Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Kvasi-metagenomic analyse av Salmonella fra mat og miljøprøver

doi: 10.3791/58612 Published: October 25, 2018

Summary

Her presenterer vi en protokoll for å forberede DNA-prøver fra mat og miljø microbiomes felles gjenkjennings- og subtyping av Salmonella gjennom quasimetagenomic sekvenser. Kombinert bruk av kultur berikelse, immunomagnetic separasjon (IMS) og flere forskyvning forsterkning (MDA) gir effektiv konsentrasjon av Salmonella genomisk DNA fra mat og miljøprøver.

Abstract

Quasi-metagenomics sekvensering refererer til sekvensering-basert analyse av modifisert microbiomes mat og miljøprøver. I denne protokollen, er microbiome modifisering designet for å konsentrere genomisk DNA av en målet matbårne patogen miljøgifter å lette oppdagelsen og subtyping av patogen i en enkelt arbeidsflyt. Her vi forklare og demonstrere eksempel forberedelsene for kvasi-metagenomics analyse av Salmonella enterica fra representant mat og miljøprøver inkludert alfalfaspirer, bakken sort pepper, hakket biff, kylling bryst og miljømessige vattpinner. Eksempler er første utsatt for kultur anriking av Salmonella for en forkortet og justerbar varighet (4-24 h). Salmonella celler er selektivt erobret fra berikelse kulturen av immunomagnetic separasjon (IMS). Til slutt, flere forskyvning forsterkning (MDA) utføres for å forsterke DNA fra IMS-fanget celler. DNA resultatet av denne protokollen kan være rekkefølge av høy gjennomstrømning sekvensering plattformer. En valgfri kvantitative PCR analyse kan utføres for å erstatte sekvenser for Salmonella oppdagelsen eller vurdere konsentrasjonen av Salmonella DNA før sekvensering.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Metagenomics sekvensering kan teoretisk felles gjenkjennings- og subtyping av matbårne patogener. Men presentere mat prøver utfordringer til patogen analyse ved direkte sekvensering av mat microbiome. Først finnes matbårne patogener ofte på lave nivåer i mat prøver. De fleste kommersielt tilgjengelige rask påvisning metodene fortsatt krever 8 – 48 h dyrking perfeksjonerer patogen cellene til en synlig nivå1. Andre, mange matvarer inneholder rikelig mikroflora celler og/eller mat DNA, gjør matbårne patogen DNA en brøkdel av mat metagenome og en flyktig mål for gjenkjennings- og subtyping for direkte metagenomic sekvenser.

Endring av mat microbiomes har blitt rapportert at betydelig konsentrasjon av matbårne patogen DNA å lette sekvensering-basert oppdagelsen av Shiga toksin-produserende Escherichia coli2,3 og Salmonella enterica4. Fordi mat microbiomes er fortsatt blandinger av ulike mikrobielle arter, deres sekvensering er betegnet som kvasi-metagenomic analyse4. Microbiome endring kan utføres av kultur berikelse alene2,3 eller i kombinasjon med immunomagnetic separasjon (IMS) og flere forskyvning forsterkning (MDA)4,5. IMS kan selektivt fange patogen celler fra berikelse kulturen via antistoff magnetiske perler. MDA kan generere tilstrekkelig mengder genomisk DNA for sekvensering gjennom svært effektiv ɸ29 DNA polymerase6. IMS-MDA har tillatt kultur-uavhengig patogen oppdagelsen klinisk prøver7, forkortelse for kultur anriking for kvasi-metagenomic gjenkjenning og subtyping av Salmonella i mat prøver4.

Det overordnede målet med denne metoden er å forberede kvasi-metagenomic DNA fra mat prøver å tillate målrettet konsentrasjon av Salmonella genomisk DNA og påfølgende søk og subtyping av Salmonella miljøgifter av sekvenser. Sammenlignet med standard metoder for Salmonella oppdagelsen8,9 og subtyping10, kan quasimetagenomic tilnærming betraktelig forkorte tiden fra forurenset mat og miljøprøver til molekylær undergrupper av patogen ved å forene to vanligvis delt analyser i en enkelt arbeidsflyt. Denne metoden er spesielt nyttig for matbårne utbrudd svaret og andre spor tilbake undersøkelser der robust patogen subtyping kreves i tillegg patogen detection og rask analytisk produksjon er viktig.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. sample forberedelse

Merk: Mat prøver er forberedt pre berikelse ifølge mikrobiologi laboratorium guidebok (MLG) av US Department of Agriculture mat Safety og inspeksjon Service (USDA-FSIS)11 og bakteriologiske analytisk manuell (BAM) av US Food og Drug Administration (FDA)12.

  1. Tas aseptisk plassere en 25 g del av mat prøve som sort pepper, kyllingbryst, kjøttdeig, og alfalfaspirer eller en miljømessig vattpinnen i et sterilt laboratorium blender bag med innebygde filter. Forberede en miljøbestemt vattpinnen ved tas aseptisk fukte en svamp med berikelse kjøttkraft (Rappaport-Vassiliadis, RV). Deretter drar vattpinnen over hele overflaten eller forhåndsbestemt området og legg den i et laboratorium blender bag.

Figure 1
Figur 1: representant mat og miljøprøver kvasi-metagenomics gjenkjenning og subtyping av Salmonella. Eksempler er plassert i sterilt filteret stomacher poser med RV kjøttkraft. Klikk her for å se en større versjon av dette tallet.

  1. Grundig blande hver 25 g prøve med 225 mL RV berikelse buljong med laboratoriet blender eller hånd massasje for 30 s.
    Merk: Varianter av RV kjøttkraft som anbefalt av MLG og BAM kan brukes avhengig av prøven typer.
  2. Inkuber sample-berikelse kjøttkraft blandingen i et laboratorium inkubator på 42 ° C 4-24 h.
  3. Etter inkubasjon samle en 50 mL subsample av berikelse kjøttkraft fra filtrerte side av vesken i et separat 50 mL sentrifuge rør.
  4. Sentrifuge røret 100 x g i 10 min å fjerne solid rusk i homogenate.
  5. Gjenopprette nedbryting forsiktig å en ny 50 mL sentrifuge rør og sentrifuge rør 3000-6000 x g i 10 min å gjenopprette celle pellets.
  6. (Valgfritt) Forkaste nedbryting og vaske pellet av re-suspensjon i 5 mL av bufret pepton vann (BPW) og sentrifuge rør 3000-6000 × g i 10 min.
    Merk: BPW kan utarbeidet av oppløsning 10 g pepton 5 g av natriumklorid, 3,5 g disodium fosfat, og 1,5 g monopotassium fosfat i 1 L av destillert vann. Siste pH skal justeres til 7,2 ± 0,2 på 25 ° C. Autoclave på 121 ºC i 15 min. kommersielt tilgjengelig BPW kan også brukes.
  7. Forkast nedbryting og å avbryte pellet 5 mL BPW.

2. Immunomagnetic fargeseparasjoner (IMS) og flere forskyvning forsterkning (MDA)

Merk: For å forhindre kryss-kontaminering mellom prøvene, innarbeide en biosafety skap, endre pipette-spisser for hver rør, unngå å berøre røret med pipette og ikke setter rør tett sammen i magnetiske stå under vask trinnet.

  1. Tine eksempel bufferen og reaksjon bufferen fra MDA kit på isen eller i 4 ° C på forhånd.
  2. Mix 1 mL re suspendert celle pellets i BPW med 20 μL av anti -Salmonella perler i 1,5 mL microcentrifuge rør og plasser den på roterende mikseren i 30 min ved romtemperatur.
    Merk: Konkurransedyktige flora, fett partikler og proteiner i urinprøven kan påvirke IMS. Fortynning av nytt suspendert celle pellet i BPW er nyttig for å redusere tap av perle -Salmonella komplekser av magnetiske stativet under vaske trinnene.
  3. Rør inn magnetiske stå og la 3 min for riktig gjenvinning av perler ved å snu stativet flere ganger å konsentrere perler inn pellets på siden av røret.
  4. Holde rørene på magnetiske stand. Sug opp og kast nedbryting fra hver rør, samt gjenværende væsken i hver tube cap.
    Merk: Pass på ikke å forstyrre pellet av IMS perler på sideveggen på røret mot magneten.
  5. Fjerne tube innehaveren av magnetiske stativet og legge 1 mL av vaskebuffer (PBS inneholder 0,05% (v/v) polysorbat 20) og invertere flere ganger for å fjerne nonspecifically bindende bakterier fra komplekset.
  6. Gjenta trinn 2.3-2.5 to ganger.
  7. Etter 3rd vask, kan du utføre endelige magnetiske separasjon av perler ved å gjenta trinn 2.3-2,4. Fjerne rør fra magnetiske rack og legg dem i en microfuge for 1 å spinne ned perler. Deretter plassere rør i magnetiske rack i 3 minutter før du fjerner eventuelle gjenværende vaskebuffer.
  8. Nytt avbryte perle -Salmonella komplekser 9 μL eksempel buffer og ruge på 95 ° C i 3 minutter for rødsprit.
  9. Etter nedkjøling til 4 ° C på is, kombinere med 9 μL reaksjon buffer pluss 1 μL enzym bland og holde på is.
  10. I en termisk cycler, ruge rør på 30 ° C for 2t for forsterkning, etterfulgt av oppvarming ved 65 ° C i 10 min å deaktivere enzym og kult å 4 ° C på is.
  11. Vurdere mengden og kvaliteten av produktene som er MDA ved å måle DNA konsentrasjonen og renhet (260/280 forholdet > 1.8) på et fluorospectrometer instrument.
    Merk: På grunn av ikke-spesifikk binding av IMS perler, genomisk DNA fra organismer enn Salmonella er trolig finnes i MDA produkter, men det påvirker ikke nedstrøms.
  12. Lagre sluttprodukter (20 μL) på 20 ° C til bruk for sanntids PCR og/eller biblioteket forberedelse til quasimetagenomics sekvenser.

3. sanntid PCR

Merk: Dette trinnet er valgfritt for 1) oppdage Salmonella uten subtyping, og 2) vurdere utvalg kvalitet før quasimetagenomics sekvenser.

  1. Forberede 18 μL PCR blanding per prøve, som inneholder Universal PCR Master Mix (10 μL), videresende primer (2 μL, 900 nM), snu primer (2 μL, 900 nM), sonde (2 μL, 250 nM), og molekylær klasse vann (2 μL).
    Merk: Salmonella-spesifikke oligonucleotide primere (frem: CTCACCAGGAGATTACAACATGG, omvendt: AGCTCAGACCAAAAGTGACCATC) og sonde ble utviklet for å forsterke en 94-bp sekvens i ttr genet (GenBank tiltredelse nei. AF 282268)13.
  2. Bland MDA produktet fra trinn 2.12 ved forsiktig pipettering opp og ned perle -Salmonella komplekser med væske til å opprette en suspensjon. Tilsett 2 μL av suspensjon i 18 μL PCR blanding.
  3. Kjøre sanntid PCR med en optimalisert sanntid PCR-protokollen, angir to holde perioder, på 50 ° C i 2 minutter og en annen på 95 ° C i 10 min, etterfulgt av 40 sykluser av 95 ° C for 15 s og 60 ° C i 60 s.
  4. Beregne terskelen syklusen (Ct), som er antall sykluser kreves for fluorescens fra forsterket DNA krysse grensen linjen.
    Merk: Terskelen linjen er satt i den lineære fasen mellom grunnlinjen og platå av forsterkning tomter av prøver. Negative resultater tilsvarer Ct verdier over 40 eller prøver med Ct verdier høyere enn negativ kontroll.

4. biblioteket forberedelse til Quasimetagenomic sekvenser

Merk: MDA produktene kan være sekvensert av både kort leser og lang lese (nanopore) sekvensering plattformer. Bruk den nyeste versjonen av DNA biblioteket prep kits produsentene av sekvensering plattformer. Utføre DNA biblioteket forberedelse i henhold til produsentens instruksjoner. Bruke 2D lav-input genomisk DNA protokollen for biblioteket forberedelse for lang lese sekvensering plattform5. For biblioteket forberedelse for kort-lese sekvensering plattformen nedenfor mindre endringer til produsentens protokollen.

  1. Følg standardbiblioteket forberedelse metoder ved å legge til buffer løsninger og reagenser MDA produkter. Overføre 40 μL sekvensering prepped MDA produktene til en ny plate og legge 20 μL PCR rensing perler i hver brønn.
  2. Inkuber platen ved romtemperatur for 10 min uten risting.
  3. Vask perler med 80% etanol og tørr perlene i 12 minutter.
  4. Nytt suspendere tørket perler i 53 μL rørets buffer og ruge i 2 minutter uten risting.
  5. Fortynne og basseng biblioteker etter produsentens instruksjoner.
    Merk: En 10 pM samlet og denaturert biblioteket er nå klar til å være sekvensielt.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Før quasimetagenomic sekvensering, kan total mengde og renhet av IMS-MDA produkter bli vurdert av fluorospectrometer (tabell 1).

Berikelse tid (h) CT verdi Konsentrasjonen (ng/ul) Renhet (260/280)
Merke A 4 24.71 812.91 1.89
8 25.80 900.36 1.87
12 15.41 753.88 1.84
Merke B 4 20.63 872.61 1.87
8 22.61 993.41 1.87
12 19.08 954.44 1.87

Tabell 1: antallet og vurdering av DNA prøver for kvasi-metagenomic sekvensering. Salmonella celler ble inokulert 25 g av rå kyllingbryst i to merkene på 1 CFU/g. Inoculated prøver ble anriket ved RV for 4, 8 og 12 h før IMS-MDA.

Målrettet antall vurdering av Salmonella DNA kan utføres av sanntids PCR (tabell 1 og figur 2), som også fungerer som et alternativ for Salmonella gjenkjenning hvis subtyping ikke er nødvendig.

Figure 2
Figur 2: Sanntid PCR Salmonella oppdagelsen eller prøve vurdering for kvasi-metagenomics sekvensering. Forsterkning kurver av sanntids PCR av Salmonella DNA i IMS-MDA produkter etter 4, 8 og 12 h berikelse tid vises. Et utvalg etter bare 2t berikelse er også inkludert. Salmonella celler (0,27 CFU/g) var inokulerte 25 g av rå kyllingbryst fra to merker A og B. Klikk her for å se en større versjon av dette tallet.

Fluorospectrometer målinger kan initial bedømmelse prøve forberedelser. Konsentrasjon av IMS-MDA produkter utarbeidet av Salmonella forurenset kyllingbryst prøver varierte fra 701.54 til 945.86 ng/µL, antyder at prøven DNA har blitt forsterket. Ifølge produsentens veiledning er laveste DNA eksempel konsentrasjonen for korte leser og lang lese sekvensering 0,2 ng/µL og 1 µg, henholdsvis. 260/280 forholdet varierte fra 1,85 til 1,88 (tabell 1), viser høy renhet av DNA-prøver med lave nivåer av protein forurensning.

Lavere Ct verdiene indikerer høyere konsentrasjoner av Salmonella genomisk DNA i utvalget. Som vist i tabell 1 og figur 2, redusere Ct verdier av IMS-MDA produkter som berikelse tid øker. I vår forrige studere4, når Ct verdier var lavere enn 25, fleste (> 50%) av SE genomet var sannsynlig som ble sekvensert, og serotype tips fra rå sekvensering leser var vellykket.

Mislykket kultur berikelse eller IMS kan føre relativt høy Ct verdier som angir lav konsentrasjon av Salmonella genomisk DNA i siste prøven som vist i figur 2. Dette kan skje til tross for en høy DNA konsentrasjon og renhet av IMS-MDA produktene som foreslått av fluorospectrometer målinger.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ofte lav overflod og i homogene tilstedeværelsen av Salmonella i mat og miljøprøver, kultur berikelse før IMS-MDA er fortsatt nødvendig for Salmonella gjenkjennings- og subtyping; Det er derfor en avgjørende skritt av protokollen. Finn optimale forhold øke overflod av Salmonella i forhold til prøven bakgrunn flora ved kan ulike berikelse media evalueres for bestemte prøver. Ifølge MLG og BAM, kan både selektiv medium som RV buljong og ikke-selektive medium som bufret pepton vann og laktose kjøttkraft brukes for Salmonella anriking fra mat prøver. Bruk av RV 42 ° c er evaluert i våre tidligere studie4 for Salmonella berikelse fra rå kyllingkjøtt, isbergsalat og sort pepper støtte quasimetagenomic analyse av patogen. Ifølge FDA BAM og AOAC precollaborative8,9og samarbeidende studier14,15anbefales RV for analyse av høy mikrobiell og lav mikrobiell belaste mat.

Optimal varigheten kultur berikelse, avhenger av flere faktorer, som eksempel type og nivå av Salmonella forurense fysiologisk tilstand hos Salmonella miljøgifter. For eksempel når lave nivåer av Salmonella (f.eks< 1 CFU/g) celler er til stede i en kjøtt prøve og under nedkjøling stress, lengre berikelse tid (f.eks, > 12 h) kan være nødvendig å gjenopplive og berike Salmonella celler. Tilstrekkelig overflod av Salmonella i den endrede microbiome fører til tilstrekkelig sekvensering dekning av Salmonella miljøgifter genomet, noe som gjør stamme-nivå single nukleotid polymorfisme (SNP) skrive4. Kortere kultur berikelse (f.eks . mindre enn 12 h) er mulig for rask påvisning5 eller serotyping av Salmonella4.

Høyere nivåer av Salmonella forurense og/eller lengre kultur berikelse av forurenset mat prøver kan resultere i høyere konsentrasjoner av Salmonella genomisk DNA i Cancer microbiomes, som fører til lavere Ct verdier fra den sanntid PCR analyse. CT viser en negativ korrelasjon med sekvensering dekning av Salmonella miljøgifter genomet4og derfor kan brukes for optimalisering og modifikasjon av arbeidsflyten. Vår erfaring er kultur berikelse, spesielt lengden på det, ofte fokus for feilsøking. For eksempel var Ct verdien av IMS-MDA produktet fra en rå kyllingbryst prøve relativt høyt på 35.94 (figur 1). Denne prøven ble inokulert med 2,5 CFU/g av SE celler og ruges i BPW ved 37 ° C i 2 h. sekvensering av dette eksemplet ikke gir tilstrekkelig dekning av SE genomet tillate serotype prediksjon. Til sammenligning var alle andre prøvene med 4 h eller lengre berikelse vellykket serotyped fra quasimetagenomic sekvensering data (data ikke vist).

Etter sekvensering anbefaler vi bruker Kraken16 for å identifisere Salmonella leser for videre bioinformatikk analyser. CFSAN SNP rørledning17 og SeqSero18 kan brukes til SNP skrive og serotyping tips fra rå sekvensering leser, henholdsvis.

Denne quasimetagenomic teknikken har flere begrensninger. Først bør DNA konsentrasjon og renhet av IMS-MDA produkter målt ved en fluorospectrometer bare brukes som en foreløpig indikator på riktig utvalg forberedelse. På grunn av høy effektivitet av MDA, kan sporstoffer mengder inn DNA bli forsterket til nok hele genomet sekvensering19. Høy kvalitet og kvantitet DNA-prøver kan derfor fortsatt genereres selv om kultur berikelse eller IMS ikke effektivt konsentrere seg Salmonella celler. Valgfri sanntid PCR analyse gir en mer målrettet og informativ vurdering av hele prøven forberedelse arbeidsflyten. Andre, vanskelig-å-kultur Salmonella celler, som levedyktig men nonculturable (VBNC) bakterier20, kan ikke vokse under kultur berikelse. Disse cellene kan derfor ikke registreres i vår metode.

I sammendraget, sammenlignet med tradisjonelle metoder, våre eksempel forberedelse metoden og kvasi-metogenomic sekvensering tilnærming kan tillate betydelig reduksjon av analytiske omslaget fra Salmonella-forurenset mat og miljøprøver til robust subtyping av Salmonella forurensninger. I tillegg til Salmonellahar denne teknikken potensial brukes til rask og felles gjenkjenning og subtyping andre matbårne patogener.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer at de har ingen konkurrerende økonomiske interesser.

Acknowledgments

Forfatterne vil gjerne takke Mark Harrison og Gwen Hirsch av University of Georgia for vennlig å gi bakterielle belastningen og annen støtte til denne studien.

Materials

Name Company Catalog Number Comments
Laboratory blender bag w/filter VWR 10048-886
Buffered peptone water Oxoid Micorbiology Products CM0509
Rappaport Vassiliadis broth Neogen Acumedia 7730A
Polysorbate 20  Millipore Sigma P9416 Tween 20
Stomacher blender Seward  30010108
Centrifuge Fisher Scientific 75005194
50 mL Centrifuge tubes Fisher Scientific 05-539-6
Thermal Cycler Techne Prime EW-93945-13
StepOne Real-Time Thermal cycler Applied Biosystems 4.76357
AMPure XP beads Beckman Coulter A63881 PCR purification beads; mix well before use; store at 4 °C
Nextera XT library prep kit Illumina FC-131-1024 Store at -80 °C
MinIon library prep kit Oxford Nanopore SQK-LSK108 Store at -80 °C
NanoDrop Thermo Scientific ND-2000
Dynabead Anti-Salmonella beads Applied Biosystems 71002 Vortex well prior to use
Illustra GenomiPhi V2 DNA amplification kit (MDA kit)
-Sample buffer
-Reaction buffer
-Enzyme mix
GE Healthcare 25-6600-30 Store at -80 °C
HulaMixer Invitrogen 15920D
DynaMag magnetic rack Invitrogen 12321D
TaqMan Universal PCR mastermix Applied Biosystems 4304437 Mix well before use; store at 4 °C
Microfuge Fisher Scientific 05-090-100

DOWNLOAD MATERIALS LIST

References

  1. Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens. Critical Reviews in Food Science and Nutrition. 56, (9), 1519-1531 (2016).
  2. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach. Applied and Environmental Microbiology. 81, (23), 8183-8191 (2015).
  3. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS One. 11, (12), e0167870 (2016).
  4. Hyeon, J. Y., et al. Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples. Applied and Environmental Microbiology. (2017).
  5. Hyeon, J. Y., Deng, X. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification. Food Microbiology. 63, 111-116 (2017).
  6. Hosono, S., et al. Unbiased whole-genome amplification directly from clinical samples. Genome Research. 13, (5), 954-964 (2003).
  7. Seth-Smith, H. M., et al. Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture. Genome Research. 23, (5), 855-866 (2013).
  8. Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method. Journal of Food Protection. 75, (2), 400-404 (2012).
  9. Jacobson, A. P., Hammack, T. S., Andrews, W. H. Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method. Journal of AOAC International. 91, (5), 1083-1089 (2008).
  10. Deng, X., et al. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. Journal of Clinical Microbiology. 53, (1), 212-218 (2015).
  11. Anonymous. Microbiology Laboratory Guidebook. Available from: https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook (2018).
  12. Andrews, W. H., Wang, H., Jacobson, A., Hammack, T. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella. Available from: https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm (2018).
  13. Malorny, B., et al. Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology. 70, (12), 7046-7052 (2004).
  14. June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study. Journal of AOAC International. 78, (2), 375-380 (1995).
  15. Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load. Journal of Food Protection. 62, (1), 16-21 (1999).
  16. Wood, D. E., Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biology. 15, (3), R46 (2014).
  17. Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data. PeerJ Computer Science. 1, (e20), (2015).
  18. Zhang, S., et al. Salmonella serotype determination utilizing high-throughput genome sequencing data. Journal of Clinical Microbiology. 53, (5), 1685-1692 (2015).
  19. Rodrigue, S., et al. Whole genome amplification and de novo assembly of single bacterial cells. PLoS One. 4, (9), e6864 (2009).
  20. Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria. Front Public Health. 2, 103 (2014).
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).More

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter