Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Quasi-métagénomique analyse des Salmonella dans les aliments et les échantillons environnementaux

doi: 10.3791/58612 Published: October 25, 2018

Summary

Nous présentons ici un protocole pour préparer des échantillons d’ADN provenant des aliments et environnement microbiomes détection concertée et sous-typage des Salmonella par séquençage de quasimetagenomic. L’utilisation combinée de l’enrichissement de la culture, séparation immunomagnétique (IMS) et le déplacement de plusieurs amplification (MDA) permet une concentration efficace de l’ADN génomique de Salmonella provenant des aliments et les échantillons environnementaux.

Abstract

Quasi-métagénomique séquençage se réfère à l’analyse basée sur le séquençage de mis à jour le microbiomes des aliments et les échantillons environnementaux. Dans ce protocole, microbiome modification vise à concentrer l’ADN génomique d’un contaminant de pathogènes d’origine alimentaire cible afin de faciliter la détection et le typage de l’agent pathogène dans un seul flux de travail. Ici, nous expliquer et démontrer les étapes de préparation d’échantillon pour l’analyse de quasi-métagénomique de Salmonella enterica de nourriture représentatif et les échantillons environnementaux, y compris les germes de luzerne, de poivre noir moulu, boeuf haché, poitrine de poulet et les échantillons environnementaux. Les échantillons sont d’abord soumis à l’enrichissement de la culture de Salmonella pour une durée raccourcie et réglable (4 à 24 h). Cellules de Salmonella sont ensuite sélectivement capturés dans la culture d’enrichissement par séparation immunomagnétique (IMS). Enfin, plusieurs amplification de déplacement (MDA) est effectuée afin d’amplifier l’ADN de cellules IMS-capturé. La sortie de l’ADN du présent protocole peut être séquencée par des plateformes de séquençage à haut débit. Une analyse PCR quantitative en option peut être effectuée pour remplacer le séquençage pour la détection de Salmonella ou évaluer la concentration de Salmonella ADN avant de séquençage.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Séquençage métagénomique permet théoriquement concertée de détection et de sous-typage des pathogènes d’origine alimentaire. Cependant, des échantillons d’aliments présentent des défis pour l’analyse de l’agent pathogène par séquençage direct du microbiome alimentaire. Tout d’abord, pathogènes d’origine alimentaire sont souvent présents à de faibles concentrations dans les échantillons d’aliments. La plupart des méthodes de détection rapide disponible dans le commerce encore exigent 8 à 48 h de culture afin d’enrichir les cellules pathogènes à un niveau détectable1. Deuxièmement, beaucoup d’aliments contiennent des cellules de microflore abondante et/ou aliments ADN, faisant ADN du pathogène d’origine alimentaire une petite fraction des aliments métagénome et une cible insaisissable pour la détection et le typage métagénomique séquençage directement.

Modification des aliments microbiomes a signalé afin de permettre une concentration importante de pathogènes d’origine alimentaire ADN afin de faciliter la détection basée sur le séquençage des Escherichia coliproductrices de toxine Shiga2,3 et Salmonella enterica4. Parce que les aliments modifiés microbiomes sont toujours des mélanges de différentes espèces microbiennes, leur séquençage est nommé comme quasi-métagénomique analyse4. Microbiome modification peut être effectuée par la culture enrichissement seuls2,3 , ou en combinaison avec séparation immunomagnétique (IMS) et de multiples déplacements amplification (MDA)4,5. IMS peut capturer sélectivement les cellules pathogènes de la culture d’enrichissement par l’intermédiaire de billes magnétiques revêtus d’anticorps. MDA peut produire une quantité suffisante d’ADN génomique pour l’ordonnancement par le biais de l' ADN polymérase de ɸ29 très efficace6. IMS-MDA a permis la détection des pathogènes indépendants de la culture des échantillons cliniques7et le raccourcissement de l’enrichissement de la culture pour la détection de quasi-métagénomique et sous-typage des salmonelles dans les échantillons de nourriture4.

L’objectif général de cette méthode est de préparer la quasi-métagénomiques ADN provenant d’échantillons de nourriture pour permettre la concentration ciblée de l’ADN génomique de Salmonella et de détection ultérieure et de sous-typage du contaminant Salmonella par séquençage. Par rapport aux méthodes standards pour la détection de Salmonella 8,9 et sous-typage de10, l’approche de quasimetagenomic peut raccourcir considérablement le temps d’immobilisation des aliments contaminés et les échantillons environnementaux sous-types moléculaires de l’agent pathogène en unifiant les deux généralement séparés des analyses dans un seul flux de travail. Cette méthode est particulièrement utile pour des applications telles que la riposte aux flambées épidémiques d’origine alimentaire et d’autres investigations arrière de trace où le sous-typage pathogène robuste est nécessaire en plus de la détection des pathogènes et rapide revirement analytique est important.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. préparation de l’échantillon

Remarque : Des échantillons d’aliments sont préparés pour pré-enrichissement selon microbiologie laboratoire Guidebook (MLG), du US Department of Agriculture Food Safety et Inspection Service (USDA-FSIS)11 et manuel analyse bactériologique (BAM) de la U.S. Food et Drug Administration (FDA)12.

  1. Placer une portion de 25 g d’échantillon d’aliments tels que le poivre noir, poitrine de poulet, boeuf haché et les germes de luzerne ou un tampon imbibé d’environnement en conditions aseptiques dans un sac de mélangeur de laboratoire stérile avec un filtre intégré. Préparer un tampon imbibé d’environnement de façon aseptique humidifier une éponge avec du bouillon d’enrichissement (Rappaport-Vassiliadis, RV). Ensuite, faites glisser l’écouvillon sur toute surface ou zone prédéterminée et placez-le dans un sac de mélangeur de laboratoire.

Figure 1
Figure 1 : aliments représentatifs et les échantillons environnementaux pour la détection de la quasi-métagénomique et sous-typage des Salmonella. Échantillons sont placés dans des sacs stomacher filtre stérile avec bouillon de RV. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

  1. Bien mélanger chaque 25 g d’échantillon avec 225 mL d’enrichissement RV bouillon à l’aide d’un massage de main ou mélangeur de laboratoire pendant 30 s.
    Remarque : Les variantes de bouillon RV tel que recommandé par MLG et BAM peuvent être utilisés selon les types d’échantillons.
  2. Incuber le mélange de bouillon d’enrichissement de l’échantillon dans un incubateur de laboratoire à 42 ° C pendant 4 à 24 h.
  3. Après incubation, recueillir un sous-échantillon de 50 mL de bouillon d’enrichissement du côté filtrée du sac dans un tube à centrifuger séparé de 50 mL.
  4. Centrifuger le tube à 100 x g pendant 10 min enlever les débris solides dans l’homogénat.
  5. Récupérer le surnageant avec soin pour centrifuger de 50 mL nouveau tube et centrifuger les tubes à 3 000 – 6 000 x g pendant 10 min récupérer le culot cellulaire.
  6. (Facultatif) Jeter le surnageant et le culot de lavage par remise en suspension dans 5 mL de l’eau peptonée tamponnée (EPT) et centrifuger les tubes à 3 000 – 6 000 × g pendant 10 min.
    NOTE : BPW peut préparer en dissoudre 10 g de peptone, 5 g de chlorure de sodium, 3,5 g de disodium phosphate, et 1,5 g de phosphate monopotassique dans 1 L d’eau distillée. Le pH final doit être ajusté à 7,2 ± 0,2 à 25 ° C. À l’autoclave à 121 ° c pendant 15 min. BPW disponible dans le commerce peut également être utilisé.
  7. Jeter le surnageant et remettre en suspension l’extrait concentré dans 5 mL d’EPT.

2. Immunomagnetic Separation (IMS) et multiples déplacements Amplification (MDA)

Remarque : Pour éviter la contamination croisée entre les échantillons, travailler dans une cabinet de biosécurité, changer les pointes de pipette pour chaque tube, évitez de toucher le tube avec la pipette et ne pas placer tubes rapprochés sur support magnétique au cours de l’étape de lavage.

  1. Décongeler à l’avance la solution tampon et le tampon de la réaction de la trousse MDA sur glace ou à 4 ° C.
  2. Mélanger 1 mL de remises en suspension cellulaire de granule dans BPW avec 20 μL d’anti - perles deSalmonella dans des tubes de microcentrifuge de 1,5 mL et placez-le sur le mélangeur rotatif pendant 30 min à température ambiante.
    NOTE : Flore compétitive, particules de graisse et de protéines dans l’extrait concentré peuvent interférer avec IMS. Dilution des remises en suspension culot dans BPW est utile pour réduire la perte des perle -Salmonella complexes du support magnétique au cours d’étapes de lavage.
  3. Insérer les tubes dans le support magnétique et laisser 3 min pour la récupération correcte des perles en retournant la grille plusieurs fois à concentrer les perles dans une boulette sur le côté du tube.
  4. Garder les lampes sur le support magnétique. Aspirer et jeter le surnageant de chaque tube, ainsi que le liquide restant dans capuchon de chaque tube.
    Remarque : Veillez à ne pas déranger le culot de perles d’IMS sur la paroi du tube contre l’aimant.
  5. Retirez le porte-tube du support magnétique et ajouter 1 mL de tampon de lavage (PBS contenant 0,05 % (v/v), polysorbate 20) et inverser plusieurs fois pour éliminer les non spécifiquement les bactéries de liaison du complexe.
  6. Répétez les étapes 2,3 – 2,5 deux fois.
  7. Après le lavage 3rd , effectuer la séparation magnétique finale des perles en répétant les étapes 2,3 à 2,4. Retirer les tubes de support magnétique et placez-les dans un microtube pour 1 s pour filer vers le bas de perles. Ensuite, placer les tubes dans la grille magnétique pendant 3 min avant de retirer n’importe quel tampon de lavage résiduelle.
  8. Remettre en suspension lesSalmonella complexes de perle - en 9 μL de tampon et incuber à 95 ° C pendant 3 min pour dénaturation.
  9. Après refroidissement à 4 ° C sur la glace, combiner avec 9 μL de tampon de réaction plus 1 μl d’enzyme mélanger et garder sur la glace.
  10. Dans un thermocycleur, incuber les tubes à 30 ° C pendant 2 h pour l’amplification, suivie par chauffage à 65 ° C pendant 10 min pour inactiver les enzymes et refroidir à 4 ° C sur la glace.
  11. Évaluer la quantité et la qualité des produits MDA en mesurant la concentration d’ADN et de la pureté (260/280 ratio > 1.8) sur un instrument de fluorospectromètre.
    Remarque : En raison de la liaison non spécifique des perles de l’IMS, l’ADN génomique d’organismes autres que les salmonelles est susceptible d’être présents dans les produits MDA, mais elle n’affecte pas l’analyse en aval.
  12. Stocker les produits finis (20 μL) à-20 ° C jusqu'à l’utilisation de la PCR en temps réel et/ou préparation de bibliothèque pour l’ordonnancement de la quasimetagenomics.

3. Real-time PCR

Remarque : Cette étape est facultative pour la détection des salmonelles sans le sous-typage, 1) et 2) évaluer la qualité de l’échantillon avant le séquençage de le quasimetagenomics.

  1. Préparer 18 μL de mélange PCR par échantillon, contenant universel PCR Master Mix (10 μL), avant l’apprêt (2 μL, 900 nM), inverser l’apprêt (2 μL, 900 nM), sonde (2 μL, 250 nM) et l’eau de qualité moléculaires (2 μL).
    Remarque : Salmonella-amorces oligonucléotidiques spécifiques (vers l’avant : CTCACCAGGAGATTACAACATGG, inverse : AGCTCAGACCAAAAGTGACCATC) et la sonde sont conçues pour amplifier une séquence 94-PB du gène ttr (GenBank accession no. AF 282268)13.
  2. Mélanger le produit de la MDA de l’étape 2.12 par pipetage doucement et descendre perleSalmonella complexes ainsi que du liquide pour créer une suspension. Ajouter 2 μl de la suspension dans 18 μL de mélange PCR.
  3. Exécuter une PCR en temps réel en utilisant un protocole optimisé de la PCR en temps réel, en spécifiant deux périodes de détention, une à 50 ° C pendant 2 min et l’autre à 95 ° C pendant 10 min, suivie de 40 cycles de 95 ° C pour 15 s et 60 ° C pendant 60 s.
  4. Calculer le cycle seuil (Ct), qui est le nombre de cycles requis pour la fluorescence de l’ADN amplifié de franchir la ligne de seuil.
    Remarque : La ligne de seuil se trouve dans la phase linéaire entre la ligne de base et du plateau des parcelles amplification des échantillons. Résultats négatifs correspondent aux valeurs de Ct sur 40 ou échantillons avec des valeurs de Ct plus élevées que celle du témoin négatif.

4. Bibliothèque préparation pour l’ordonnancement de la Quasimetagenomic

Remarque : Les produits MDA peuvent être séquencés par les deux courtes lire et bien lire (nanopore) plateformes de séquençage. Utilisez la dernière version de trousses de préparation ADN bibliothèque fournies par les fabricants des plateformes de séquençage. Effectuer la préparation de bibliothèque d’ADN conformément aux instructions des fabricants. Utiliser le protocole d’ADN génomique 2D low input pour la préparation de la bibliothèque pour le séquençage de long lire plateforme5. Pour préparation de bibliothèque pour la plate-forme de séquençage court à lire, des modifications mineures au protocole du fabricant sont fournies ci-dessous.

  1. Suivre les méthodes de préparation de bibliothèque standard en ajoutant des solutions tampons et réactifs aux produits MDA. Transférer 40 μL des produits MDA séquençage préparé à une nouvelle plaque et ajouter 20 μL de perles de PCR purification dans chaque puits.
  2. Incuber les plaques à température ambiante pendant 10 min sans agitation.
  3. Laver les billes avec 80 % d’éthanol et sécher les perles pendant 12 min.
  4. Une nouvelle suspension perles séchées dans 53 μL de tampon de resuspension et incuber pendant 2 min sans agiter.
  5. Diluer et bibliothèques en suivant les instructions du fabricant de la piscine.
    Remarque : Un 22:00 mis en commun et bibliothèque dénaturé est maintenant prêt à être séquencé.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Avant quasimetagenomic le séquençage, la quantité globale et la pureté des produits IMS-MDA peuvent être évaluées par la fluorospectromètre (tableau 1).

Temps de l’enrichissement (h) Valeur de CT Concentration (ng/ul) Pureté (260/280)
Marque A 4 24,71 812.91 1.89
8 25.80 900.36 1,87
12 15.41 753.88 1,84
Marque B 4 20.63 872.61 1,87
8 22.61 993.41 1,87
12 19.08 954.44 1,87

Tableau 1 : évaluation qualitative et quantitative de l’ADN d’échantillons pour le séquençage de quasi-métagénomique. Ont inoculé des cellules de salmonelle dans 25 g de poitrine de poulet cru des deux marques à 1 UFC/g. les échantillons ont été enrichis en RV pour 4, 8 et 12 h avant IMS-MDA.

Évaluation de la quantité ciblée de Salmonella ADN peut être effectuée par PCR en temps réel (tableau 1 et Figure 2), qui assure aussi une alternative pour la détection de Salmonella si le sous-typage n’est pas nécessaire.

Figure 2
Figure 2 : PCR en temps réel pour évaluation détection ou échantillon de Salmonella pour l’ordonnancement de la quasi-métagénomique. Courbes de amplification de PCR en temps réel de Salmonella ADN produits IMS-MDA après 4, 8 et 12 h de temps d’enrichissement sont indiqués. Un échantillon après seulement l’enrichissement 2 h est également inclus. Cellules de Salmonella (0,27 CFU/g) ont été inoculés à 25 g de poitrine de poulet cru des deux marques A et B. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Fluorospectromètre lectures permettent une évaluation initiale de préparation des échantillons. Concentration de produits IMS-MDA à base de Salmonella , poitrine de poulet contaminés échantillons variaient entre 701,54 et 945.86 ng/µL, suggérant que l’ADN de l’échantillon a été amplifié. Selon les directives du fabricant, la concentration d’échantillon ADN minimale pour faire court, lire et lire longtemps séquençage est de 0,2 ng/µL et 1 µg, respectivement. Le ratio 260/280 varie entre 1,85 et 1,88 (tableau 1), montrant la grande pureté des échantillons ADN ayant de faibles niveaux de contamination de la protéine.

Des valeurs de Ct inférieures indiquent des concentrations plus élevées de l’ADN génomique de Salmonella dans l’échantillon. Comme le montre le tableau 1 et Figure 2, les valeurs de Ct de produits IMS-MDA diminuent à mesure que l’enrichissement temps augmente. Dans notre précédente étude4, lorsque les valeurs de Ct étaient inférieurs à 25, la majorité (> 50 %) de la SE génome était susceptible d’être séquencé et prédiction de sérotype de séquençage brutes lectures a réussi.

Enrichissement de la culture infructueux ou IMS peut entraîner une valeurs Ct relativement élevées indiquant la faible concentration de l’ADN génomique de Salmonella dans l’échantillon final tel qu’illustré à la Figure 2. Cela peut se produire malgré une forte concentration d’ADN et la pureté des produits IMS-MDA comme suggéré par fluorospectromètre lectures.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En raison du souvent faible abondance et homogène en présence de Salmonella dans les aliments et les échantillons environnementaux, enrichissement de la culture avant IMS-MDA est encore nécessaire pour la détection de Salmonella et de sous-typage ; C’est donc une étape cruciale du protocole. Pour identifier les conditions optimales d’augmenter l’abondance des salmonelles par rapport à la flore fond échantillon, milieux d’enrichissement différents peut-être être évaluées pour des exemples spécifiques. Selon MLG et BAM, milieu sélectif comme bouillon RV tant en milieu non sélectif comme bouillon de lactose et de l’eau peptonée tamponnée peuvent être utilisés pour l’enrichissement de Salmonella provenant d’échantillons de nourriture. L’utilisation de RV à 42 ° C a été évaluée dans notre précédente étude4 pour l’enrichissement de la viande de poulet cru, laitue iceberg et grains de poivre noirs pour l’analyse quasimetagenomic de l’agent pathogène Salmonella . Selon la FDA BAM et AOAC precollaborative8,9et études collaboratives14,15, RV est recommandé pour l’analyse des aliments de haute charge microbienne microbienne et faible.

La durée optimale de l’enrichissement de la culture dépend de plusieurs facteurs, tels que le type d’échantillon, niveau de contamination par Salmonella et l’état physiologique du contaminant Salmonella . Par exemple, quand un faible taux de Salmonella (par exemple, < 1 UFC/g), les cellules sont présentes dans un échantillon de viande et sous contrainte de réfrigération, durée d’enrichissement (par exemple, > 12 h) peut être nécessaire de relancer et d’enrichir des cellules de salmonelle . Abondance suffisante de Salmonella dans le microbiome mis à jour le mène à une couverture adéquate de séquençage du génome du contaminant Salmonella , qui peut permettre de polymorphisme de souche niveau nucléotide simple (SNP) taper4. Enrichissement de la culture plus courte (par exemple, moins de 12 h) est possible pour une détection rapide5 ou sérotypage de Salmonella4.

Des niveaux plus élevés de contamination par Salmonella et/ou plu enrichissement de la culture des échantillons d’aliments contaminés peut entraîner des concentrations plus élevées de l’ADN génomique de Salmonella dans les aliments modifiés microbiomes, qui conduisent à des valeurs de Ct de plus faibles le analyse PCR en temps réel. Les valeurs de CT affichent une corrélation négative avec une couverture de séquençage du génome contaminant Salmonella 4et donc peuvent être utilisés pour l’optimisation et la modification du flux de travail. Selon notre expérience, enrichissement de la culture, en particulier la longueur de celui-ci, est souvent au centre des efforts de dépannage. Par exemple, la valeur de Ct du produit auprès d’un échantillon de poitrine de poulet cru IMS-MDA était relativement élevée à 35.94 (Figure 1). Cet exemple a été inoculé avec 2,5 UFC/g de cellules SE et incubé dans BPW à 37 ° C pendant 2 h. séquençage de cet exemple n’a pas fourni une couverture suffisante du génome SE permettre la prédiction de sérotype. En comparaison, tous les autres échantillons avec 4 h ou enrichissement plus longue ont été avec succès sérotypées de quasimetagenomic les données du séquençage (données non présentées).

Après le séquençage, nous recommandons à l’aide de Kraken16 pour identifier les Salmonella lectures pour approfondir les analyses bio-informatique. CFSAN SNP pipeline17 et18 de la SeqSero peuvent être utilisés pour le SNP tapant et la sérotypie prédiction de séquençage brutes lectures, respectivement.

Cette technique de quasimetagenomic présente plusieurs limites. Tout d’abord, concentration d’ADN et la pureté des produits IMS-MDA, mesurée par un fluorospectromètre devraient être utilisés uniquement comme un indicateur préliminaire de préparation de l’échantillon approprié. En raison de la grande efficacité du traitement de masse, des traces d’ADN d’entrée peuvent être amplifiés pour suffire de séquençage du génome entier19. Par conséquent, haute qualité et la quantité des échantillons d’ADN peuvent encore générés même si l’enrichissement de la culture ou IMS ne parvient pas à concentrer efficacement les cellules de Salmonella . L’analyse PCR en temps réel en option fournit une évaluation plus ciblée et informatif du flux de préparation d’échantillon entier. Deuxièmement, difficile-à-culture Salmonella des cellules, telles que viables mais non cultivables (VBNC) bactéries20, ne peut pas se développer au cours de l’enrichissement de la culture. Par conséquent, ces cellules ne peuvent pas être détectés par notre méthode.

En résumé, par rapport aux méthodes traditionnelles, notre méthode de préparation d’échantillon et l’approche du séquençage quasi-metogenomic peuvent permettre une réduction substantielle de l’analytique revirement de salmonelles-contaminés par les aliments et les échantillons environnementaux sous-typage robuste des contaminants Salmonella . Outre Salmonella, cette technique peut être appliquée à la rapide et concertée de détection et de sous-typage d’autres pathogènes d’origine alimentaire.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent qu’ils n’ont aucun intérêt financier concurrentes.

Acknowledgments

Les auteurs aimeraient remercier Mark Harrison et Gwen Hirsch de l’Université de Georgie pour aimablement la souche bactérienne et autres formes de soutien à cette étude.

Materials

Name Company Catalog Number Comments
Laboratory blender bag w/filter VWR 10048-886
Buffered peptone water Oxoid Micorbiology Products CM0509
Rappaport Vassiliadis broth Neogen Acumedia 7730A
Polysorbate 20  Millipore Sigma P9416 Tween 20
Stomacher blender Seward  30010108
Centrifuge Fisher Scientific 75005194
50 mL Centrifuge tubes Fisher Scientific 05-539-6
Thermal Cycler Techne Prime EW-93945-13
StepOne Real-Time Thermal cycler Applied Biosystems 4.76357
AMPure XP beads Beckman Coulter A63881 PCR purification beads; mix well before use; store at 4 °C
Nextera XT library prep kit Illumina FC-131-1024 Store at -80 °C
MinIon library prep kit Oxford Nanopore SQK-LSK108 Store at -80 °C
NanoDrop Thermo Scientific ND-2000
Dynabead Anti-Salmonella beads Applied Biosystems 71002 Vortex well prior to use
Illustra GenomiPhi V2 DNA amplification kit (MDA kit)
-Sample buffer
-Reaction buffer
-Enzyme mix
GE Healthcare 25-6600-30 Store at -80 °C
HulaMixer Invitrogen 15920D
DynaMag magnetic rack Invitrogen 12321D
TaqMan Universal PCR mastermix Applied Biosystems 4304437 Mix well before use; store at 4 °C
Microfuge Fisher Scientific 05-090-100

DOWNLOAD MATERIALS LIST

References

  1. Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens. Critical Reviews in Food Science and Nutrition. 56, (9), 1519-1531 (2016).
  2. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach. Applied and Environmental Microbiology. 81, (23), 8183-8191 (2015).
  3. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS One. 11, (12), e0167870 (2016).
  4. Hyeon, J. Y., et al. Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples. Applied and Environmental Microbiology. (2017).
  5. Hyeon, J. Y., Deng, X. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification. Food Microbiology. 63, 111-116 (2017).
  6. Hosono, S., et al. Unbiased whole-genome amplification directly from clinical samples. Genome Research. 13, (5), 954-964 (2003).
  7. Seth-Smith, H. M., et al. Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture. Genome Research. 23, (5), 855-866 (2013).
  8. Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method. Journal of Food Protection. 75, (2), 400-404 (2012).
  9. Jacobson, A. P., Hammack, T. S., Andrews, W. H. Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method. Journal of AOAC International. 91, (5), 1083-1089 (2008).
  10. Deng, X., et al. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. Journal of Clinical Microbiology. 53, (1), 212-218 (2015).
  11. Anonymous. Microbiology Laboratory Guidebook. Available from: https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook (2018).
  12. Andrews, W. H., Wang, H., Jacobson, A., Hammack, T. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella. Available from: https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm (2018).
  13. Malorny, B., et al. Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology. 70, (12), 7046-7052 (2004).
  14. June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study. Journal of AOAC International. 78, (2), 375-380 (1995).
  15. Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load. Journal of Food Protection. 62, (1), 16-21 (1999).
  16. Wood, D. E., Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biology. 15, (3), R46 (2014).
  17. Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data. PeerJ Computer Science. 1, (e20), (2015).
  18. Zhang, S., et al. Salmonella serotype determination utilizing high-throughput genome sequencing data. Journal of Clinical Microbiology. 53, (5), 1685-1692 (2015).
  19. Rodrigue, S., et al. Whole genome amplification and de novo assembly of single bacterial cells. PLoS One. 4, (9), e6864 (2009).
  20. Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria. Front Public Health. 2, 103 (2014).
Quasi-métagénomique analyse des <em>Salmonella</em> dans les aliments et les échantillons environnementaux
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).More

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter