Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Analisi metagenomica quasi di Salmonella da campioni ambientali e alimentari

doi: 10.3791/58612 Published: October 25, 2018

Summary

Qui, presentiamo un protocollo per preparare campioni di DNA da alimentare e ambientale microbiomi per rilevamento concertato e tipizzazione di Salmonella mediante sequenziamento di quasimetagenomic. L'uso combinato di arricchimento della cultura, separazione immunomagnetica (IMS) e cilindrata più amplificazione (MDA) permette efficace concentrazione del DNA genomico di Salmonella da campioni ambientali e alimentari.

Abstract

Quasi-metagenomica sequenziamento si riferisce all'analisi basata su sequenziamento dei microbiomi modificate di cibo e campioni ambientali. In questo protocollo, microbiome modificazione è progettato per concentrare il DNA genomico di un contaminante di agente patogeno alimentare destinazione per facilitare l'individuazione e definizione di sottotipo dell'agente patogeno in un unico flusso di lavoro. Qui, spiegare e dimostrare la procedura di preparazione del campione per l'analisi metagenomica quasi di Salmonella enterica da alimentari rappresentativi e campioni ambientali tra cui germogli di erba medica, pepe nero macinato, macinato di manzo, petto di pollo e tamponi ambientali. Campioni vengono prima sottoposti all'arricchimento della cultura della Salmonella per una durata ridotta e regolabile (4 – 24 h). Salmonella cellule quindi vengono acquisite in modo selettivo dalla coltura di arricchimento di separazione immunomagnetica (IMS). Infine, amplificazione multipla di cilindrata (MDA) viene eseguita per amplificare il DNA dalle cellule di IMS-catturato. L'output di DNA del presente protocollo possa essere sequenziato da piattaforme di sequenziamento di throughput elevato. Un'analisi PCR quantitativa opzionale può essere eseguita per sostituire sequenziamento per rilevamento di Salmonella o valutare la concentrazione di Salmonella del DNA prima di sequenziamento.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Metagenomica sequenziamento permette teoricamente di rilevamento concertato e tipizzazione di agenti patogeni di origine alimentare. Tuttavia, campioni alimentari presentano sfide all'analisi dell'agente patogeno mediante sequenziamento diretto del microbioma cibo. In primo luogo, patogeni di origine alimentare sono spesso presenti a livelli bassi in campioni alimentari. La maggior parte dei metodi di rilevazione rapida commercialmente disponibili ancora richiedono 8 – 48 h coltura per arricchire patogeni e cellule a un livello rilevabile1. In secondo luogo, molti alimenti contengono abbondante microflora cellule e/o cibo del DNA, che rende il DNA di agenti patogeni di origine alimentare una piccola frazione del metagenoma di cibo e un obiettivo sfuggente per rilevazione e definizione di sottotipo di metagenomica sequenziamento diretto.

Modifica del cibo microbiomi è stato segnalato per consentire la notevole concentrazione di patogeni di origine alimentare DNA per facilitare il rilevamento basato sul sequenziamento di Shiga tossina Escherichia coli2,3 e Salmonella enterica4. Perché alimenti microbiomi sono ancora miscele di differenti specie microbiche, loro sequenziamento è definito come di analisi metagenomica quasi4. Microbioma modifica può essere eseguita da cultura arricchimento da solo2,3 , o in combinazione con separazione immunomagnetica (IMS) e più cilindrata amplificazione (MDA)4,5. IMS è in grado di catturare in modo selettivo patogeni e cellule dalla coltura di arricchimento tramite biglie magnetiche rivestite con anticorpo. MDA può generare una quantità sufficiente di DNA genomico per la sequenza attraverso il ɸ29 altamente efficiente della polimerasi del DNA6. IMS-MDA ha permesso il rilevamento del patogeno coltura-indipendente da campioni clinici7e accorciando l'arricchimento della cultura per il rilevamento di quasi-metagenomica e tipizzazione di Salmonella in campioni di cibo4.

L'obiettivo generale di questo metodo è quello di preparare quasi metagenomici DNA da campioni di alimenti per consentire mirate concentrazione del DNA genomico di Salmonella e successivo rilevamento e sottotipizzazione del contaminante Salmonella mediante sequenziamento. Paragonato ai metodi standard per Salmonella rilevamento8,9 e10di sottotipizzazione, l'approccio di quasimetagenomic sostanzialmente possibile accorciare i tempi di turnaround da alimenti contaminati ed i campioni ambientali sottotipi molecolari dell'agente patogeno unificando i due in genere separata analisi in un unico flusso di lavoro. Questo metodo è particolarmente utile per applicazioni come risposta alle epidemie trasmesse da alimenti e altre indagini di schiena traccia dove robusto patogeno sottotipizzazione è richiesto oltre al rilevamento del patogeno e rapida inversione di tendenza analitica è importante.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. preparazione del campione

Nota: Campioni di prodotti alimentari sono preparati per pre-arricchimento secondo la Guida di laboratorio di microbiologia (MLG) di Stati Uniti Dipartimento di agricoltura sicurezza alimentare e Inspection Service (USDA-FSIS)11 e manuale analitico batteriologico (BAM) della US Food e Drug Administration (FDA)12.

  1. Asetticamente posto una porzione di 25 g di campione di cibo come il pepe nero, petto di pollo, carne macinata e germogli di erba medica o un tampone ambientale in un sacchetto di laboratorio sterile frullatore con un filtro incorporato. Preparare un tampone ambientale inumidendo asetticamente una spugna con brodo di arricchimento (Rappaport-Vassiliadis, RV). Trascinare il tampone su tutta la superficie o area predeterminata, quindi metterlo in un sacchetto di frullatore di laboratorio.

Figure 1
Figura 1: alimentari rappresentativi e campioni ambientali per il rilevamento di quasi-metagenomica e tipizzazione di Salmonella. I campioni vengono inseriti in sacchetti stomacher filtro sterile insieme al brodo di RV. Clicca qui per visualizzare una versione più grande di questa figura.

  1. Miscelare accuratamente ogni campione di 25 g con 225 mL di arricchimento RV brodo utilizzando un massaggio di blender o mano di laboratorio per 30 s.
    Nota: Varianti di brodo RV come consigliato da MLG e BAM possono essere utilizzati a seconda dei tipi di campione.
  2. Incubare la miscela di brodo di arricchimento del campione in un incubatore da laboratorio a 42 ° C per 4 – 24 h.
  3. Dopo l'incubazione, è necessario raccogliere un sottocampione di 50 mL di brodo di arricchimento dal lato filtrato della borsa in una provetta da centrifuga separata 50 mL.
  4. Centrifugare la provetta a 100 x g per 10 min rimuovere detriti solidi nell'omogeneato.
  5. Recuperare il surnatante attentamente per un nuovo 50 mL Centrifugare la provetta e centrifugare le provette a 3.000-6.000 x g per 10 min recuperare il pellet cellulare.
  6. (Opzionale) Scartare il surnatante e lavare la pallina di risospensione in 5ml di Buffered Peptone Water (BPW) e centrifugare le provette a 3.000-6.000 × g per 10 min.
    Nota: BPW può preparato dalla dissoluzione 10 g di peptone, 5 g di cloruro di sodio, 3,5 g di disodio fosfato, e 1,5 g di fosfato monopotassico in 1 L di acqua distillata. Il pH finale deve essere regolato a 7,2 ± 0,2 a 25 ° C. Utilizzabile anche sterilizzare in autoclave a 121 ° c per 15 min. BPW commercialmente disponibili.
  7. Eliminare il surnatante e risospendere il pellet in 5 mL di BPW.

2. immunomagnetica separazione (IMS) e amplificazione multipla di cilindrata (MDA)

Nota: Per evitare contaminazioni tra campioni, lavorare in una cappa di biosicurezza, cambiare i puntali delle pipette per ogni tubo, evitare di toccare il tubo con la pipetta e non collocare tubi ravvicinati in stand magnetico durante la fase di lavaggio.

  1. Scongelare la sample buffer e il buffer di reazione dal kit di MDA in ghiaccio o a 4 ° C in anticipo.
  2. Mescolare 1 mL di ri-sospensione cellulare a pellet a BPW con 20 μL di anti -Salmonella perline in provette per microcentrifuga da 1,5 mL e posizionarlo sul miscelatore rotante per 30 min a temperatura ambiente.
    Nota: Flora competitiva, particelle di grasso e proteine nel sedimento risospeso possono interferire con IMS. Diluizione di pellet cellulare risospeso in BPW è utile per ridurre la perdita dei complessi perle -Salmonella dal supporto magnetico durante fasi di lavaggio.
  3. Inserire le provette nel supporto magnetico e consentire 3 min per il corretto recupero dei branelli capovolgendo il rack diverse volte a concentrare le perle in una pallina sul lato del tubo.
  4. Mantenere le provette sul supporto magnetico. Aspirare e scartare il surnatante da ciascuna provetta, come pure il liquido restante nel tappo di ogni tubo.
    Nota: Fare attenzione a non disturbare il pellet di perline IMS sulla parete laterale del tubo contro il magnete.
  5. Rimuovere il supporto del tubo dal supporto magnetico e aggiungere 1 mL di tampone di lavaggio (PBS contenente 0,05% (v/v) polisorbato 20) e capovolgendo per rimuovere batteri di legame non specifico dal complesso.
  6. Ripetere i passaggi da 2.3 – 2.5 due volte.
  7. Dopo il lavaggio 3rd , eseguire la definitiva separazione magnetica di perline ripetendo i passaggi 2.3 – 2.4. Rimuovere i tubi dal rack magnetico e metterli in un microfuge per 1 s per far girare giù perline. Quindi, posizionare i tubi nel rack magnetico per 3 minuti prima di togliere qualsiasi residuo di tampone.
  8. Risospendere i complessi diSalmonella perle - in 9 μL di tampone del campione e incubare a 95 ° C per 3 min per denaturazione.
  9. Dopo raffreddamento a 4 ° C il ghiaccio, si combinano con 9 μL di tampone di reazione più 1 μL di enzima mescolare e tenere sul ghiaccio.
  10. In un termociclatore, incubare le provette a 30 ° C per 2 h per l'amplificazione, seguita da riscaldamento a 65 ° C per 10 min per inattivare l'enzima e raffreddare a 4 ° C sul ghiaccio.
  11. Valutare la quantità e la qualità dei prodotti MDA misurando la concentrazione del DNA e la purezza (260/280 ratio > 1,8) su uno strumento di fluorospectrometer.
    Nota: A causa del legame non specifico di perline IMS, DNA genomico da organismi diversi da Salmonella è probabile che sia presente nei prodotti di MDA, ma non influisce sulla analisi a valle.
  12. Conservare i prodotti finali (20 μL) a-20 ° C fino a uso per PCR Real-Time e/o preparazione di libreria per il sequenziamento di quasimetagenomics.

3. Real-Time PCR

Nota: Questo passaggio è facoltativo per 1) rilevazione di Salmonella senza sottotipi e 2) valutare la qualità del campione prima del sequenziamento di quasimetagenomics.

  1. Preparare 18 μL di miscela PCR per campione, contenente Universal PCR Master Mix (10 μL), forward primer (2 μL, 900 nM), reverse primer (2 μL, 900 nM), sonda (2 μL, 250 nM) e acqua di grado molecolare (2 μL).
    Nota: Salmonella-iniettori del oligonucleotide specifico (in avanti: CTCACCAGGAGATTACAACATGG, reverse: AGCTCAGACCAAAAGTGACCATC) e sonda sono stati progettati per amplificare una sequenza di 94 punti di ebollizione all'interno del gene ttr (accessione no. AF 282268)13.
  2. Mescolare il prodotto MDA dal punto 2.12 pipettando delicatamente su e giù per perle -Salmonella complessi con liquido per creare una sospensione. Aggiungere 2 μL della sospensione in 18 μL di miscela PCR.
  3. Eseguire PCR in tempo reale utilizzando un protocollo PCR in tempo reale ottimizzato, specificando due periodi di detenzione, uno a 50 ° C per 2 min e un altro a 95 ° C per 10 minuti, seguiti da 40 cicli di 95 ° C per 15 s e 60 ° C per 60 s.
  4. Calcolare il ciclo soglia (Ct), che è il numero di cicli necessari per la fluorescenza da DNA amplificato per attraversare la linea di soglia.
    Nota: La linea di soglia è impostata nella fase lineare tra la linea di base e Altopiano degli appezzamenti amplificazione di campioni. Risultati negativi corrispondono a valori Ct su 40 o campioni con valori di Ct superiori a quella del controllo negativo.

4. Biblioteca preparazione per il sequenziamento di Quasimetagenomic

Nota: I prodotti MDA possono essere ordinati in sequenza da entrambi breve leggere e lungo leggere (nanopore) piattaforme di sequenziamento. Utilizzare l'ultima versione del kit di preparazione libreria del DNA forniti dai produttori delle piattaforme di sequenziamento. Eseguire la preparazione libreria DNA seguendo le istruzioni dei produttori. Utilizzare il protocollo di DNA genomico basso input 2D per la preparazione di libreria per il sequenziamento di lungo-ha letto piattaforma5. Per la preparazione di biblioteca per la piattaforma di sequenziamento di breve-lettura, piccole modifiche al protocollo del produttore sono fornite di seguito.

  1. Seguire metodi di preparazione di libreria standard con l'aggiunta di soluzioni tampone e reagenti ai prodotti MDA. Trasferimento 40 μL di sequenziamento prepped MDA prodotti per una nuova piastra e aggiungere 20 μL di perle di purificazione di PCR in ciascun pozzetto.
  2. Incubare la piastra a temperatura ambiente per 10 min senza agitare.
  3. Le perline con 80% di etanolo di lavare e asciugare le perline per 12 min.
  4. Risospendere secchi perline in 53 μL di tampone di risospensione e incubare per 2 minuti senza agitazione.
  5. Diluire e librerie seguendo le istruzioni del fabbricante della piscina.
    Nota: Un 22 riuniti e Biblioteca denaturato è ora pronto ad essere sequenziata.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Prima del sequenziamento di quasimetagenomic, la quantità e la purezza dei prodotti IMS-MDA globale possono essere valutate dal fluorospectrometer (tabella 1).

Tempo di arricchimento (h) Valore di CT Concentrazione (ng/ul) Purezza (260/280)
Marca A 4 24,71 812.91 1,89
8 25.80 900.36 1,87
12 15,41 753.88 1.84
Marchio B 4 20,63 872.61 1,87
8 22,61 993.41 1,87
12 19.08 954.44 1,87

Tabella 1: valutazione di qualità e la quantità di DNA campioni per il sequenziamento di quasi-metagenomica. Sono state inoculate cellule di Salmonella in 25 g di petto di pollo crudo delle due marche a 1 CFU/g. inoculate campioni sono stati arricchiti nel camper per 4, 8 e 12 h prima IMS-MDA.

Valutazione di quantità mirata di Salmonella del DNA può essere eseguita mediante PCR in tempo reale (tabella 1 e Figura 2), che serve anche come alternativa per il rilevamento di Salmonella , se non è richiesta la definizione di sottotipo.

Figure 2
Figura 2: Real-Time PCR per la valutazione del rilevamento o campione Salmonella per il sequenziamento di quasi-metagenomica. Curve di amplificazione di PCR in tempo reale di Salmonella del DNA nei prodotti IMS-MDA dopo 4, 8 e 12 ore di tempo di arricchimento sono illustrate. È incluso anche un campione dopo solo arricchimento di 2h. Cellule di Salmonella (0.27 CFU/g) sono stati inoculati 25 g di petto di pollo crudo da due marchi A e B. Clicca qui per visualizzare una versione più grande di questa figura.

Letture di fluorospectrometer permettono la valutazione iniziale della preparazione del campione. Concentrazione di prodotti IMS-MDA da Salmonella campioni contaminati petto di pollo ha variati da 701.54 a 945.86 ng / µ l, suggerendo che il DNA del campione è stato amplificato. Secondo indicazioni del produttore, la concentrazione minima di campione di DNA per breve leggere e leggere lungo sequenziamento è 0,2 ng / µ l e 1 µ g, rispettivamente. Il rapporto di 260/280 ha variato da 1,85 a 1,88 (tabella 1), risultati di elevata purezza dei campioni del DNA con bassi livelli di contaminazione della proteina.

Valori inferiori di Ct indicano concentrazioni più elevate di DNA genomico di Salmonella nel campione. Come illustrato nella tabella 1 e Figura 2, i valori di Ct dei prodotti IMS-MDA diminuiscono come aumento del tempo di arricchimento. Nel nostro precedente studio4, quando i valori di Ct erano inferiori a 25, la maggior parte (> 50%) della SE era probabile da sequenziare genoma e sierotipo previsione da letture di sequenziamento crudo era successo.

Arricchimento della cultura infruttuoso o IMS può provocare un relativamente elevati valori di Ct che indica bassa concentrazione del DNA genomico di Salmonella nel campione finale come mostrato nella Figura 2. Questo problema può verificarsi nonostante un alta concentrazione di DNA e la purezza dei prodotti IMS-MDA come suggerito dal fluorospectrometer letture.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

A causa della spesso-bassa abbondanza e omogenei in presenza di Salmonella negli alimenti e nei campioni ambientali, arricchimento di cultura prima di IMS-MDA è ancora necessario per il rilevamento di Salmonella e subtyping; è quindi un passo fondamentale del protocollo. Per identificare le condizioni ottimali per aumentare l'abbondanza di Salmonella relativa flora sfondo campione, media diversi arricchimento può essere valutata per gli esempi specifici. Secondo MLG e BAM, sia terreno selettivo come brodo di RV e mezzo non selettivo come Brodo peptone tamponato di acqua e lattosio può essere utilizzati per l'arricchimento di Salmonella da campioni alimentari. L'utilizzo di RV a 42 ° C è stata valutata nel nostro precedente studio4 per l'arricchimento di Salmonella da carne di pollo crudo, lattuga iceberg e grani di pepe neri a supporto dell'analisi quasimetagenomic dell'agente patogeno. Secondo FDA BAM e AOAC precollaborative8,9e studi collaborativi14,15, RV è raccomandato per l'analisi degli alimenti ad alta carica microbica microbica e basso.

La durata ottimale di arricchimento della cultura dipende da molteplici fattori, come tipo di campione, livello di contaminazione da Salmonella e lo stato fisiologico del contaminante Salmonella . Ad esempio, quando bassi livelli di Salmonella (ad esempio, < 1 CFU/g) le cellule sono presenti in un campione di carne e sotto stress di refrigerazione, più tempo di arricchimento (ad es., > 12 h) può essere necessarie per rilanciare e arricchire le cellule Salmonella . Sufficiente abbondanza di Salmonella nel microbioma modificato porta alla copertura adeguata sequenziamento del genoma di contaminante Salmonella , che possa consentire il polimorfismo a singolo nucleotide ceppo-livello (SNP) digitando4. Arricchimento di cultura più breve (ad esempio, meno di 12 h) sono possibile per il rilevamento rapido5 o classificazione secondo il sierotipo di Salmonella4.

I livelli elevati di contaminazione da Salmonella e/o arricchimento di cultura più lungo di campioni di alimenti contaminati può provocare nelle più alte concentrazioni di DNA genomic di Salmonella in alimenti modificati microbiomi, che conducono per abbassare i valori di Ct dalla analisi PCR in tempo reale. I valori CT visualizzare una correlazione negativa con copertura di sequenziamento del genoma contaminante Salmonella 4e pertanto possono essere utilizzati per l'ottimizzazione e la modifica del flusso di lavoro. Secondo la nostra esperienza, arricchimento della cultura, soprattutto la lunghezza di esso, è spesso al centro di risoluzione dei problemi di sforzi. Ad esempio, il valore di Ct del prodotto IMS-MDA da un campione di petto di pollo crudo era relativamente elevato alle 35.94 (Figura 1). In questo esempio è stato inoculato con 2,5 CFU/g di cellule SE ed incubato in BPW a 37 ° C per 2 h. sequenziamento di questo esempio non ha fornito sufficiente copertura del genoma SE consentire sierotipo pronostico. In confronto, tutti gli altri campioni con 4h o arricchimento più lungo sono stati correttamente classific secondo il sierotipoare da dati di sequenziamento di quasimetagenomic (dati non mostrati).

Dopo la sequenziazione, si consiglia di utilizzando il Kraken16 per identificare Salmonella legge per ulteriori analisi di bioinformatica. CFSAN SNP pipeline17 e SeqSero18 può essere utilizzati per SNP digitando e sierotipizzazione Pronostico da letture di sequenziamento crudo, rispettivamente.

Questa tecnica di quasimetagenomic ha diversi limiti. In primo luogo, concentrazione del DNA e la purezza dei prodotti IMS-MDA misurato da un fluorospectrometer dovrebbe essere utilizzati solo come un indicatore di preliminare di preparazione del campione corretto. Dovuto l'alta efficienza di MDA, tracce di DNA di ingresso possono essere amplificati per essere sufficiente di sequenziamento del genoma intero19. Di conseguenza, campioni di DNA ad alti qualità e la quantità possono essere generati ancora anche se cultura arricchimento o IMS non riesce a concentrare in modo efficace le cellule Salmonella . L'analisi PCR in tempo reale opzionale fornisce una valutazione più mirata e ben informativa del flusso di lavoro preparazione intero campione. In secondo luogo, di difficile--coltura Salmonella cellule, come praticabile ma batteri VBNC (VBNC)20, non può crescere durante l'arricchimento della cultura. Di conseguenza, queste cellule non possono essere rilevate con il nostro metodo.

In sintesi, rispetto ai metodi tradizionali, il nostro metodo di preparazione del campione e quasi-metogenomic sequenziamento approccio può consentire sostanziale riduzione dell'analisi svolta da Salmonella-contaminati cibo ed i campioni ambientali sottotipizzazione robusto dei contaminanti Salmonella . Oltre a Salmonella, questa tecnica ha il potenziale essere applicata alla rapida e concertata rilevamento e subtyping altri patogeni di origine alimentare.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano di non avere nessun concorrenti interessi finanziari.

Acknowledgments

Gli autori vorrei ringraziare Mark Harrison e Gwen Hirsch della University of Georgia per fornire gentilmente il ceppo batterico e altro supporto a questo studio.

Materials

Name Company Catalog Number Comments
Laboratory blender bag w/filter VWR 10048-886
Buffered peptone water Oxoid Micorbiology Products CM0509
Rappaport Vassiliadis broth Neogen Acumedia 7730A
Polysorbate 20  Millipore Sigma P9416 Tween 20
Stomacher blender Seward  30010108
Centrifuge Fisher Scientific 75005194
50 mL Centrifuge tubes Fisher Scientific 05-539-6
Thermal Cycler Techne Prime EW-93945-13
StepOne Real-Time Thermal cycler Applied Biosystems 4.76357
AMPure XP beads Beckman Coulter A63881 PCR purification beads; mix well before use; store at 4 °C
Nextera XT library prep kit Illumina FC-131-1024 Store at -80 °C
MinIon library prep kit Oxford Nanopore SQK-LSK108 Store at -80 °C
NanoDrop Thermo Scientific ND-2000
Dynabead Anti-Salmonella beads Applied Biosystems 71002 Vortex well prior to use
Illustra GenomiPhi V2 DNA amplification kit (MDA kit)
-Sample buffer
-Reaction buffer
-Enzyme mix
GE Healthcare 25-6600-30 Store at -80 °C
HulaMixer Invitrogen 15920D
DynaMag magnetic rack Invitrogen 12321D
TaqMan Universal PCR mastermix Applied Biosystems 4304437 Mix well before use; store at 4 °C
Microfuge Fisher Scientific 05-090-100

DOWNLOAD MATERIALS LIST

References

  1. Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens. Critical Reviews in Food Science and Nutrition. 56, (9), 1519-1531 (2016).
  2. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach. Applied and Environmental Microbiology. 81, (23), 8183-8191 (2015).
  3. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS One. 11, (12), e0167870 (2016).
  4. Hyeon, J. Y., et al. Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples. Applied and Environmental Microbiology. (2017).
  5. Hyeon, J. Y., Deng, X. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification. Food Microbiology. 63, 111-116 (2017).
  6. Hosono, S., et al. Unbiased whole-genome amplification directly from clinical samples. Genome Research. 13, (5), 954-964 (2003).
  7. Seth-Smith, H. M., et al. Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture. Genome Research. 23, (5), 855-866 (2013).
  8. Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method. Journal of Food Protection. 75, (2), 400-404 (2012).
  9. Jacobson, A. P., Hammack, T. S., Andrews, W. H. Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method. Journal of AOAC International. 91, (5), 1083-1089 (2008).
  10. Deng, X., et al. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. Journal of Clinical Microbiology. 53, (1), 212-218 (2015).
  11. Anonymous. Microbiology Laboratory Guidebook. Available from: https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook (2018).
  12. Andrews, W. H., Wang, H., Jacobson, A., Hammack, T. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella. Available from: https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm (2018).
  13. Malorny, B., et al. Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology. 70, (12), 7046-7052 (2004).
  14. June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study. Journal of AOAC International. 78, (2), 375-380 (1995).
  15. Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load. Journal of Food Protection. 62, (1), 16-21 (1999).
  16. Wood, D. E., Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biology. 15, (3), R46 (2014).
  17. Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data. PeerJ Computer Science. 1, (e20), (2015).
  18. Zhang, S., et al. Salmonella serotype determination utilizing high-throughput genome sequencing data. Journal of Clinical Microbiology. 53, (5), 1685-1692 (2015).
  19. Rodrigue, S., et al. Whole genome amplification and de novo assembly of single bacterial cells. PLoS One. 4, (9), e6864 (2009).
  20. Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria. Front Public Health. 2, 103 (2014).
Analisi metagenomica quasi di <em>Salmonella</em> da campioni ambientali e alimentari
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).More

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter