थाली मशीन ।
  3. ८०% इथेनॉल के साथ मोती धोने और 12 मिनट के लिए मोती सूखी ।
  4. पुनः निलंबन बफर के ५३ μL में सूखे मोतियों को निरस्त करने और मिलाते हुए बिना 2 मिनट के लिए मशीन ।
  5. पतला और निर्माता के निर्देश के बाद पूल पुस्तकालयों ।
    नोट: एक 10 बजे परित और विकृत पुस्तकालय अब अनुक्रम बनने के लिए तैयार है ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

quasimetagenomic अनुक्रमण करने से पहले, कुल मात्रा और आईएमएस-एमडीए उत्पादों की शुद्धता fluorospectrometer (तालिका 1) द्वारा मूल्यांकन किया जा सकता है ।

संवर्धन समय (एच) सीटी वैल्यू एकाग्रता (एनजी उल/ शुद्धता (260/280)
ब्रांड ए 4 २४.७१ ८१२.९१ १.८९
8 २५.८० ९००.३६ १.८७
12 १५.४१ ७५३.८८ १.८४
ब्रांड बी 4 २०.६३ ८७२.६१ १.८७
8 २२.६१ ९९३.४१ १.८७
12 १९.०८ ९५४.४४ १.८७

तालिका 1: अर्ध-metagenomic अनुक्रमण के लिए डीएनए नमूनों की गुणवत्ता और मात्रा का आकलन । साल्मोनेला कोशिकाओं में दो ब्रांडों के कच्चे चिकन स्तन के 25 ग्राम में inoculated थे 1 CFU/जी inoculated नमूने आईएमएस-एमडीए से पहले 4, 8, और 12 एच के लिए RV में समृद्ध थे ।

साल्मोनेला डीएनए के लक्षित मात्रा आकलन वास्तविक समय पीसीआर (तालिका 1 और चित्रा 2) है, जो भी साल्मोनेला का पता लगाने के लिए एक विकल्प के रूप में कार्य करता है अगर उपलेखन की जरूरत नहीं है द्वारा किया जा सकता है ।

Figure 2
चित्रा 2: साल्मोनेला का पता लगाने या अर्ध-metagenomics अनुक्रमण के लिए नमूना आकलन के लिए वास्तविक समय पीसीआर । साल्मोनेला डीएनए की वास्तविक समय पीसीआर के प्रवर्धन घटता आईएमएस-एमडीए उत्पादों में 4, 8 और 12 के बाद संवर्धन समय के एच दिखाया जाता है । केवल 2 एच संवर्धन के बाद एक नमूना भी शामिल है । साल्मोनेला कोशिकाएं (०.२७ CFU/जी) दो ब्रांडों से कच्चे चिकन स्तन के 25 ग्राम inoculated थे a और B. कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें

Fluorospectrometer रीडिंग नमूना तैयारी के प्रारंभिक मूल्यांकन की अनुमति दें । आईएमएस-एमडीए साल्मोनेला दूषित चिकन स्तन नमूने से तैयार उत्पादों की एकाग्रता ७०१.५४ से ९४५.८६ एनजी/µ एल, सुझाव है कि नमूना डीएनए परिलक्षित किया गया है । निर्माता के मार्गदर्शन के अनुसार, कम पढ़ने के लिए ंयूनतम डीएनए नमूना एकाग्रता और लंबे समय तक पढ़ें अनुक्रमण ०.२ एनजी/µ एल और 1 µ जी, क्रमशः है । 260/280 अनुपात १.८५ से १.८८ (तालिका 1) से लेकर, प्रोटीन संक्रमण के कम स्तर के साथ डीएनए नमूनों की उच्च शुद्धता दिखा ।

कम सीटी मान नमूने में साल्मोनेला जीनोमिक डीएनए के उच्च सांद्रता संकेत मिलता है । के रूप में तालिका 1 और चित्रा 2में दिखाया गया है, आईएमएस के सीटी मूल्यों-एमडीए उत्पादों संवर्धन समय बढ़ जाती है के रूप में कमी । हमारे पिछले अध्ययन में4, जब सीटी मूल्यों से कम थे 25, बहुमत (> 50%) के एसई जीनोम के अनुक्रम होने की संभावना थी, और कच्चे अनुक्रमण से सीरोटाइप भविष्यवाणी सफल रहा था पढ़ता है ।

असफल संस्कृति संवर्धन या आईएमएस एक अपेक्षाकृत उच्च सीटी अंतिम नमूना में साल्मोनेला जीनोमिक डीएनए की कम एकाग्रता का संकेत के रूप में चित्रा 2में दिखाया गया मूल्यों में परिणाम कर सकते हैं । यह एक उच्च डीएनए एकाग्रता और आईएमएस-एमडीए उत्पादों की पवित्रता के रूप में fluorospectrometer रीडिंग द्वारा सुझाए के बावजूद हो सकता है ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

क्योंकि अक्सर-कम बहुतायत और खाद्य और पर्यावरणीय नमूनों में साल्मोनेला की समरूप उपस्थिति में, संस्कृति संवर्धन से पहले आईएमएस-एमडीए अभी भी साल्मोनेला का पता लगाने और उपलेखन के लिए आवश्यक है; इसलिए यह प्रोटोकॉल का एक महत्वपूर्ण कदम है । इष्टतम शर्तों की पहचान करने के लिए नमूना पृष्ठभूमि वनस्पति के सापेक्ष साल्मोनेला की बहुतायत बढ़ाने के लिए, विभिंन संवर्धन मीडिया विशिष्ट नमूनों के लिए मूल्यांकन किया जा सकता है । MLG और BAM के अनुसार, ऐसे आर. वी. शोरबा और गैर-चयनात्मक माध्यम जैसे कि बफर peptone पानी और लैक्टोज शोरबा जैसे दोनों चुनिंदा माध्यम भोजन के नमूनों से साल्मोनेला संवर्धन के लिए इस्तेमाल किया जा सकता है । ४२ ° c पर RV का उपयोग कच्चे चिकन मांस, हिमखंड सलाद पत्ता और काले कालीमिर्च से साल्मोनेला संवर्धन के लिए हमारे पिछले अध्ययन4 में मूल्यांकन किया गया है रोगज़नक़ के quasimetagenomic विश्लेषण का समर्थन करने के लिए । एफडीए BAM और AOAC सहयोगी8,9और सहयोगी अध्ययन के अनुसार14,15, आर. वी. उच्च माइक्रोबियल और कम माइक्रोबियल लोड खाद्य पदार्थों के विश्लेषण के लिए सिफारिश की है ।

संस्कृति संवर्धन की इष्टतम अवधि कई कारकों पर निर्भर करता है, जैसे नमूना प्रकार, साल्मोनेला संदूषण के स्तर, और साल्मोनेला contaminant की शारीरिक स्थिति । उदाहरण के लिए, जब साल्मोनेला के निंन स्तर (उदा., < 1 CFU/) कक्ष एक मांस नमूना में मौजूद है और प्रशीतन तनाव के तहत, अब संवर्धन समय (उदा., > 12 एच) को पुनर्जीवित करने और साल्मोनेला कोशिकाओं को समृद्ध करने की जरूरत हो सकती है । संशोधित microbiome में साल्मोनेला की पर्याप्त बहुतायत साल्मोनेला contaminant जीनोम, जो तनाव स्तर एकल न्यूक्लियोटाइड बहुरूपता (SNP)4टाइपिंग की अनुमति दे सकते है की पर्याप्त अनुक्रमण कवरेज की ओर जाता है । छोटा संस्कृति संवर्धन (जैसे, 12 से कम एच) तेजी से पता लगाने के लिए संभवहै 5 या serotyping साल्मोनेला4

साल्मोनेला संदूषण और/या लंबे समय तक संस्कृति संवर्धन के उच्च स्तर दूषित भोजन के नमूनों में संशोधित खाद्य microbiomes में साल्मोनेला जीनोमिक डीएनए के उच्च सांद्रता में परिणाम कर सकते हैं, जो से कम सीटी मूल्यों के लिए नेतृत्व वास्तविक समय पीसीआर विश्लेषण । सीटी मान साल्मोनेला contaminant जीनोम4के अनुक्रमण कवरेज के साथ एक नकारात्मक संबंध प्रदर्शित करते हैं, और इसलिए अनुकूलन और कार्यप्रवाह के संशोधन के लिए इस्तेमाल किया जा सकता है । हमारे अनुभव के अनुसार, संस्कृति संवर्धन, विशेष रूप से इसकी लंबाई, अक्सर समस्या निवारण के प्रयासों का ध्यान केंद्रित है । उदाहरण के लिए, एक कच्चे चिकन स्तन के नमूने से आईएमएस-एमडीए उत्पाद की सीटी मूल्य ३५.९४ (चित्रा 1) में अपेक्षाकृत उच्च था । यह नमूना एसई कोशिकाओं के २.५ CFU/जी के साथ inoculated था और ३७ डिग्री सेल्सियस पर BPW में 2 h. sequencing के लिए इस नमूने के सीरोटाइप पूर्वानुमान की अनुमति देने के लिए एसई जीनोम के पर्याप्त कवरेज प्रदान नहीं किया । इसकी तुलना में, 4 ज या अब संवर्धन के साथ सभी अन्य नमूनों सफलतापूर्वक quasimetagenomic sequencing डेटा (नहीं दिखाया गया डेटा) से serotyped थे.

अनुक्रमण के बाद, हम Kraken16 का उपयोग करने की सिफारिश साल्मोनेला आगे bioinformatics विश्लेषण के लिए पढ़ता है की पहचान । CFSAN SNP पाइपलाइन17 और SeqSero18 SNP टाइपिंग और कच्चे sequencing से serotyping भविष्यवाणी के लिए इस्तेमाल किया जा सकता है, क्रमशः पढ़ता है ।

इस quasimetagenomic तकनीक की कई सीमाएं हैं । पहला, डीएनए एकाग्रता और आईएमएस की पवित्रता-एमडीए एक fluorospectrometer द्वारा मापा उत्पादों उचित नमूना तैयारी के एक प्रारंभिक संकेतक के रूप में ही इस्तेमाल किया जाना चाहिए । एमडीए की उच्च दक्षता के कारण, इनपुट डीएनए की मात्रा का पता लगाने के लिए पर्याप्त पूरे जीनोम अनुक्रमण19परिलक्षित किया जा सकता है । इसलिए, उच्च गुणवत्ता और मात्रा डीएनए नमूने अभी भी उत्पंन किया जा सकता है अगर संस्कृति संवर्धन या आईएमएस को प्रभावी ढंग से साल्मोनेला कोशिकाओं ध्यान में विफल रहता है । वैकल्पिक वास्तविक समय पीसीआर विश्लेषण पूरे नमूना तैयारी कार्यप्रवाह का एक अधिक लक्षित और जानकारीपूर्ण आकलन प्रदान करता है । दूसरा, मुश्किल से संस्कृति साल्मोनेला कोशिकाओं, जैसे व्यवहार्य लेकिन nonculturable (VBNC) बैक्टीरिया20, संस्कृति संवर्धन के दौरान विकसित नहीं हो सकता है । इसलिए, इन कोशिकाओं को हमारी विधि द्वारा नहीं पाया जा सकता है ।

संक्षेप में, पारंपरिक तरीकों के साथ तुलना में, हमारे नमूना तैयारी विधि और अर्ध-metogenomic अनुक्रमण दृष्टिकोण साल्मोनेलासे विश्लेषणात्मक बदलाव की पर्याप्त कमी-दूषित खाद्य और पर्यावरणीय नमूनों की अनुमति दे सकते हैं साल्मोनेला संदूषणों का सुदृढ़ उपलेखन । साल्मोनेलाके अलावा, इस तकनीक की क्षमता को तेजी से और ठोस पता लगाने और अंय foodborne रोगजनकों टाइपिंग के लिए लागू किया जा सकता है ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों की घोषणा है कि वे कोई प्रतिस्पर्धा वित्तीय हितों की है ।

Acknowledgments

लेखक कृपया इस अध्ययन के लिए बैक्टीरियल तनाव और अंय समर्थन प्रदान करने के लिए जॉर्जिया विश्वविद्यालय के मार्क हैरिसन और वेन हिर्श शुक्रिया अदा करना चाहूंगा ।

Materials

Name Company Catalog Number Comments
Laboratory blender bag w/filter VWR 10048-886
Buffered peptone water Oxoid Micorbiology Products CM0509
Rappaport Vassiliadis broth Neogen Acumedia 7730A
Polysorbate 20  Millipore Sigma P9416 Tween 20
Stomacher blender Seward  30010108
Centrifuge Fisher Scientific 75005194
50 mL Centrifuge tubes Fisher Scientific 05-539-6
Thermal Cycler Techne Prime EW-93945-13
StepOne Real-Time Thermal cycler Applied Biosystems 4.76357
AMPure XP beads Beckman Coulter A63881 PCR purification beads; mix well before use; store at 4 °C
Nextera XT library prep kit Illumina FC-131-1024 Store at -80 °C
MinIon library prep kit Oxford Nanopore SQK-LSK108 Store at -80 °C
NanoDrop Thermo Scientific ND-2000
Dynabead Anti-Salmonella beads Applied Biosystems 71002 Vortex well prior to use
Illustra GenomiPhi V2 DNA amplification kit (MDA kit)
-Sample buffer
-Reaction buffer
-Enzyme mix
GE Healthcare 25-6600-30 Store at -80 °C
HulaMixer Invitrogen 15920D
DynaMag magnetic rack Invitrogen 12321D
TaqMan Universal PCR mastermix Applied Biosystems 4304437 Mix well before use; store at 4 °C
Microfuge Fisher Scientific 05-090-100

DOWNLOAD MATERIALS LIST

References

  1. Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens. Critical Reviews in Food Science and Nutrition. 56, (9), 1519-1531 (2016).
  2. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach. Applied and Environmental Microbiology. 81, (23), 8183-8191 (2015).
  3. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS One. 11, (12), e0167870 (2016).
  4. Hyeon, J. Y., et al. Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples. Applied and Environmental Microbiology. (2017).
  5. Hyeon, J. Y., Deng, X. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification. Food Microbiology. 63, 111-116 (2017).
  6. Hosono, S., et al. Unbiased whole-genome amplification directly from clinical samples. Genome Research. 13, (5), 954-964 (2003).
  7. Seth-Smith, H. M., et al. Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture. Genome Research. 23, (5), 855-866 (2013).
  8. Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method. Journal of Food Protection. 75, (2), 400-404 (2012).
  9. Jacobson, A. P., Hammack, T. S., Andrews, W. H. Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method. Journal of AOAC International. 91, (5), 1083-1089 (2008).
  10. Deng, X., et al. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. Journal of Clinical Microbiology. 53, (1), 212-218 (2015).
  11. Anonymous. Microbiology Laboratory Guidebook. Available from: https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook (2018).
  12. Andrews, W. H., Wang, H., Jacobson, A., Hammack, T. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella. Available from: https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm (2018).
  13. Malorny, B., et al. Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology. 70, (12), 7046-7052 (2004).
  14. June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study. Journal of AOAC International. 78, (2), 375-380 (1995).
  15. Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load. Journal of Food Protection. 62, (1), 16-21 (1999).
  16. Wood, D. E., Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biology. 15, (3), R46 (2014).
  17. Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data. PeerJ Computer Science. 1, (e20), (2015).
  18. Zhang, S., et al. Salmonella serotype determination utilizing high-throughput genome sequencing data. Journal of Clinical Microbiology. 53, (5), 1685-1692 (2015).
  19. Rodrigue, S., et al. Whole genome amplification and de novo assembly of single bacterial cells. PLoS One. 4, (9), e6864 (2009).
  20. Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria. Front Public Health. 2, 103 (2014).
खाद्य और पर्यावरणीय नमूनों से <em>साल्मोनेला</em> का अर्ध-metagenomic विश्लेषण
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).More

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter