Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Análisis de metagenómica cuasi de Salmonella de muestras alimentarias y ambientales

doi: 10.3791/58612 Published: October 25, 2018

Summary

Aquí, presentamos un protocolo para preparar muestras de ADN de alimentos y medio ambiente microbiomes de detección concertada y subclasificación de Salmonella a través de la secuencia quasimetagenomic. El uso combinado de enriquecimiento de la cultura, la separación inmunomagnética (IMS) y múltiples desplazamiento amplificación (MDA) permite la concentración efectiva de la DNA genomic de la Salmonella de muestras alimentarias y ambientales.

Abstract

Cuasi-metagenómica secuenciación se refiere al análisis basado en la secuencia de microbiomes modificado de muestras alimentarias y ambientales. En este protocolo, modificación de microbioma está diseñado para concentrar el ADN genómico de un contaminante de patógeno de los alimentos objetivo para facilitar la detección y la subclasificación del patógeno en un único flujo de trabajo. Aquí, explicar y demostrar los pasos de preparación de muestra para el análisis de metagenómica cuasi de enterica de las salmonelas de representativas muestras alimentarias y ambientales incluyendo brotes de alfalfa, pimienta negra molida, carne picada, pechuga de pollo y de medio ambiente. Las muestras primero son sometidas al enriquecimiento de la cultura de Salmonella para una duración acortada y ajustable (4 – 24 h). Células de Salmonella son selectivamente capturadas de la cultura de enriquecimiento por separación inmunomagnética (IMS). Finalmente, se realiza amplificación de desplazamiento múltiple (MDA) para amplificar ADN de células capturadas de IMS. La salida del ADN de este protocolo puede ordenada por plataformas de secuenciación de alto rendimiento. Un análisis PCR cuantitativo opcional puede realizarse para cambiar la secuencia para la detección de Salmonella o evaluar la concentración de Salmonella ADN antes de la secuencia.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Secuencia de la metagenómica permite teóricamente detección concertada y subclasificación de patógenos alimentarios. Sin embargo, muestras de alimentos presentan desafíos para el análisis de patógenos por la secuencia directa de la microbioma de la comida. En primer lugar, patógenos de transmisión alimentaria a menudo están presentes en niveles bajos en muestras de alimentos. La mayoría de los métodos de detección rápida disponible comercialmente aún requieren 8 – 48 h de cultivo para enriquecer las células del patógeno a un nivel detectable1. En segundo lugar, muchos alimentos contienen células abundante microflora o alimentos ADN, haciendo ADN de patógenos de transmisión alimentaria una pequeña fracción del metagenoma de alimentos y un objetivo difícil de alcanzar para detección y subclasificación por dirigen secuencia de metagenómica.

Modificación de microbiomes de alimentos se ha divulgado para permitir la concentración sustancial de patógeno de los alimentos ADN para facilitar la detección basada en la secuencia de Shiga Escherichia coliproductoras de toxina2,3 y Enterica de las salmonelas4. Porque alimentos microbiomes todavía son mezclas de diferentes especies microbianas, su secuencia se denomina como análisis de metagenómica casi4. Microbioma modificación puede realizarse por cultura enriquecimiento solo2,3 o en combinación con separación inmunomagnética (IMS) y múltiples desplazamientos amplificación (MDA)4,5. IMS puede capturar selectivamente las células del patógeno de la cultura del enriquecimiento a través de granos magnéticos recubiertos de anticuerpos. MDA puede generar cantidades suficientes de la DNA genomic de la secuencia a través de la polimerasa de la DNA ɸ29 altamente eficiente del6. IMS-MDA ha permitido la detección de patógenos de la cultura-independiente de las muestras clínicas7y acortamiento del enriquecimiento de la cultura para la detección de cuasi metagenómica y subclasificación de Salmonella en muestras de alimentos4.

El objetivo general de este método es preparar cuasi metagenomic ADN de muestras de alimentos para permitir la concentración específica de ADN genómico de Salmonella y posterior detección y subclasificación de los contaminantes de la Salmonella por la secuencia. En comparación con los métodos estándar para detección de Salmonella 8,9 y10de subclasificación, el enfoque quasimetagenomic puede acortar substancialmente el tiempo de procesamiento de alimentos contaminados y muestras ambientales a subtipos moleculares del patógeno por unificar los dos típicamente separan análisis en un único flujo de trabajo. Este método es particularmente útil para aplicaciones como respuesta de brote de origen alimentario y otras investigaciones posterior del rastro donde sólido patógeno subclasificación se requiere además de detección de patógenos y rápida renovación analítica es importante.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. preparación de la muestra

Nota: Muestras de alimentos se preparan para pre-enriquecimiento según la guía de laboratorio de Microbiología (MLG) de seguridad alimentaria del Departamento de agricultura de Estados Unidos y Inspection Service (USDA-FSIS)11 y manual analítico bacteriológico (BAM) de alimentos de Estados Unidos y Drug Administration (FDA)12.

  1. Asépticamente colocar una porción de 25 g de muestra de alimentos como la pimienta, pechuga de pollo, carne molida y brotes de alfalfa o un algodón embebido en medio ambiente dentro de una bolsa de licuadora de laboratorio estéril con filtro incorporado. Preparar una torunda ambiental asépticamente humedeciendo una esponja con caldo de enriquecimiento (Rappaport-Vassiliadis, RV). Luego, arrastre la esponja sobre toda la superficie o área determinada y colóquelo en una bolsa de licuadora de laboratorio.

Figure 1
Figura 1: Representante muestras alimentarias y ambientales para la detección de cuasi metagenómica y subclasificación de Salmonella. Las muestras se colocan en bolsas de stomacher estéril filtro junto con el caldo RV. Por favor haga clic aquí para ver una versión más grande de esta figura.

  1. Mezclar bien cada 25 g de la muestra con 225 mL de enriquecimiento RV caldo mediante un masaje de mano o licuadora de laboratorio de 30 s.
    Nota: Variantes de caldo RV recomendadas por MLG y BAM pueden utilizarse dependiendo de tipos de muestras.
  2. Incubar la mezcla del caldo de enriquecimiento de la muestra en una incubadora del laboratorio a 42 ° C durante 4-24 h.
  3. Después de la incubación, obtener una submuestra de 50 mL de caldo de enriquecimiento de la parte filtrada de la bolsa en un tubo de centrífuga de 50 mL separadas.
  4. Centrifugar el tubo a 100 x g por 10 min eliminar los desechos sólidos en el homogeneizado.
  5. Recuperar el sobrenadante con cuidado para un nuevo 50 mL tubo de centrífuga y centrifugar los tubos a 3.000 – 6.000 x g durante 10 minutos recuperar el sedimento celulares.
  6. (Opcional) Deseche el sobrenadante y lavar el precipitado por re-suspensión en 5 mL de agua de peptona tamponada (BPW) y centrifugar los tubos a 3.000 – 6.000 × g por 10 min.
    Nota: BPW puede preparada por disolución de 10 g de peptona, 5 g de cloruro de sodio 3,5 g de disodio fosfato, y 1.5 g de fosfato monopotásico en 1 L de agua destilada. El pH final debe ajustarse a 7,2 ± 0,2 a 25 ° C. También puede utilizar el autoclave a 121 º c durante 15 minutos BPW comercialmente disponible.
  7. Deseche el sobrenadante y resuspender el pellet en 5 mL de BPW.

2. separación inmunomagnética (IMS) y amplificación de desplazamiento múltiple (MDA)

Nota: Para evitar la contaminación cruzada entre muestras, trabajar en un gabinete de bioseguridad, cambiar las puntas de pipeta para cada tubo, evite tocar el tubo con la pipeta y no coloque tubos juntos en soporte magnético durante la etapa de lavado.

  1. Descongelar el tampón de muestra y el buffer de reacción del kit del MDA en hielo o a 4 ° C por adelantado.
  2. Mezclar 1 mL de células suspende de nuevo en BPW de pellets con 20 μL de anti -salmonela granos en tubos de microcentrífuga de 1,5 mL y coloque en el mezclador rotatorio durante 30 min a temperatura ambiente.
    Nota: Flora competitiva, partículas de grasa y proteínas en resuspendido pueden interferir con IMS. Dilución del precipitado de células volver a suspensión de BPW es útil para reducir la pérdida de grano -Salmonella complejos del soporte magnético durante pasos de lavado.
  3. Inserte los tubos en el soporte magnético y permiten 3 minutos para la recuperación adecuada de granos invirtiéndolos varias veces la cremallera para concentrar los granos en una pelotilla en el lado del tubo.
  4. Mantener los tubos en el soporte magnético. Aspirar y descartar el sobrenadante de cada tubo, así como el líquido restante en la tapa de cada tubo.
    Nota: Tenga cuidado de no perturbar el pellet de granos IMS en la pared lateral del tubo contra el imán.
  5. Retire el soporte del tubo de soporte magnético y añadir 1 mL de tampón de lavado (PBS que contenga 0.05% (v/v) polisorbato 20) e inviértalo varias veces para eliminar bacterias de Unión no específica del complejo.
  6. Repita los pasos 2,3 – 2,5 dos veces.
  7. Después del lavado 3rd , realizar la separación magnética final de cuentas, repitiendo los pasos 2.3-2.4. Retirar tubos de soporte magnético y colocar en una microcentrífuga para 1 s para girar por los granos. Luego, coloque los tubos en la rejilla magnética para 3 minutos antes de retirar cualquier tampón de lavado residual.
  8. Resuspenda el grano -Salmonella complejos en 9 μL del tampón de muestra e incubar a 95 ° C por 3 min de desnaturalización.
  9. Después de enfriar a 4 ° C en hielo, combinar con 9 μL de tampón de reacción además de 1 μL de enzima de la mezcla y mantener en hielo.
  10. En un termociclador, incubar los tubos a 30 ° C por 2 h para la amplificación, seguida de calentamiento a 65 ° C durante 10 minutos para inactivar la enzima y enfriar a 4 ° C en hielo.
  11. Evaluar la cantidad y calidad de los productos MDA mediante la medición de la concentración de ADN y la pureza (relación 260/280 > 1,8) en un instrumento de fluorospectrometer.
    Nota: Debido a fijación no específica de granos de la IMS, ADN genómico de microorganismos distintos de Salmonella es probable estar presente en los productos MDA, pero no afecta los análisis posteriores.
  12. Almacenar los productos finales (20 μL) a-20 ° C hasta el uso de PCR en tiempo real o de la preparación de la biblioteca para la secuencia quasimetagenomics.

3. real-time PCR

Nota: Este paso es opcional para 1) detección de Salmonella sin subclasificación y 2) evaluación de la calidad de la muestra antes de la secuencia quasimetagenomics.

  1. Preparar 18 μL de mezcla PCR por muestra, que contiene el maestro de PCR Universal (10 μL) de la mezcla, adelante la cartilla (2 μL, 900 nM), revertir la cartilla (2 μL, 900 nM), sonda (2 μL, 250 nM) y grado molecular de agua (μ 2).
    Nota: Salmonella-cartillas del oligonucleótido específico (adelante: CTCACCAGGAGATTACAACATGG, marcha atrás: AGCTCAGACCAAAAGTGACCATC) y sonda fueron diseñados para amplificar una secuencia de 94 puntos de ebullición dentro del gene de ttr (GenBank accesión no. AF 282268)13.
  2. Mezcle el producto de la MDA de paso 2.12 transfiriendo suavemente arriba y abajo de grano -Salmonella complejos para crear una suspensión de caldo. Añadir 2 μL de la suspensión en 18 μL de mezcla PCR.
  3. Ejecutar el PCR en tiempo real usando un protocolo PCR en tiempo real optimizado, especificando dos períodos de tenencia, uno a 50 ° C por 2 min y otro a 95 ° C durante 10 min, seguido de 40 ciclos de 95 ° C por 15 s y 60 ° C durante 60 s.
  4. Calcular el ciclo umbral (Ct), que es el número de ciclos necesarios para la fluorescencia de ADN amplificado para cruzar la línea de umbral.
    Nota: La línea de umbral se establece en la fase lineal entre línea de base y meseta de los diagramas de la amplificación de las muestras. Resultados negativos corresponden a valores de Ct 40 o muestras con valores de Ct superiores a la del control negativo.

4. Biblioteca preparación para la secuencia de Quasimetagenomic

Nota: Los productos MDA pueden ser secuenciados por ambos corta Lea y lea mucho (nanopore) plataformas de secuenciación. Utilice la última versión de kits de preparación del biblioteca de ADN proporcionadas por los fabricantes de las plataformas de secuenciación. Realizar preparación de biblioteca de ADN según instrucciones del fabricante. Utilizando el protocolo de ADN genómico 2D de bajos insumos para la preparación de la biblioteca para la lectura larga secuencia plataforma5. Para la preparación de la biblioteca para la plataforma de lectura corta secuencia, a continuación se proporcionan pequeñas modificaciones en el protocolo del fabricante.

  1. Seguir métodos de preparación de la biblioteca estándar mediante la adición de soluciones buffer y los reactivos a los productos MDA. Transferencia de 40 μL de los productos MDA secuenciación preparado a una placa nueva y añadir 20 μL de granos de purificación la polimerización en cadena a cada pocillo.
  2. Incubar la placa a temperatura ambiente durante 10 minutos sin agitar.
  3. Lavar los granos con etanol al 80% y secar los granos durante 12 minutos.
  4. Resuspender los granos secos en 53 μL de buffer de resuspensión e Incube por 2 minutos sin agitación.
  5. Diluir y bibliotecas siguiendo instrucciones del fabricante de la piscina.
    Nota: A 22:00 agruparon y desnaturalizada de la biblioteca ya está lista para ser secuenciado.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Antes de quasimetagenomic la secuencia, la cantidad y la pureza de los productos de IMS-MDA general pueden evaluar fluorospectrometer (tabla 1).

Tiempo de enriquecimiento (h) Valor de CT Concentración (ng/ul) Pureza (260/280)
Marca A 4 24.71 812.91 1.89
8 25.80 900.36 1,87
12 15.41 753.88 1.84
Marca B 4 20,63 872.61 1,87
8 22.61 993.41 1,87
12 19.08 954.44 1,87

Tabla 1: evaluación de la calidad y la cantidad de DNA muestras para secuencia cuasi metagenómicos. Se inocularon células de Salmonella en 25 g de pechuga de pollo cruda de dos marcas a 1 UFC/g. inoculó muestras fueron enriquecidas en RV para 4, 8 y 12 h antes de IMS-MDA.

Evaluación de la cantidad específica de Salmonella ADN puede realizarse mediante PCR en tiempo real (tabla 1 y figura 2), que también sirve como una alternativa para la detección de Salmonella si subclasificación no es necesario.

Figure 2
Figura 2: PCR en tiempo real para la evaluación de detección o muestra de Salmonella para la secuencia cuasi metagenómica. Se muestran las curvas de amplificación de PCR en tiempo real de Salmonella ADN en productos IMS-MDA después de 4, 8 y 12 h de tiempo de enriquecimiento. También se incluye una muestra después de enriquecimiento de sólo 2 h. Células de Salmonella (0.27 UFC/g) fueron inoculado 25 g de pechuga de pollo cruda de dos marcas A y B. haga clic aquí para ver una versión más grande de esta figura.

Fluorospectrometer lecturas permiten la evaluación inicial de la preparación de la muestra. Concentración de MDA IMS productos preparados a partir de Salmonella muestras de pechuga de pollo contaminada entre 701.54 a 945.86 ng/μl, lo que sugiere que el ADN de la muestra se ha ampliado. Según la dirección del fabricante, la concentración mínima de la muestra de ADN para el cortocircuito, lea y lea mucho la secuencia es 0,2 ng/μl y 1 μg, respectivamente. La relación 260/280 oscilaron entre 1.85 y 1.88 (tabla 1), mostrando la alta pureza de las muestras de ADN con bajos niveles de contaminación de la proteína.

Valores de Ct más bajos indican altas concentraciones de ADN genómico de Salmonella en la muestra. Como se muestra en la tabla 1 y figura 2, valores de Ct de productos IMS-MDA disminuyen como enriquecimiento tiempo aumenta. En nuestro anterior estudio4, cuando los valores de Ct fueron menores a 25, la mayoría (> 50%) de la SE es probable que ser secuenciado genoma y serotipo predicción de secuencia cruda Lee era acertado.

Enriquecimiento de la cultura fracasado o IMS puede resultar en un valores relativamente altos de Ct que indica baja concentración de ADN genómico de Salmonella en la muestra final como se muestra en la figura 2. Esto puede ocurrir a pesar de una alta concentración de ADN y la pureza de los productos de IMS-MDA según lo sugerido por las lecturas de fluorospectrometer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Debido a la abundancia de frecuencia baja y homogénea en presencia de Salmonella en muestras alimentarias y ambientales, enriquecimiento de la cultura antes de IMS-MDA es necesario para la detección de Salmonella y subclasificación; por lo tanto es un paso crítico del protocolo. Para identificar las condiciones óptimas para incrementar la abundancia de Salmonella con respecto a la flora del fondo de muestra, pueden evaluar los medios de enriquecimiento diferentes muestras específicas. Según MLG y BAM, pueden utilizarse medio selectivo como el caldo RV y medio no selectivo como el caldo de peptona tamponada agua y lactosa para el enriquecimiento de la Salmonella de muestras de alimentos. El uso de la RV a 42 ° C se ha evaluado en nuestro estudio anterior4 para enriquecimiento de Salmonella de carne de pollo crudo, lechuga y granos de pimienta negras para apoyar análisis quasimetagenomic del patógeno. Según FDA BAM y AOAC precollaborative8,9y estudios colaborativos14,15, RV se recomienda para el análisis de alimentos de alta carga microbiana microbianas y baja.

La duración óptima del enriquecimiento de la cultura depende de múltiples factores, como tipo de muestra, nivel de contaminación por Salmonella y el estado fisiológico de la contaminación de Salmonella . Por ejemplo, cuando baja los niveles de Salmonella (por ejemplo, < 1 UFC/g) las células están presentes en una muestra de carne y bajo tensión de refrigeración, tiempo de enriquecimiento (p. ej., > 12 h) puede ser necesario para revitalizar y enriquecer las células de Salmonella . Abundancia suficiente de Salmonella en el microbioma modificado conduce a cobertura adecuada de la secuencia del genoma de contaminante Salmonella , que puede permitir que el polimorfismo de nucleótido único a nivel de cepa (SNP) escribir4. Enriquecimiento de la cultura más corto (por ejemplo, menos de 12 h) es posible para una rápida detección5 o serotipificación de Salmonella4.

Niveles más altos de contaminación por Salmonella o enriquecimiento de la cultura más de muestras de alimentos contaminados puede resultar en mayores concentraciones de ADN genómico de Salmonella en alimentos modificados microbiomes, que conducen a disminuir los valores de Ct de la Análisis PCR en tiempo real. Valores de CT muestra una correlación negativa con la cobertura de la secuencia de la Salmonella contaminante genoma4y por lo tanto se pueden utilizar para la optimización y modificación del flujo de trabajo. Según nuestra experiencia, enriquecimiento de la cultura, especialmente la longitud de la misma, es a menudo el foco de los esfuerzos de solución de problemas. Por ejemplo, el valor de Ct del IMS-MDA producto de una muestra de pechuga de pollo cruda fue relativamente alto en 35.94 (figura 1). Esta muestra se inoculó con 2,5 ufc/g de células SE y se incubó en BPW en 37 ° C durante 2 h. secuenciación de esta muestra no presentó suficiente cobertura del genoma SE para permitir la predicción de serotipo. En comparación, todas las muestras con 4 h o más enriquecimiento fueron serotipificadas con éxito datos de secuenciación quasimetagenomic (datos no mostrados).

Después de la secuencia, recomendamos usando Kraken16 para identificar salmonela Lee para más análisis de Bioinformática. CFSAN SNP tubería17 y18 de SeqSero pueden utilizarse para SNP typing y serotipificación predicción secuencia cruda Lee, respectivamente.

Esta técnica quasimetagenomic tiene varias limitaciones. En primer lugar, concentración de ADN y pureza de los productos de IMS-MDA medido por un fluorospectrometer deben utilizarse sólo como un indicador preliminar de preparación de la muestra adecuada. Debido a la alta eficiencia de MDA, trazas de ADN de entrada pueden amplificarse para es suficiente todo el genoma secuencias19. Por lo tanto, alta calidad y la cantidad de muestras de ADN pueden generarse aún aún si enriquecimiento cultura o IMS no logra concentrarse con eficacia las células de Salmonella . El análisis PCR en tiempo real opcional proporciona una evaluación más específica e informativa del flujo de trabajo de preparación de muestra entero. En segundo lugar, de difícil cultivo Salmonella de las células, como20, pero puromicina (VBNC) de bacterias viables no crezca durante el enriquecimiento de la cultura. Por lo tanto, estas células no pueden ser detectadas por nuestro método.

En Resumen, en comparación con los métodos tradicionales, nuestro método de preparación de la muestra y cuasi-metogenomic secuenciación enfoque pueden permitir una reducción sustancial de la respuesta analítica de Salmonella-contaminados muestras alimentarias y ambientales a robusto subclasificación de los contaminantes de la Salmonella . Además de Salmonella, esta técnica tiene el potencial de ser aplicada rápida y concertada de la detección y subclasificación de otros patógenos de transmisión alimentaria.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores declaran que no tienen intereses financieros que compiten.

Acknowledgments

Los autores desean agradecer a Mark Harrison y Gwen Hirsch de la Universidad de Georgia para proporcionar amablemente la cepa bacteriana y otro tipo de apoyo a este estudio.

Materials

Name Company Catalog Number Comments
Laboratory blender bag w/filter VWR 10048-886
Buffered peptone water Oxoid Micorbiology Products CM0509
Rappaport Vassiliadis broth Neogen Acumedia 7730A
Polysorbate 20  Millipore Sigma P9416 Tween 20
Stomacher blender Seward  30010108
Centrifuge Fisher Scientific 75005194
50 mL Centrifuge tubes Fisher Scientific 05-539-6
Thermal Cycler Techne Prime EW-93945-13
StepOne Real-Time Thermal cycler Applied Biosystems 4.76357
AMPure XP beads Beckman Coulter A63881 PCR purification beads; mix well before use; store at 4 °C
Nextera XT library prep kit Illumina FC-131-1024 Store at -80 °C
MinIon library prep kit Oxford Nanopore SQK-LSK108 Store at -80 °C
NanoDrop Thermo Scientific ND-2000
Dynabead Anti-Salmonella beads Applied Biosystems 71002 Vortex well prior to use
Illustra GenomiPhi V2 DNA amplification kit (MDA kit)
-Sample buffer
-Reaction buffer
-Enzyme mix
GE Healthcare 25-6600-30 Store at -80 °C
HulaMixer Invitrogen 15920D
DynaMag magnetic rack Invitrogen 12321D
TaqMan Universal PCR mastermix Applied Biosystems 4304437 Mix well before use; store at 4 °C
Microfuge Fisher Scientific 05-090-100

DOWNLOAD MATERIALS LIST

References

  1. Valderrama, W. B., Dudley, E. G., Doores, S., Cutter, C. N. Commercially Available Rapid Methods for Detection of Selected Food-borne Pathogens. Critical Reviews in Food Science and Nutrition. 56, (9), 1519-1531 (2016).
  2. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Application of metagenomic sequencing to food safety: detection of Shiga Toxin-producing Escherichia coli on fresh bagged spinach. Applied and Environmental Microbiology. 81, (23), 8183-8191 (2015).
  3. Leonard, S. R., Mammel, M. K., Lacher, D. W., Elkins, C. A. Strain-Level Discrimination of Shiga Toxin-Producing Escherichia coli in Spinach Using Metagenomic Sequencing. PLoS One. 11, (12), e0167870 (2016).
  4. Hyeon, J. Y., et al. Quasi-metagenomics and realtime sequencing aided detection and subtyping of Salmonella enterica from food samples. Applied and Environmental Microbiology. (2017).
  5. Hyeon, J. Y., Deng, X. Rapid detection of Salmonella in raw chicken breast using real-time PCR combined with immunomagnetic separation and whole genome amplification. Food Microbiology. 63, 111-116 (2017).
  6. Hosono, S., et al. Unbiased whole-genome amplification directly from clinical samples. Genome Research. 13, (5), 954-964 (2003).
  7. Seth-Smith, H. M., et al. Whole-genome sequences of Chlamydia trachomatis directly from clinical samples without culture. Genome Research. 23, (5), 855-866 (2013).
  8. Jacobson, A. P., Gill, V. S., Irvin, K. A., Wang, H., Hammack, T. S. Evaluation of methods to prepare samples of leafy green vegetables for preenrichment with the Bacteriological Analytical Manual Salmonella culture method. Journal of Food Protection. 75, (2), 400-404 (2012).
  9. Jacobson, A. P., Hammack, T. S., Andrews, W. H. Evaluation of sample preparation methods for the isolation of Salmonella from alfalfa and mung bean seeds with the Bacteriological Analytical Manual's Salmonella culture method. Journal of AOAC International. 91, (5), 1083-1089 (2008).
  10. Deng, X., et al. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. Journal of Clinical Microbiology. 53, (1), 212-218 (2015).
  11. Anonymous. Microbiology Laboratory Guidebook. Available from: https://www.fsis.usda.gov/wps/portal/fsis/topics/science/laboratories-and-procedures/guidebooks-and-methods/microbiology-laboratory-guidebook/microbiology-laboratory-guidebook (2018).
  12. Andrews, W. H., Wang, H., Jacobson, A., Hammack, T. Bacteriological Analytical Manual (BAM) Chapter 5: Salmonella. Available from: https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm070149.htm (2018).
  13. Malorny, B., et al. Diagnostic real-time PCR for detection of Salmonella in food. Applied and Environmental Microbiology. 70, (12), 7046-7052 (2004).
  14. June, G. A., Sherrod, P. S., Hammack, T. S., Amaguana, R. M., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella from raw flesh and other highly contaminated foods: precollaborative study. Journal of AOAC International. 78, (2), 375-380 (1995).
  15. Hammack, T. S., Amaguana, R. M., June, G. A., Sherrod, P. S., Andrews, W. H. Relative effectiveness of selenite cystine broth, tetrathionate broth, and Rappaport-Vassiliadis medium for the recovery of Salmonella spp. from foods with a low microbial load. Journal of Food Protection. 62, (1), 16-21 (1999).
  16. Wood, D. E., Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biology. 15, (3), R46 (2014).
  17. Davis, S., Pettengill, J. B., Luo, Y., Payne, J., Shpuntoff, A., Rand, H., Strain, E. CFSAN SNP Pipeline: an automated method for constructing SNP matrices from next-generation sequence data. PeerJ Computer Science. 1, (e20), (2015).
  18. Zhang, S., et al. Salmonella serotype determination utilizing high-throughput genome sequencing data. Journal of Clinical Microbiology. 53, (5), 1685-1692 (2015).
  19. Rodrigue, S., et al. Whole genome amplification and de novo assembly of single bacterial cells. PLoS One. 4, (9), e6864 (2009).
  20. Ramamurthy, T., Ghosh, A., Pazhani, G. P., Shinoda, S. Current Perspectives on Viable but Non-Culturable (VBNC) Pathogenic Bacteria. Front Public Health. 2, 103 (2014).
Análisis de metagenómica cuasi de <em>Salmonella</em> de muestras alimentarias y ambientales
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).More

Hyeon, J. Y., Mann, D. A., Townsend, A. M., Deng, X. Quasi-metagenomic Analysis of Salmonella from Food and Environmental Samples. J. Vis. Exp. (140), e58612, doi:10.3791/58612 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter