Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Ячейки на основе анализов SINEUP кодирования РНК, которые могут конкретно улучшить перевод мРНК

doi: 10.3791/58627 Published: February 1, 2019
* These authors contributed equally

Summary

SINEUPs являются синтетические антисмысловых некодирующих РНК, которые содержат привязки домена (BD) и домен эффектор (Эд) и вверх регулировать перевод целевых мРНК. Здесь мы описываем методы обнаружения для SINEUPs в культивированный клеточных линий, анализ их перевод содействие деятельности Западной блот и полуавтоматические высокую пропускную способность системы.

Abstract

Повышение целевых белков имеет важное значение не только для изучения биологических процессов, но и для терапевтических и биотехнологических применений. Здесь мы представляем метод выборочно вверх-регулировать выражение протеина желаемого генов в культивируемых клеток с помощью синтетических antisense кодирования РНК, известный как SINEUPs. Этот положительный контроль экспрессии генов находится на post-transcriptional уровне и оказываемое Перевернутый короткие перемежаются ядерный элемент (синус) повторить в конце 3ʹ SINEUPs, включает в себя его эффекторных домена (Эд). SINEUPs специально можно привязать к любой мРНК белка кодирования выбора путем его привязки домена (BD), регион, предназначенные для дополнения последовательность в регионе непереведенные 5ʹ (5ʹ утр) и вокруг начала кодон мРНК. Целевой объект специфического SINEUPs разработан таким образом transfected культивируемых клеток и белков и РНК извлекаются для анализа ниже по течению, как правило 24-48 ч после transfection. SINEUP-индуцированного белка вверх регулирования определяется Западной блот анализ и РНК выражение измеряется с помощью реального времени Количественная обратная транскрипция ПЦР. Мы заметили, что BD дизайн имеет решающее значение для достижения оптимального SINEUP активности и что тестирование различных размеров BD и позиции в отношении начала кодон цель, которую рекомендуется мРНК. Таким образом мы здесь описывать полуавтоматические высок объём изображения метод, основанный на флуоресценции обнаружения, который может быть реализован к цели, которую мРНК сливается с зеленого флуоресцентного белка (ГПУП). SINEUPs конкретно улучшить перевод в пределах физиологической норме клетки, без изменения целевого уровня Стенограмма. Этот метод успешно работает против ряда эндогенных и экзогенных целей, в широкий спектр человека и мыши, насекомых клеточных линий, а также в естественных условиях систем. Кроме того были зарегистрированы SINEUPs увеличить производство антител и работать как терапевтические против гаплонедостаточных генов РНК. Универсальный и модульных характер SINEUPs делает их подходящим инструментом для трансляционного управления ген специфического.

Introduction

В постгеномной эре, многие идеи были приобретены в нормативной роли ген некодирующих антисмысловых стенограмм вследствие развития секвенирование нового поколения технологий1,2,3 и Джин-инструменты для редактирования. Эта категория стенограммы, который ранее считался «transcriptional корзину», теперь устанавливается как ключевой игрок генетического регулирования. Сообщается, что Антисмысловые стенограммы модулировать хроматина и стабильность управления и выражение их родственных белков кодирования чувство мРНК4,5. В большинстве случаев этот режим регулирования является отрицательным и антисмысловых стенограммы замолчать их смысл коллегами через РНК-РНК взаимодействия6,7. Эта черта природных антисмысловых стенограммы был использован с помощью желаемого генов в виде синтетических малые интерферирующие РНК (siRNA), микроРНК (miRNA) и антисмысловых oligos (АСО)8,9,10 ,11 оставляя технологического пустота для целевых генов вверх регулирование.

Один интригующий исследование изменил перспективы поле Антисмысловые РНК, продемонстрировав, что antisense длиной некодирующих РНК (как lncRNAs) генов Uchl1 (гидролазы L1 убиквитин C-терминала) и Uxt (повсеместно выразил стенограмма) положительно регулируют перевод их узнаваемыми смысле мРНК на уровне post-transcriptional в мышах12. Конец 5ʹ этих lncRNAs перекрывается с несколькими базами в регионе непереведенные 5ʹ (5ʹ утр) их соответствующих смысле стенограмм, и конец 3ʹ non перекроя содержит Перевернутый повторить Ретротранспозоны принадлежащих к краткосрочной перемежаются ядерной элемент (синус) семья. Интересно мы обнаружили, что основной движущей силой этого трансляционного вверх регулирование встраиваемых синус повторить и это не ограничивается мыши, синус повторяет только. Человека Alu повтор содержащих как lncRNAs также усилено перевод целевой чувство мРНК, армирующие идею романа класса синус driven регулирования antisense кодирования РНК, соответствующим названием SINEUPs13. Недавние исследования показали, что потенциал естественных SINEUPs сохраняется в синтетических SINEUPs, призванных конкретно цели различных эндогенных и экзогенных генов14,15. SINEUPs имеют две важные функции: первый «связывающий домен» (BD) который обычно 5ʹ конец региона дополняет последовательность охватывающих первичной начать кодон мРНК белка кодирования и второй «эффекторных домен» (ED) как он включает в себя Перевернутый повторить синуса, что является обязательным условием для SINEUP функции14 (рис. 1). SINEUPs могут быть настроены для разработки BD, конкретно ориентированная на ген выбора. Это затем могут быть использованы для того чтобы рассечь функции конкретных генов, участвующих в биологической реакции, как лучшая альтернатива обычной стратегии гиперэкспрессия мРНК. Кроме того, этот универсальный инструмент может применяться для повышения антител и как препарат для лечения заболеваний гаплонедостаточных, вызванных недостаточной дозировке функциональных белков16,,1718, 19,,2021.

Преимущества технологии SINEUP многообразны. Это не меняет выражение целевого показателя на уровне транскрипционный анализ. Длиннее BDs обеспечивают больше конкретности в SINEUPs, не вызывая двуцепочечной ДНК зависимая стресс ответ15. Всасывание белков поддерживается в пределах нормального физиологического диапазона клеток, предотвращая любые пагубные последствия из-за ошибочной или чрезмерного белков. SINEUPs совместимы с широким разнообразием мыши, человека, и хомяк культивированный клеточных линий, например, HEK293T/17, HepG2, HeLa, Чо, MN9D и многие больше12,13,14,15,18 ,19. SINEUPs можно эффективно ориентировать эндогенного генов, временно гиперэкспрессия генов и отмеченных флагом или Люцифераза фьюжн генов, устраняя необходимость ген специфического антитела14,18. Основные SINEUP анализ требует обычной клеточной культуры, transfection, натрия Додециловый сульфат полиакриламидный гель-электрофорез (SDS-PAGE), реальном времени количественных обратной транскрипции полимеразной цепной реакции (qRT ПЦР) Инструменты и параметры, и знания могут быть получены в течение короткого времени.

Здесь мы описываем метод для ориентации генов с синтетическими SINEUPs вверх-регулировать перевод, эффект в отличие от других технологий, таких как РНК интерференции9 и Асо-gapmers-11,-22,-23. Широко используемый метод для активации гена РНК руководствуясь является кластеризованным регулярно interspaced короткие палиндром повторяется-активации на основе (CRISPRa), где выражение гена инициируется транскрипционный анализ уровня24. Этот метод, хотя простой и быстрый, требует несколько одно руководство РНК (sgRNAs) ориентации же гена для более высокой эффективности, тем самым увеличивая шансы пробить привязки25. Кроме того ключевого фермента CRISPRa системы, каталитически мертвым ТРИФОСФАТЫ связанные белком 9 (dCas9) имеет низкий привязки специфики и sgRNAs ориентация которую двунаправленным промоутер регионы могут неспецифически вверх регулировать рядом гены25. И наоборот SINEUPs связывают целевой мРНК в регион одной привязки с высокой точностью и не влияют на экспрессию генов поблизости. Мы обсудим основные этапы в SINEUP дизайн, transfection, белка и РНК выражение анализа. Кроме того мы представляем полуавтоматическое, высок объём изображений системы на экране несколько SINEUPs сразу, что полезно для обнаружения оптимального SINEUPs.

Protocol

1. дизайн BDs SINEUP, строит для целевой мРНК

  1. Проверьте транскрипции начальный узел (TSS) и начальный перевод сайта целевой мРНК в клетках интерес. Приобрести ТВУ данных от FANTOM, так и для кодирования проектов (Кап анализ экспрессии генов, Кейдж) (ぜんぶ: http://fantom.gsc.riken.jp/zenbu/).
  2. Откройте браузер, поиск генов интерес и проверить ТВУ, Кейдж пиков.
  3. Обратитесь пример анализа клеток и тканей конкретных ТВУ Паркинсона болезнь белка 7 (PARK7) мРНК, показан на рисунке 2.
  4. Дизайн, BD последовательности нескольких различных длин, соответствующего 40 баз вверх по течению и 32 базы по течению первого метионина (август), 72 nt в общей сложности.
  5. Настраиваемый порядок разработан УРБ в SINEUP выражение вектор (см. Таблицу материалы).
    Примечание: Проверьте последовательность специфики основных местных выравнивание инструмент поиска (взрыв) чтобы избежать эффектов пробить26.

2. клетки культуры и SINEUP Transfection

  1. Семя клетки интереса к 6 скважин плита или 24 хорошо плита за 24 ч до transfection SINEUPs. В случае линии клеток человеческого эмбриона почек (HEK293T/17) (см. Таблицу материалы), семя 0,5 x 106 клеток на хорошо 6 клеток хорошо плита или 1,5 x 10-5 за хорошо поли D-лизин покрытием 24 хорошо-плиты (см. Таблицу материалы). Она становится 70% притока после 24 ч.
  2. После 24 часов измените средних 1,5 мл свежей среды для 6 скважин плиты или 0,4 мл свежей среды для 24 хорошо плиты. В случае SINEUP-GFP, transfect 0,6 мкг pEGFP-C2 (см. Таблицу материалы) и 3.4 мкг SINEUP-ГФП в одной скважине 6 хорошо плита или 130 нг pEGFP-C2 и 670 нг SINEUP-ГФП в одной скважине 24 хорошо-плиты с трансфекции реагента (10 мкл в 6 хорошо плиты и 3 мкг L в 24 хорошо плита), следуя инструкциям производителя (см. Таблицу материалы) и инкубировать при 37 ° C в 5% СО2-инкубатор для 24 h.
  3. Вымойте клетки с 2 мл фосфатный буфер (PBS) (37 мм NaCl, 8 мм Na2HPO4, 2,6 мм KCl и 1,5 мм х2PO4) в каждой скважине 6 скважин-плиты или 0,5 мл PBS в каждой скважине 24 хорошо-плиты. Только для поли D-лизин покрытием 24 хорошо плиты 25 мкл 0,05% веса на единицу объема трипсина, инкубировать в 5% CO2 инкубатора на 5 мин и 275 мкл ячейки среднего за хорошо. В случае 6 скважин плиты добавьте 2 мл PBS в каждой скважине. Накапайте вверх и вниз, чтобы собрать 3/4 клеток (1,5 мл на 6 скважин плиты) или 225 мкл 24 хорошо-пластины из 1 хорошо для извлечения белков (перейти к Протоколу 3 для извлечения белков) и 1/4 клеток (0,5 мл на 6 скважин плиты) или 75 мкл для 24 хорошо пластина для Извлечение RNA и центрифуги на 6000 x g 5 минут при температуре 4 ° C (перейдите к шагу 5 для извлечения РНК).
    Примечание: Анализировать эффект SINEUP-ГФП в поли D-лизин покрытием 24 хорошо плита изображений. Перейдите к шагу 7 (анализ изображений).

3. белка добычу

  1. Тщательно аспирационная 1,5 мл PBS и 140 мкл раствора (20 мм трис-HCl (рН 7,5), 150 NaCl, 1 мм Na2ЭДТА, 1 мм EGTA, 1% (w/v) Тритон, Пирофосфат натрия 2,5 мм, 1 мм β-метронидазол, 1 мм Na3VO4 лизис 1 мкг/мл leupeptin и phenylmethylsulfonyl фтора 0,005% (w/v) (PMSF)) (см. Таблицу материалы) для 6 хорошо плита или 60 мкл для 24 хорошо плиты клетки гранул.
  2. Смешать, закупорить и затем тщательно перемешать, повернув на медленной скорости за 1 час при 4 ° C. Собирать супернатант центрифугированием в 14.000 x g 10 мин при 4 ° C.
  3. Проверить концентрацию белка колориметрического анализа (см. таблицу материалы). Подготовьте все реакции при комнатной температуре.
    1. Подготовить 5 - 6 раз разрежения бычьим сывороточным альбумином (БСА) белка в ультрачистая вода в концентрациях от 0,2-1,5 мг/мл белка. Подготовьте свежие стандарты каждый раз.
    2. Подготовка рабочего реагента Aʹ путем смешивания 1 мл реагента (щелочные меди тартрата раствор) с 20 мкл Реагента S (раствора ПАВ).
    3. Загрузка 5 мкл воды (отрицательный контроль), BSA стандарт (белок стандартных и позитивного управления) или образец протеина в каждой скважине 96-хорошо-плиты.
    4. Добавьте 25 мкл Реагента Aʹ в каждой скважине. Аккуратно добавьте 200 мкл Реагента B (реактивом Фолина) за хорошо избегая любых формирования пузыря. Крышка с алюминиевой фольгой и ждать 5-10 мин.
    5. Измерение поглощения белков на 750 нм с спектрофотометром. Поглощения является стабильным для по крайней мере 1 час.
    6. Подготовьте калибровочной кривой, построения концентрацию BSA стандартных белка (мг/мл) на оси x и их соответствующих поглощения на оси y. Рассчитайте концентрацию белка образца, применяя уравнения калибровочной кривой.
      Примечание: Приостановить протокола на этот шаг, если необходимо, или перейдите к шагу 4. Для длительного хранения оснастки заморозить образцы протеина в жидком азоте и хранить при температуре-80 ° C.

4. белка разъединения SDS-PAGE и выявления целевых белков с антителами (Западная блот анализ)

  1. Добавьте один объем 2 x загрузки краситель (0,1 М трис-HCl (рН 6,8), SDS 4%, 20% глицерина, 1,42% 2-mercaptethanol и 0,2% бромфеноловый синий) для каждого тома образец протеина от шагу 3.3. Тепло на 90 ° C за 5 мин и остудите на льду за 1 мин.
  2. Загрузить 10-20 мкг белка образцов до 10% SDS-Полимерность гелей и разделить на 100-150 V) (см. Таблицу материалы).
  3. Передать 0,45 мкм нитроцеллюлозную мембрану белка от геля (см. Таблицу материалы) инструмент полусухое передачи с передачи буфера (25 мм трис, 192 мм глицин и 20% метанола) 25 V за 30 мин.
  4. Добавить блокировки решение (5% обезжиренное сухое молоко в 1 x TBST буфера (137 мм NaCl, 20 трис-HCl (рН 7,6), 0,1% Tween-20)) (см. Таблицу материалов) к контейнеру до мембрана полностью пропитана и проинкубируйте его при комнатной температуре за 30 мин.
  5. В случае SINEUP-GFP, гибридизируйте белка с анти GFP антитела (1 в блокировании решения разреженных: 2000) (см. Таблицу материалы) по инкубации мембран для 30 минут с тряску при комнатной температуре. Как белка внутреннего контроля, обнаружения β-миозина белков гибридизировать с анти β-актина антитела (1 в блокировании решения разреженных: 2000) (см. Таблицу материалы) за 30 мин при встряхивании при комнатной температуре.
  6. Добавьте 1 x TBST буфер в контейнер до тех пор, пока мембрана является полностью промокли и мыть за 5 мин при комнатной температуре. Повторите шаг мыть два раза больше (в общей сложности три автомойки).
  7. Гибридизируйте белка GFP разреженных (1: 1000 в преграждая разрешение) анти кролик антитела конъюгированных с пероксидазой хрена (ПХ) и гибридизировать β-миозина белков в разбавленной (1: 1000 в преграждая разрешение) против мыши антитело проспряганное с ПХ на мембране за 30 минут с тряску при комнатной температуре.
  8. Промойте мембрану с 1 x TBST буфер для 5 мин при комнатной температуре. Повторите шаг мыть два раза больше (в общей сложности три автомойки).
  9. Смешать равные объем реагента обнаружения HRP-усиленной хемилюминесценции (ЭСЛ) 1 и 2 (см. Таблицу материалы). Передать микс реагента 2 мл ECL мембрана, Обложка коробки с алюминиевой фольгой и пусть он инкубировать 1-2 мин при комнатной температуре. Тщательно удалить мембрану из смеси реагентов ECL и предоставлять с помощью изображений инструмент свечения.

5. РНК добыча и обработка DNase

  1. Экстракт всего РНК после стандарт протокола для извлечение RNA от клеток, выращиваемых в монослое27 или альтернативно использовать коммерчески доступных РНК добыча комплект (см. Таблицу материалы). Изложить в краткой, добавить любой монофазные лизис реагента (MLR) из Изотиоцианаты гуанидина и фенола в заготовленной ячейки шаг 2,3 (1 мл MLR на ~ 5 миллионов клеток)27.
    Примечание: Часто менять перчатки. Использовать бесплатные РНКазы реагентов и Диэтилпирокарбонат (DEPC)-лечение пластиковая посуда и посуда для предотвращения деградации РНК. Приостановите протокола на этот шаг, если необходимо. Магазин извлечь РНК-80 ° c.
  2. Добавьте 0,1 объема 10 x буфер DNase и 2 U DNase очищенный РНК из шага 5.1 (см. Таблицу материалы).
  3. Установите громкость реакции до 50 мкл свободной от нуклеиназы водой и осторожно перемешать. Инкубируйте при 37 ° C за 30 мин.
  4. Добавить 0,1 объема вновь приостановлено DNase инактивации реагента и хорошо перемешать (см. Таблицу материалы). Инкубируйте 5 мин при комнатной температуре с нежным встряхивания.
  5. Центрифуга на 10000 x g 90 s. передачи супернатант (РНК, ДНК бесплатно) в свежих бесплатно РНКазы 1,5 мл трубку. Будьте осторожны, чтобы не коснуться гранулы, потому что это может вызвать перенос DNase, которая является неприятной для вниз по течению шаги.
  6. Quantitate РНК путем измерения260 и соотношении280 /A260(для чистого РНК, диапазон-1.8-2.0) в Спектрофотометр UV.

6. Первый синтез cDNA стренги и qRT ПЦР-анализа

  1. Выполните первый синтез cDNA стренги после стандартного cDNA синтеза протокол как ниже (см. таблицу материалы).
    1. Смешайте 0,75 мкм oligo dT грунт, 4.3 мкм случайного праймера, дНТФ (по 10 мм) с 200-500 нг всего РНК (от шаги 5-8) в 10 мкл объема общей реакции. Инкубируйте на 65 ° C за 5 мин и затем немедленно положить на льду.
    2. Смешать 1 x обратной транскриптазы буфера, 1 U РНКазы ингибитор, 10 U обратной транскриптазы и добавить 10 мкл РНК праймер микс от 6.1.1.
    3. Установите громкость общая реакция на 20 мкл свободной от нуклеиназы водой при необходимости. Осторожно перемешать и инкубировать смесь реакции на 30 ° C в течение 10 мин, затем при 42 ° C 60 мин и наконец на 95 ° C за 5 мин до инактивирует фермент. Прохладный трубы на льду.
      Примечание: Оттепель образцов РНК и все реагенты на льду и подготовить смесь реакции на льду. Если целевой РНК только поля РНК, используйте только грунт dT oligo (2,5 мкм). При необходимости приостановите протокол. Хранить синтезированных cDNA в-20 ° C.
  2. Выполнять qRT ПЦР в технических triplicates (n = 3, Cт стандартное отклонение > 0,2) и в рамках биологической реплицирует (n ≥ 3) с помощью 1 мкл 10 нг cDNA, 0.4 мкл обратного праймера (10 мкм), 0,4 мкл вперед праймера (10 мкм), 10 мкл раствора смеси ДНК полимеразы , 0.4 мкл двухручьевой ДНК, окрашивание краситель, 10 мкл нуклеиназы свободной воды (объем реакции был 20 мкл) для обнаружения продукты PCR, используя следующие условия; провести этап (1 цикл) для 30 сек при 95 ° C, Велоспорт этап (40 циклов) для 5 s на 95 ° C и 30 s при 60 ° C, расплавить кривой стадии. Грунтовка примерами являются для человека Gapdh_Fw: TCTCTGCTCCTCCTGTTC, человека Gapdh_Rv: GCCCAATACGACCAAATCC, EGFP_Fw: GCCCGACAACCACTACCTGAG, EGFP_Rv: CGGCGGTCACGAACTCCAG, SINEUP-GFP_Fw: CTGGTGTGTATTATCTCTTATG и SINEUP-GFP_Rv: CTCCCGAGTCTCTGTAGC. Смотрите таблицу материалов. Анализ количественных выражения РНК с 2- ∆∆Ct ± SD метод28.

7. изображений анализ SINEUPs методом полуавтоматического обнаружения

  1. Вымойте клетки с 0,5 мл PBS для одной скважиной 24 хорошо-плиты.
  2. Добавить 2,0 мкг Hoechst 33342 (см. Таблицу материалы) (растворяют в 500 мкл PBS) каждому хорошо 24-хорошо-плиты и инкубации клеток при 37 ° C за 20 мин до пятно ядра.
  3. Мерой Хехст окрашенные клетки, чтобы подсчитать общее число клеток в голубой выбросов максимум 461 Нм и интенсивность зеленого флуоресценции для подсчета количества позитивных клеток GFP зеленый выбросов максимум 510 нм, используя (цитометр высок объём микро Ну изображения см Таблицу материалы). Анализ белка вверх регулирующее действие SINEUPs путем расчета интенсивности GFP интегрированы, который является суммой всех интенсивности пикселей, отображение сигнала в сегментирована объектов, рассчитывается для каждого канала, с использованием изображений программного обеспечения29.
  4. Урожай клетки для проверки выражения РНК (обратно к шагам 5 и 6).

Representative Results

SINEUP-GFP-это синтетический SINEUP, содержащий как оптимальный BD (-28 / + 4 перекрываются в мРНК гена GFP) и Эд (Перевернутый B2 синус от AS -Uchl1) которые можно вверх регулируют перевод GFP мРНК (Рисунок 3А и 3B) без изменения экспрессии гена GFP мРНК (рис. 3 c и 3D). Для оптимального УРП и ЭЦП для SINEUPs, мы разработали протокол анализа полуавтоматические изображений Улучшено время обнаружения и увеличил количество образцов, которые одновременно проходят проверку по сравнению с обычными Западной блот анализ15. Как показано на рисунке 4, эта система электронного фотографирования высок объём принял 3 дней (Западная блот анализ заняло 2 недели для 48 SINEUPs). Продемонстрировав, что SINEUP-GFP увеличивает GFP перевода, мы обнаружены GFP интегрированных интенсивности цитометр изображения. Оптимальное BD SINEUP-GFP индуцированных 1.4-fold увеличение экспрессии белка GFP. Хотя мы наблюдали сжатия сигналов от 2.6-fold (Западная блот анализ, см. рис. 3а) к 1.4-fold (Imaging анализ, смотрите Рисунок 5), разница может быть связано Калибровка инструмента программного обеспечения обработки изображений. Тем не менее мы обнаружили значительно более высокий уровень флюоресценции GFP, по сравнению с контролем (Рисунок 5А и 5B).

Figure 1
Рисунок 1: основной дизайн синтетических SINEUPs. BD = связывающий домен целевой мРНК, Эд = эффекторных домен, содержащий последовательность Перевернутый синус. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: Транскрипция, начиная с сайтов (тссс) человеческий белок болезнь Паркинсона 7 (PARK7) мРНК в определенных тканях и клетках как определяется Кейдж анализа. (A) A снимок показывает результат поиска ТВУ для человека PARK7 мРНК, используя омику интеграции данных и интерактивной визуализации системы30. Горизонтальные зеленая стрелка в трек hg19 гена Entrez указывает геномной положение ссылки на человека PARK7 мРНК и вертикальные зеленые бары в FANTOM5 КЛЕТКЕ 1 и 2 треки указывают сумму Спецкабель (измеряется как стенограмм за миллион (tpm)) от 1829 виды тканей и клеток. (B) масштаб в регионе заметно ТВУ в группе A (масштаб 1/354: 35.4 kb до 100 bp). Серый затененной области в фазе FANTOM5 КЛЕТКЕ, 1 и 2 треки указывает ТП 6 конкретных ячеек из всего 1829, которые перечислены в нижней части рисунка. Цифры (11.369, 4.998, 4.304, 3,509, 3.477 и 3.055) соответствует этих перечисленных клеток указывают стенограмм за миллион для каждой из ячеек в серой тени должностях ТВУ. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: Западная блот анализ, подтверждающие вверх регулирование перевод SINEUP-GFP. (A) SINEUP-GFP был осмотрен Западной блот с анти GFP антитела. (B) результаты были нормализованы к интенсивности β-миозина белков группы. МРНК гена GFP (C) и (D) SINEUP РНК выражения были обнаружены qRT ПЦР. p < 0.0005, n = 3, 2-Стьюдента t тест, погрешностей, стандартное отклонение. Эта цифра была изменена с Такахаси et al.15. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: схема анализа полуавтоматические изображений SINEUP. День 1: Семя клетки интереса к 24 хорошо плиты. День 2: Transfect GFP и SINEUP-GFP. День 3: Анализ эффекта SINEUPs путем измерения интенсивности GFP интегрированы. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5: высок объём анализ перевода вверх регулирование SINEUP-GFP. (A) сравнение GFP флюоресценция между элементом управления и SINEUP-GFP transfected клеток15. Шкалы бар = 2 mm. (B) GFP комплексной интенсивность нормализована всего мобильный номер ЦИКом ядерных окрашивание с Hoechst 33342. p < 0.0005, n = 3, 2-Стьюдента t тест, погрешностей, стандартное отклонение. ПЗ: поле зрения. Эта цифра была изменена с Такахаси et al.15. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Discussion

Мы описали здесь протокол конкретно повышения производства белка из мишенью мРНК с помощью синус содержащих некодирующих РНК, называется SINEUPs. В качестве примера представитель оптимального синтетических SINEUP-GFP показано вверх регулировать перевод GFP мРНК 2.6-fold как измеряется Западной блот анализ.

Разработка оптимального BD имеет решающее значение для обеспечения SINEUP специфику и потенции (степени белка вверх-регулирования). Ранее мы экранируется Западной блот анализ15 17 BDs SINEUP-GFP и обнаружил, что оптимальный BD перекрывается Авг-Козак последовательность мРНК гена GFP, хотя он не может быть в случае с другими мРНК и должны быть проверены для каждого случая. Еще одна независимая группа также проверку BD, используя другой метод31. Как скрининг многие УРБ может быть довольно длительным и обременительным, мы ввели метод обнаружения SINEUP высокой пропускной способности здесь. Этот метод меры относительные изменения в плотности GFP интегрированы в transfected клеток SINEUP по сравнению с управления вектор transfected клетки. Для обеспечения клетки в частности хорошо плиты культуры являются transfected одинаково и GFP сигнал не сосредоточены только определенного региона хорошо, очень важно распространять клетки одинаково в скважинах на шаге 2.1. Для этой цели осторожно встряхнуть пластину и обратно в 10 раз (↑↓) после посева клетки внутри чистый скамейке и повторять в 5% CO2 инкубатора перед началом инкубации.

Другим важным шагом является расчет концентрации белка в шаге 3.3. Просчеты здесь может привести к загрузке ошибочное количество белка в Западной блот анализ, следовательно, предотвращение обнаружения небольших изменений в выражении протеина, некоторые из слабых SINEUPs или генерации ложных срабатываний от перегрузки. Рекомендуется подготовить свежезаваренным белка калибровочной кривой каждый раз, убедившись, что равное количество стандартов и образцы протеина измеряются в шаге 3.3.3. Протокол описанных здесь сосредоточена на SINEUP-GFP, но Западная блот анализ может быть использован для любых целевых mRNA интереса. Время инкубации и концентрация антител должны быть оптимизированы для каждого целевого компьютера получить лучший результат.

Одной из уникальных особенностей SINEUPs является, что уровень выражения целевого мРНК остается неизменным. Это важно для лечения РНК с DNase, чтобы избежать обнаружения transfected SINEUPs и Геномную ДНК методом ПЦР qRT. SINEUP РНК и выражение mRNA цели должно быть измерено qRT ПЦР для подтверждения успех transfection и SINEUP деятельности. SINEUPs содержат последовательность синус, который богат на протяжении как людские, так и мышь геномов. Чтобы избежать неспецифических обнаружения последовательностей синус, не рекомендуется для разработки qRT ПЦР Праймеры для синус последовательности.

В этом протоколе мы использовали линий клеток человека, но SINEUPs эффективным в ряде клеточных линий из нескольких различных видов12,13,14,18,19. Условия культуры и transfection клетки могут быть изменены согласно различных клеточных линий, до тех пор, как они поддерживать эффективность трансфекции SINEUP векторов. Кроме того могут использоваться альтернативные методы добычи, синтеза cDNA РНК и белка концентрацию проверка, учитывая, что они сохраняют требуемого качества РНК и белков для qRT-PCR и Западной блот анализ. Хотя мы использовали конкретные цитометр микро ну высокой пропускной способности, которая позволила обнаружения GFP флуоресценции через всю скважину, другие цитофлуориметрами с аналогичными дальность обнаружения может быть используемые31. Следует отметить, что если распределение клеток и трансфекции равны во всем хорошо, то это не нужно сканировать весь колодец для флуоресценции GFP: половина или четверть площади хорошо может быть достаточно, чтобы различать SINEUP эффект в зависимости от эксперимент Аль навыки.

Создание протокола обнаружения SINEUP высокой пропускной способностью позволяет для одновременного скрининга несколько УРБ, ориентация данной мРНК в культивируемых клеток. Это важно, поскольку правила, регулирующие оптимальной ориентации, BD до сих пор неясны. Мультиплекс, скрининг системы позволяет для крупномасштабных испытаний многих SINEUPs против различных генов, полезные для охвата нескольких генов, участвующих в частности сигнальный путь к примеру. Кроме того, он может быть использован для расширения поиска для эффективного SINEUPs ориентации несколько мРНК, проектирование различных SINEUP BDs вокруг региона Сен-Козак (см. рис. 1), совместно transfecting полную длину целевой mRNAs (5ʹ утр-CDS-3ʹ утр) сливается с GFP мРНК в культивируемых клеток для поиска оптимального SINEUPs и впоследствии тестирования кандидатов BD против эндогенного мРНК в культивируемых клеток и животных в естественных условиях модели, от людей и мышей для других видов животных и растений.

Этот протокол скрининга является очень быстро. Нам не нужно исправить и собрать клетки, но просто нужно разместить живые клетки культуры пластины в изображения документа. Мы предлагаем использовать этот протокол высокопроизводительного скрининга для выбора оптимального BDs SINEUPs и оценить потенциальных кандидатов, Западная блот анализ. Таким образом отобранные кандидаты с оптимальной УРБ могут применяться для увеличения антител производства18,19,21. В настоящее время РНК терапевтические области резко возрастает. К примеру siRNA, Асо, мРНК и ТРИФОСФАТЫ РНК терапии, широко используются для управления выражение mRNA их соответствующих целей9,32. В этом контексте SINEUPs находятся в зачаточном, но пока никто из изученных SINEUPs изменено выражение целевой мРНК. Кроме того, не изменяйте SINEUPs целевой мРНК, но только вверх регулировать перевод мРНК. Кроме того функция потерь заболеваний в результате haploinsufficiency могут быть направлены на SINEUP терапии, достижения 2 раза индукции протеина17,33. Хотя пробить эффекты должны быть дополнительно изучены, SINEUPs потенциально и конкретно цели единого, выраженная мРНК с дополнительные последовательности в BD.

Ограничение этого высокопроизводительного протокола является, что это не подходит для экрана BDs SINEUPs в в естественных условиях мыши модели, потому что меры по протоколу GFP интегрированных интенсивности только. Как естественный антисмысловых lncRNAs, что post-transcriptionally, SINEUPs не могут применяться, когда целевой мРНК отсутствует в клетки или образцов ткани.

Тем не менее SINEUPs может применяться для усиления функции исследования, повышения антител и как РНК терапии вверх-регулировать экспрессию дефицит белков в диапазоне 1,5-3,0 раза. Описанные здесь методы представляют полезным руководством для целевых и обнаружить SINEUP-индуцированной перевода повышение желаемого мРНК и обеспечить новый инструмент для регулирования post-transcriptional ген.

Disclosures

Соавтор Piero Carninci является одним из основателей TransSINE Technologies Co. Ltd., хранящий интеллектуальной собственности по поданной патент (EP2691522A4 и JP2017169573A) и выдаче патента (US9353370B2) для SINEUP технологии.

Acknowledgments

Это исследование было частично поддерживается фундаментальной науки и технологии программы платформы для инновационных биологической медицины, № 17 am 0301014, от японского агентства для медицинских исследований и развития (AMED), исследовательский грант от МПКСНТ RIKEN центр для жизни Технологии и исследовательский грант от МПКСНТ RIKEN МСМ. Мы благодарим членов лаборатории PC и SINEUP сети ("Сисса", Университет Восточной Пьемонт и RIKEN) для размышлений обсуждения. Мы благодарим д-р Мэтью Валентина для корректуры.

Materials

Name Company Catalog Number Comments
Synthetic SINEUP Cell Guidance Systems Ltd. in UK and K.K.DNAFORM in Japan https://www.cellgs.com/items/sineupand8482.html and https://www.dnaform.jp/en/information/20130320 Step 1.5
HEK293T/17 ATCC ATCC CRL-11268 Step 2.1
Falcon Multiwell Plate For Cell Culture 6 well plate Corning 6902A01 Step 2.1
Corning BioCoat Poly-D-Lysine 24 well Plate Corning 08-774-124 Step 2.1
Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific 11668027 Step 2.2
pEGFP-C2 Clontech #6083-1 Step 2.2
Cell Lysis Buffer (10x) Cell Signaling Technology #9803S Step 3.1 This is pre-mixed cell lysis solution.
PMSF Cell Signaling Technology #8553S Step 3.1 To complete cell lysis buffer, add 0.005% (w/v) PMSF to 1x cell lysis buffer.
DC protein assay kit II BIO RAD #5000112JA Step 3.3
10% Mini-PROTEAN TGX Precast Protein Gels, 12-well, 20 µL BIO RAD #4561035 Step 4.2
Amersham Protran Premium NC 0.45 (150 mm×4 m) Amasham 10600013 Step 4.3, This is a 0.45 µm nitrocellulose membrane.
Nonfat Dry Milk Cell Signaling Technology #9999S Step 4.4 A component of the blocking solution.
GFP Tag Antibody Thermo Fisher Scientific A-6455 Step 4.5 Lot number: 1495850, RRID: AB_221570
Monoclonal Anti-β-Actin antibody produced in mouse SIGMA A5441 Step 4.5 Lot number: 026M4780V, RRID: AB_476744
Polyclonal Goat Anti Rabbit Immunoglobulins Dako P0448 Step 4.5 This is secondary antibody conjugating with HRP for anti GFP antibody. Lot number: 20017525, RRID:AB_2617138
Polyclonal Goat Anti mouse Immunoglobulins Dako P0447 Step 4.5 This is secondary antibody conjugating with HRP for anti β-Actin antibody. Lot number: 20019698, RRID:AB_2617137
ECL Western Blotting Detection Reagents Amersham RPN2109 Step 4.9
Maxwell Rapid Sample Concentrator (RSC) Instrument Promega AS4500 Step 5.1 This is commercially available RNA exreaction instrument.
Maxwell RSC simplyRNA Cells Kit Promega AS1390 Step 5.1 This is commercially available RNA exreaction kit.
TURBO DNA-free Kit ambion AM1907 Step 5.2 and 5.4 The kit contains DNase, DNase buffer and inactivation reagent.
PrimeScrip 1st strand cDNA Synthesis Kit TaKaRa 6110A Step 6.1 The kit contains reagents of first strand cDNA synthesis.
TB Green Premix Ex Taq II TaKaRa RR820A Step 6.2
Hoechst3342 Thermo Fisher Scientific H3570 Step 7.2
Celigo S Nexcelom Bioscience 200-BFFL-S Step 7.3 This is a high throughput micro-well image cytometer.

DOWNLOAD MATERIALS LIST

References

  1. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, (5740), 1564-1566 (2005).
  2. Carninci, P., et al. The transcriptional landscape of the mammalian genome. Science. 309, (5740), 1559-1563 (2005).
  3. Hon, C. C., et al. An atlas of human long non-coding RNAs with accurate 5' ends. Nature. 543, (7644), 199-204 (2017).
  4. Tufarelli, C., et al. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nature Genetics. 34, (2), 157-165 (2003).
  5. Yu, W., et al. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature. 451, (7175), 202-206 (2008).
  6. Carninci, P., Hayashizaki, Y. Noncoding RNA transcription beyond annotated genes. Current Opinion in Genetics & Development. 17, (2), 139-144 (2007).
  7. Chu, Y., Yue, X., Younger, S. T., Janowski, B. A., Corey, D. R. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 38, (21), 7736-7748 (2010).
  8. Ha, M., Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology. 15, (8), 509-524 (2014).
  9. Takahashi, H., Carninci, P. Widespread genome transcription: new possibilities for RNA therapies. Biochemical and Biophysical Research Communications. 452, (2), 294-301 (2014).
  10. Lam, J. K. W., Chow, M. Y. T., Zhang, Y., Leung, S. W. S. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy-Nucleic Acids. 4, e252 (2015).
  11. Nishina, K., et al. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nature communications. 6, 7969 (2015).
  12. Carrieri, C., et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 491, (7424), 454-457 (2012).
  13. Schein, A., Zucchelli, S., Kauppinen, S., Gustincich, S., Carninci, P. Identification of antisense long noncoding RNAs that function as SINEUPs in human cells. Scientific Reports. 6, 33605 (2016).
  14. Zucchelli, S., et al. SINEUPs are modular antisense long non-coding RNAs that increase synthesis of target proteins in cells. Frontiers in Cellular Neuroscience. 9, 174 (2015).
  15. Takahashi, H., et al. Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation. PLOS ONE. 13, (2), e0183229 (2018).
  16. Deutschbauer, A. M., et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 169, (4), 1915-1925 (2005).
  17. Indrieri, A., et al. Synthetic long non-coding RNAs [SINEUPs] rescue defective gene expression in vivo. Scientific Reports. 6, 27315 (2016).
  18. Patrucco, L., et al. Engineering mammalian cell factories with SINEUP noncoding RNAs to improve translation of secreted proteins. Gene. (2015).
  19. Sasso, E., et al. A long non-coding SINEUP RNA boosts semi-stable production of fully human monoclonal antibodies in HEK293E cells. MAbs. 1-8 (2018).
  20. Dang, V. T., Kassahn, K. S., Marcos, A. E., Ragan, M. A. Identification of human haploinsufficient genes and their genomic proximity to segmental duplications. European Journal of Human Genetics. 16, (11), 1350-1357 (2008).
  21. Zucchelli, S., Patrucco, L., Persichetti, F., Gustincich, S., Cotella, D. Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs. Computational and Struct Biotechnology Journal. 14, 404-410 (2016).
  22. Hua, Y., et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes & Development. 24, (15), 1634-1644 (2010).
  23. Watts, J. K., Corey, D. R. Silencing disease genes in the laboratory and the clinic. Journal of Pathology. 226, (2), 365-379 (2012).
  24. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  25. Wu, X., et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nature Biotechnology. 32, (7), 670-676 (2014).
  26. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  27. Liu, X., Harada, S. RNA isolation from mammalian samples. Current Protocols in Molecular Biology. Chapter 4 Unit 4.16 (2013).
  28. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  29. Schneider, C. A., Rasband, W. S., Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 9, (7), 671-675 (2012).
  30. Severin, J., et al. Interactive visualization and analysis of large-scale sequencing datasets using ZENBU. Nature Biotechnology. 32, (3), 217-219 (2014).
  31. Yao, Y., et al. RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat. Nucleic Acids Research. 43, (9), e58 (2015).
  32. Savić, N., Schwank, G. Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research. 168, 15-21 (2016).
  33. Long, H., et al. RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy. Biotechnology Letters. (2016).
Ячейки на основе анализов SINEUP кодирования РНК, которые могут конкретно улучшить перевод мРНК
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).More

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter