Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Celle baseret Assays af SINEUP ikke-kodende RNA'er, der specifikt kan forbedre mRNA Oversættelse

doi: 10.3791/58627 Published: February 1, 2019
* These authors contributed equally

Summary

SINEUPs er syntetiske antisense ikke-kodende RNA'er, som indeholder en bindende domæne (BD) og en effektor domæne (ED) og op-regulere oversættelse af målrette mRNA. Her, beskriver vi detektionsmetoder for SINEUPs i kulturperler cellelinjer, analyse af deres oversættelse-fremme aktiviteten af Western-skamplet og en semi-automatiske høj overførselshastighed imaging system.

Abstract

Målrettede protein ekstraudstyr er af betydning ikke blot for studier af biologiske processer, men også for terapeutiske og bioteknologiske applikationer. Vi præsenterer her, en metode til at selektivt op-regulere protein udtryk for ønskede gener i kulturperler celler ved hjælp af syntetiske antisensstoffer ikke-kodende RNA'er kendt som SINEUPs. Denne positive kontrol af genekspression er på det post-transcriptional niveau og udøves af en omvendt kort spækket nukleare element (sinus) Gentag 3ʹ slutningen af SINEUPs der omfatter dens effektor domæne (ED). SINEUPs kan specielt binder sig til hvilken som helst protein-kodning mRNA valg gennem dets bindende domæne (BD), en region, der er designet til at supplere sekvensen i 5ʹ utranslaterede region (5ʹ UTR) og omkring start codon af mRNA. Target-specifik SINEUPs beregnet på denne måde er transfekteret til kulturperler celler og proteiner og RNA udpakkes nedstrøms analyser, normalt 24-48 h efter Transfektion. SINEUP-induceret protein op-forordning er opdaget af Western-skamplet analyse og RNA udtryk er målt ved hjælp af real-time kvantitativ reverse transkription PCR. Vi har konstateret, at BD design er afgørende for at opnå optimal SINEUP aktivitet og at teste forskellige BD størrelser og holdninger med hensyn til start codon målet mRNA anbefales. Derfor, vi beskriver her en semi-automatiske høj overførselshastighed billedbehandling metode baseret på fluorescens opdagelse, der kan omsættes til target mRNA sammensmeltet med grøn fluorescerende proteiner (NGL). SINEUPs styrke specifikt oversættelse inden for normale fysiologiske interval i cellen, uden at ændre udskrift målniveau. Denne metode er blevet med held ansat mod en vifte af endogene og eksogene mål, i en lang række menneskelige, mus og insekter cellelinjer sammen med in vivo systemer. Desuden er SINEUPs blevet rapporteret at øge antistof produktion og arbejde som et RNA terapeutiske mod haploinsufficient gener. SINEUPs alsidig og modulære karakter gør dem et egnet redskab til at gen-specifikke Translationel kontrol.

Introduction

I post-genom æra, mange indsigter har opnået ind gen regulerende roller ikke-kodende antisense udskrifter på grund af udviklingen af næste generation sequencing teknologier1,2,3 og gen-redigeringsværktøjer. Denne kategori af udskrifter, som blev tidligere anset for at være "transcriptional trash", er nu etableret som en central aktør i genetiske forordning. Antisense udskrifter er rapporteret til at modulere kromatin og kontrol stabilitet og udtryk for deres beslægtet protein-kodning forstand mRNA4,5. I de fleste tilfælde, denne forordning er negative og antisense udskrifter tavshed deres forstand modparter gennem RNA-RNA interaktioner6,7. Dette træk af naturlige antisense udskrifter er blevet udnyttet til at nedregulere ønskede gener i form af syntetiske lille interfererende RNA (siRNA), mikroRNA (miRNA) og antisense oligos (ASO)8,9,10 ,11 forlader et teknologisk tomrum for målrettet genregulering op.

En spændende undersøgelse ændrede perspektiv for feltet antisense RNA ved at demonstrere at antisensstoffer længe ikke-kodende RNA'er (som lncRNAs) af generne Uchl1 (ubiquitin C-terminale hydrolase L1) og Uxt (allestedsnærværende udtrykt udskrift) positivt regulere oversættelse af deres cognate fornemme mRNA på det post-transcriptional niveau i mus12. 5ʹ slutningen af disse afbrudt lncRNAs overlapper med flere baser i 5ʹ utranslaterede region (5ʹ UTR) af deres tilsvarende følelse udskrifter, og den ikke-overlappende 3ʹ ende indeholder en inverteret gentagelse af en retrotransposon, der tilhører kort nukleare element (sinus) familie. Interessant, fandt vi, at den vigtigste drivkraft bag denne translationel op-forordning er den integrerede sinus gentage og det er ikke begrænset til musen sinus gentager kun. Menneskelige Alu repeat-holdige navngivet som lncRNAs også forbedret oversættelsen af target forstand mRNAs, styrke idéen om en ny klasse af sinus-drevet regulerende antisensstoffer ikke-kodende RNA'er, passende SINEUPs13. De seneste undersøgelser viste, at potentialet i naturlige SINEUPs er bevaret i syntetisk SINEUPs designet til specifikt mål forskellige endogene og eksogene gener14,15. SINEUPs har to vigtige funktioner: første "bindende domæne" (BD) som er generelt den 5ʹ ende region komplementær til den sekvens, som omfatter primære start codon af en protein-kodning mRNA, og anden "effektor domæne" (ED) som det inkorporerer en inverteret gentagelse af sinus, hvilket er en forudsætning for SINEUP funktion14 (figur 1). SINEUPs kan tilpasses til at designe en BD specifikt er rettet mod et gen af valg. Dette kan derefter udnyttes for at dissekere funktion af et bestemt gen involveret i en biologisk sti, som et bedre alternativ til en konventionel mRNA overekspression strategi. Desuden denne alsidig værktøj kan anvendes til at styrke antistof produktion, og som et lægemiddel til behandling af haploinsufficient sygdomme forårsaget af utilstrækkelig doser af funktionelle proteiner16,17,18, 19,20,21.

Fordelene ved SINEUP teknologi er mangfoldige. Det ændrer ikke udtryk for målet på det transkriptionel niveau. Længere BDs give flere specificitet til SINEUPs, mens ikke fremkalde en dsRNA-afhængige stress reaktion15. Protein induktion opretholdes inden for den normale fysiologiske vifte af cellen, forhindrer enhver skadelig indvirkning på grund af afvigende eller overdreven protein udtryk. SINEUPs er kompatibel med en lang række mus, menneskelige, og hamster kulturperler cellelinjer, for eksempel, HEK293T/17, HepG2, HeLa, CHO, MN9D og mange flere12,13,14,15,18 ,19. SINEUPs kan effektivt målrette endogene gener, forbigående overexpressed gener og FLAG-mærket eller luciferase-fusion gener, hvilket eliminerer behovet for gen-specifikke antistoffer14,18. Den grundlæggende SINEUP analyse kræver rutine cellekultur, Transfektion, sodium dodecyl sulfat-polyacrylamid gelelektroforese (SDS-PAGE), realtid kvantitative reverse transkription-polymerase kæde reaktion (qRT-PCR) instrumenter og indstillinger, og ekspertise kan opnås på kort tid.

Her, beskriver vi en metode for målretning gener med syntetisk SINEUPs op-regulere oversættelse, en effekt i modsætning til andre teknologier såsom RNA interferens9 og ASO gapmers11,22,23. En meget udbredt metode til RNA-styrede genaktivering er grupperet regelmæssigt interspaced korte palindromiske gentager-baseret aktivering (CRISPRa), hvor genekspressionen udløses på det transkriptionel niveau24. Denne metode, men enkel og hurtig, kræver flere enkelt guide RNA'er (sgRNAs) rettet mod det samme gen for højere effektivitet, hvilket øger chancerne for off-mål bindende25. Desuden den centrale enzym af CRISPRa systemet, katalytisk døde CRISPR-forbundet protein 9 (dCas9) har lav bindende specificitet og sgRNAs rettet mod bi-directional promotor regioner kan ikke-specifikt op-regulere i nærheden gener25. Omvendt, SINEUPs binder målretter mRNA på en enkelt bindende region med høj specificitet og påvirker ikke udtryk for nærliggende gener. Vi diskutere de grundlæggende trin involveret i SINEUP design, Transfektion, proteiner og RNA udtryk analyser. Desuden præsenterer vi en semi-automatiske, høj overførselshastighed billedbehandlingssystem gennemgå flere SINEUPs på én gang, hvilket er nyttigt til påvisning af optimal SINEUPs.

Protocol

1. design af BDs af SINEUP konstruktioner for Target mRNAs

  1. Kontrollere transskription start websted (TSS) og oversættelse start stedet for target mRNAs i cellerne i interesse. Erhverve TSS data fra både ENCODE og FANTOM projekter (cap analyse af genekspression, bur) (ぜんぶ: http://fantom.gsc.riken.jp/zenbu/).
  2. Åbn browseren, Søg gener af interesse og kontrollere TSS bur toppe.
  3. Konsultere eksempel analyse af celler og væv specifikke TSS af Parkinsons sygdom protein 7 (PARK7) mRNA vist i figur 2.
  4. Design BD sekvenser af flere forskellige længder svarende til 40 baser opstrøms og 32 baser nedstrøms de første methionin (AUG), 72 nt i alt.
  5. Custom bestille de designede BDs i SINEUP udtryk vektor (Se Tabel af materialer).
    Bemærk: Kontrollere sekvens specificitet ved grundlæggende lokale justering søgeværktøj (BLAST) at undgå off target effekter26.

2. celle kultur og SINEUP Transfektion

  1. Frø celler af interesse i en 6 godt-plade eller 24 godt-plade i 24 timer før Transfektion af SINEUPs. I tilfælde af menneskelige embryonale nyre cellelinje (HEK293T/17) (Se Tabel af materialer), frø 0,5 x 106 celler pr. brønd af et 6 godt-plade eller 1.5 x 105 celler pr. brønd af en poly-D-lysin belagt 24 godt-plade (Se Tabel af materialer). Det bliver 70% sammenflydende efter 24 timer.
  2. Efter 24 timer, skal du ændre medium til 1,5 mL frisk medium for en 6 godt-plade eller 0,4 mL frisk medium for en 24 godt-plade. I tilfælde af SINEUP-normal god landbrugspraksis, transfect 0,6 µg for pEGFP-C2 (Se Tabel af materialer) og 3,4 µg for SINEUP-normal god landbrugspraksis i et godt af en 6 godt-plade eller 130 ng af pEGFP-C2 og 670 ng af SINEUP-normal god landbrugspraksis i et godt af en 24 godt-plade med Transfektion reagens (10 µL i 6 godt-plade og 3 µ L i 24 godt-plade) ved at følge producentens instruktioner (Se Tabel af materialer), og der inkuberes ved 37 ° C i en 5% CO2 inkubator i 24 timer.
  3. Vaske cellerne med 2 mL af fosfat buffer saltvand (PBS) (37 mM NaCl, 8 mM Na2HPO4, 2,6 mM KCl og 1,5 mM KH2PO4) i hvert hul i en 6 godt-plade eller 0,5 mL PBS i hvert hul i en 24 godt-plade. Kun for poly-D-lysin belagt 24 godt-plade, tilsæt 25 µL af 0,05% vægt pr. volumen Trypsin, inkuberes i en 5% CO2 inkubator i 5 min og tilføje 275 µL af celle medium pr. brønd. I tilfælde af 6 godt-plade, der tilsættes 2 mL PBS i hvert hul. Med pipette overfoeres op og ned for at høste 3/4 af celler (1,5 mL til en 6 godt-plade) eller 225 µL til en 24 godt-plade fra 1 godt for protein udvinding (gå til protokol 3 til protein udvinding) og 1/4 af celler (0,5 mL til en 6 godt-plade) eller 75 µL til en 24 brønden-plade for RNA udvinding og centrifugeres ved 6.000 x g i 5 min. ved 4 ° C (gå til trin 5 for RNA udvinding).
    Bemærk: Analysere effekten af SINEUP-normal god landbrugspraksis i en poly-D-lysin belagt 24 godt-plade af billedbehandling. Gå til trin 7 (imaging analyse).

3. protein udvinding

  1. Omhyggeligt Aspirér 1,5 mL PBS og tilføje 140 µL af lysis løsning (20 mM Tris-HCl (pH 7,5), 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% (w/v) Triton, 2,5 mM natrium pyrofosfat, 1 mM β-glycerophosphate, 1 mM Na3VO4 1 μg/mL leupeptin og 0,005% (w/v) phenylmethylsulfonyl fluorid (PMSF)) (Se Tabel af materialer) for en 6 godt-plade eller 60 µL til en 24 godt-plade til celle pellets.
  2. Mix af pipettering og derefter blandes grundigt ved at dreje ved lav hastighed i 1 time ved 4 ° C. Indsamle supernatanten ved centrifugering ved 14.000 x g i 10 min. ved 4 ° C.
  3. Kontrollere proteinkoncentration ved kolorimetriske assay (se tabel af materialer). Forberede alle reaktioner ved stuetemperatur.
    1. Laves 5 - 6 gange fortynding af bovint serumalbumin (BSA) protein standard i ultrarent vand med koncentrationer spænder fra 0,2-1,5 mg/mL protein. Forberede frisk standarder hver gang.
    2. Forberede arbejde reagens Aʹ ved at blande 1 mL af reagenset en (alkalisk kobber tartrat løsning) med 20 µL af reagens S (overfladeaktive løsning).
    3. Indlæse 5 µL af vand (negativ kontrol), BSA standard (protein standard og positiv kontrol) eller protein prøve i hver brønd med en 96-brønd-plade.
    4. Tilsæt 25 µL af reagens Aʹ i hver brønd. Forsigtigt tilføje 200 µL af reagens B (Folin reagens) pr. godt undgå enhver boble-dannelse. Dække plade med alufolie og vente på 5-10 min.
    5. Protein absorbansen ved 750 nm med et spektrofotometer. Absorbansen er stabil i mindst 1 time.
    6. Forbered standardkurve ved at plotte BSA standard protein koncentrationer (mg/mL) på x-aksen og deres respektive absorbans på y-aksen. Beregne prøve proteinkoncentration ved at anvende standardkurven ligning.
      Bemærk: Pause protokol på dette trin, hvis det er nødvendigt eller gå til trin 4. Til langtidsopbevaring, snap fryse protein prøver i flydende nitrogen og opbevares ved-80 ° C.

4. protein adskillelse af SDS-PAGE og påvisning af Target proteiner med antistoffer (Western-skamplet analyse)

  1. Tilføje en volumen på 2 x lastning farvestof (0,1 M Tris-HCl (pH 6,8), 4% SDS, 20% glycerol, 1,42% 2-mercaptethanol og 0,2% bromophenol blå) til hver volumen af protein stikprøve fra trin 3.3. Varme ved 90 ° C i 5 min og straks afkøles i isbad i 1 min.
  2. Indlæse 10-20 µg protein prøver, at 10% SDS poly-acrylamid gel og separat på 100-150 V) (Se Tabel af materialer).
  3. Overføre protein fra gel til 0,45 µm nitrocellulose membran (Se Tabel af materialer) af halvtør overførsel instrument med overførsel buffer (25 mM Tris, 192 mM glycin og 20% methanol) på 25 V i 30 min.
  4. Tilføje blokerende løsning (5% fedtfrit tørt mælk i 1 x TBST buffer (137 mM NaCl, 20 mM Tris-HCl (pH 7,6), 0,1% Tween-20)) (Se Tabel af materialer) til beholder indtil membranen er helt gennemblødt og inkuberes ved stuetemperatur i 30 min.
  5. I tilfælde af SINEUP-normal god landbrugspraksis, krydse protein med anti-normal god landbrugspraksis antistof (fortyndet 1: 2000 i blokerende løsning) (Se Tabel af materialer) ved at inkubere membran for 30 min med ryster ved stuetemperatur. Som en intern protein, opdage β-actin protein af hybridizing med Anti-β-Actin antistof (fortyndet 1: 2000 i blokerende løsning) (Se Tabel af materialer) i 30 min med ryster ved stuetemperatur.
  6. Tilføje 1 x TBST buffer til beholderen, indtil membranen er helt gennemblødt og vask for 5 min ved stuetemperatur. Gentag vask trin to flere gange (tre vasker alt).
  7. Krydse normal god landbrugspraksis protein til fortyndet (1:1000 i blokerende løsning) anti-kanin antistof konjugeret med peberrodsperoxidase (HRP), og krydse β-actin protein til fortyndet (1:1000 i blokerende løsning) anti-mus antistof konjugeret med HRP på membranen for 30 min med ryster ved stuetemperatur.
  8. Vask membran med 1 x TBST buffer for 5 min ved stuetemperatur. Gentag vask trin to flere gange (tre vasker alt).
  9. Bland lige saa stort volumen af HRP-forstærket kemiluminescens (ECL) påvisning reagens 1 og 2 (Se Tabel af materialer). Overføre membranen til 2 mL ECL reagens blandes, dække boksen med aluminiumsfolie og lad det inkuberes i 1-2 min. ved stuetemperatur. Forsigtigt fjerne membranen fra ECL reagens blandes og udsætte ved hjælp af en luminescence imaging instrument.

5. RNA udvinding og DNase behandling

  1. Ekstrakt total RNA følgende standard protokol for RNA udvinding fra celler dyrkes i en éncellelag27 eller alternativt bruge en kommercielt tilgængelig RNA udvinding kit (Se Tabel af materialer). Statslige kort, tilføje enhver monofasiske lysis reagens (MLR) guanidin tilsat og phenol de høstede celler i trin 2,3 (1 mL MLR pr. ~ 5 millioner celler)27.
    Bemærk: Ændre handsker hyppigt. Bruge RNase-fri reagenser, og diethylpyrocarbonate (DEPC)-behandlet plast ware og glasvarer at forhindre RNA nedbrydning. Pause protokol på dette trin, hvis det er nødvendigt. Butik ekstraheret RNA ved-80 ° C.
  2. Tilføje 0,1 volumen af 10 x DNase buffer og 2 U af DNase til den oprensede RNA fra trin 5.1 (Se Tabel af materialer).
  3. Indstille reaktion lydstyrken til 50 µL med nukleasen-gratis vand og blandes forsigtigt. Der inkuberes ved 37 ° C i 30 min.
  4. Tilføje 0,1 volumen igen suspenderede DNase inaktivering reagens og bland godt (Se Tabel af materialer). Inkuber i 5 min. ved stuetemperatur med blid ryster.
  5. Centrifugeres ved 10.000 x g for 90 s. overførsel supernatanten (DNA-fri RNA) til en frisk RNase-fri 1,5 mL tube. Pas på ikke at røre pelleten, da dette kan fremkalde fremførsel af DNase, som er besværlige for downstream trin.
  6. Kvantificere RNA ved måling af en260 og en260/A280 ratio (for ren RNA, området er 1,8-2,0) i Spektrofotometer UV.

6. den første streng cDNA syntese og qRT-PCR analyse

  1. Udføre første streng cDNA syntese efter en standard cDNA syntese protokol som nedenfor (se tabel af materialer).
    1. Bland 0,75 µM oligo dT primer, 4,3 µM tilfældige primer, dNTP'er (10 mM) med 200-500 ng total RNA (fra trin 5-8) i 10 µL af samlede reaktion volumen. Der inkuberes ved 65 ° C i 5 min og derefter straks lagt på is.
    2. Bland 1 x reverse transkriptase buffer, 1 U af RNase inhibitor, 10 U i reverse transkriptase, og tilføje til 10 µL RNA-primer mix fra 6.1.1.
    3. Indstille samlede reaktion lydstyrken til 20 µL med nukleasen-gratis vand, hvis det kræves. Bland forsigtigt og inkuberes mastermix ved 30 ° C i 10 min, så på 42 ° C i 60 min, og endelig ved 95 ° C i 5 min at inaktiverer enzymet. Cool rør på is.
      Bemærk: Tø RNA prøver og alle reagenser på is og forberede mastermix på is. Hvis målet RNA'er er kun polyA RNA'er, bruge oligo dT primer kun (2,5 µM). Pause protokollen, hvis det er nødvendigt. Gemme syntetiserede cDNA ved-20 ° C.
  2. Udføre qRT-PCR i tekniske tre (n = 3, Cт standardafvigelse > 0,2) og inden for biologiske flergangsbestemmelser (n ≥ 3) ved hjælp af 1 µL af 10 ng cDNA, 0,4 µL af reverse primer (10 µM), 0,4 µL af fremad primer (10 µM), 10 µL af blandingen løsning af DNA polymerase , 0,4 µL af dobbelt-strenget DNA farvning farvestof, 10 µL af nukleasen-gratis vand (reaktion volumen var 20 µL) påvise PCR produkter benytter næste betingelser; hold fase (1 cyklus) for 30 s ved 95 ° C, cykling fase (40 cyklusser) for 5 s ved 95 ° C og for 30 s på 60 ° C, smelte kurve fase. Primer eksempler er for menneskelige Gapdh_Fw: TCTCTGCTCCTCCTGTTC, menneskelige Gapdh_Rv: GCCCAATACGACCAAATCC, EGFP_Fw: GCCCGACAACCACTACCTGAG, EGFP_Rv: CGGCGGTCACGAACTCCAG, SINEUP-GFP_Fw: CTGGTGTGTATTATCTCTTATG og SINEUP-GFP_Rv: CTCCCGAGTCTCTGTAGC. Se tabel over materialer. Analysere kvantitative RNA udtryk med 2- ∆∆Ct ± SD metode28.

7. imaging analyse af SINEUPs af semi-automatiserede påvisningsmetode

  1. Vaske cellerne med 0,5 mL PBS for et godt af en 24 godt-plade.
  2. Tilføje 2,0 μg af Hoechst 33342 (Se Tabel af materialer) (opløse i 500 μL af PBS) til hver godt af 24-godt-plade og inkuberes celler ved 37 ° C i 20 min. til at plette kernen.
  3. Foranstaltning Hoechst farvede celler for at tælle det samlede antal celler på højst blå emission af 461 nm, og intensiteten af grønne fluorescens til at tælle antallet af normal god landbrugspraksis positive celler på højst grønne emission på 510 nm ved hjælp af en høj overførselshastighed mikro-godt billede forskellige ( Se Tabel af materialer). Analysere protein op-regulerende virkning af SINEUPs ved beregning af normal god landbrugspraksis integreret intensitet, hvilket er summen af alle pixel intensiteter vise signal i segmenterede genstande beregnet for hver kanal, ved hjælp af Imaging software29.
  4. Høste celler til at kontrollere RNA udtryk (tilbage til trin 5 og 6).

Representative Results

SINEUP-normal god landbrugspraksis er et syntetisk SINEUP som indeholder både en optimal BD (-28 / 4 overlapper til normal god landbrugspraksis mRNA) og en ED (omvendt sinus B2 fra AS -Uchl1) der kan op-regulere normal god landbrugspraksis mRNA oversættelse (figur 3A og 3B) uden at ændre udtryk for normal god landbrugspraksis mRNA (figur 3 c og 3D). Gennemgå optimal BDs og EDs for SINEUPs, udviklede vi en protokol af semi-automatiserede billedanalyse, som forbedret afsløring tid og øget antallet af prøver er samtidigt screenes sammenlignet med en konventionel Western-skamplet analyse15. Som vist i figur 4, tog denne høj overførselshastighed billedbehandlingssystem 3 dage (Western-skamplet analyse tog 2 uger for 48 SINEUPs). Har vist, at SINEUP-NGL øger normal god landbrugspraksis oversættelse, opdaget vi normal god landbrugspraksis integreret intensiteten af billedet Flowcytometret. Den optimale BD SINEUP-NGL induceret en 1,4 stigning i normal god landbrugspraksis protein udtryk. Selv om vi observeret komprimering af signaler fra 2.6-fold (Western-skamplet analyse, se figur 3A) til 1,4 (Imaging analyse, se figur 5), forskellen kan skyldes kalibrering af instrumentet billedbehandlingsprogrammer. Ikke desto mindre, vi opdaget betydeligt højere niveauer af normal god landbrugspraksis fluorescens sammenlignet med kontrol (figur 5A og 5B).

Figure 1
Figur 1: grundlæggende design af de syntetiske SINEUPs. BD = bindende domæne for at målrette mRNA, ED = effektor domæne indeholdende en omvendt sinus sekvens. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: Transskription starter websteder (TSSs) af menneskelige Parkinsons sygdom protein 7 (PARK7) mRNA i specifikke væv og celler som opdaget af bur analyse. (A) A snapshot viser et TSS søgeresultat for menneskelige PARK7 mRNA ved hjælp af en omik dataintegration og interaktiv visualisering system30. Den vandrette grønne pil i Entrez gen hg19 spor angiver genomisk placeringen af referencen menneskelige PARK7 mRNA og de lodrette grønne bjælker i FANTOM5 bur 1 og 2 spor viser summen af TSSs (målt som udskrifter pr. million (tpm)) fra 1.829 typer af væv og celler. (B) Zoom i TSS i panelet A markant regionen (1/354 skala: 35,4 kb til 100 bp). Grå skygge området i FANTOM5 bur fase 1 og 2 spor angiver TSS 6 specifikke celler ud af de samlede 1,829, som er listet i bunden af figuren. Numre (11.369, 4.998, 4.304, 3.509, 3.477 og 3.055) svarende til disse angivne celler angiver udskrifter pr. million for hver specifik celle på grå skygge positioner af TSS. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: Western-skamplet analyse bekræfter op-regulering af oversættelse af SINEUP-NGL. (A) SINEUP-NGL blev undersøgt af vestlige-skamplet med anti-normal god landbrugspraksis antistof. (B) resultater var normaliseret til intensiteten af β-actin protein band. (C) NGL mRNA og (D) SINEUP RNA'er udtryk blev opdaget af qRT-PCR. p < 0.0005, n = 3, tosidede student's t-test, fejllinjer er standardafvigelse. Dette tal er blevet ændret fra Takahashi et al.15. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: skematisk af SINEUP semi-automatiske billedanalyse. Dag 1: Frø celler af interesse i en 24 godt-plade. Dag 2: Transfect normal god landbrugspraksis og SINEUP-normal god landbrugspraksis. Dag 3: Analysere effekten af SINEUPs ved at måle normal god landbrugspraksis integreret intensitet. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: høj overførselshastighed analyse af oversættelse op-regulering af SINEUP-NGL. (A) sammenligning af normal god landbrugspraksis fluorescens mellem kontrol og SINEUP-NGL transfekteret celler15. Skalalinjen = 2 mm. (B) NGL integreret intensitet var normaliseret til cellen total antal optalt af nukleare farvning med Hoechst 33342. p < 0.0005, n = 3, tosidede student's t-test, fejllinjer er standardafvigelse. FOV: synsfelt. Dette tal er blevet ændret fra Takahashi et al.15. Venligst klik her for at se en større version af dette tal.

Discussion

Vi beskrevet her en protokol til at specifikt øge protein produktion af mål mRNA ved hjælp af en sinus-der indeholder ikke-kodende RNA, kaldet SINEUPs. Som et repræsentativt eksempel, er optimal syntetiske SINEUP-normal god landbrugspraksis vist at op-regulere oversættelse af normal god landbrugspraksis mRNA 2.6-fold målt ved Western blot analyse.

Designe en optimal BD er afgørende for at sikre SINEUP specificitet og potens (omfanget af protein op-regulering). Tidligere vi screening 17 BDs af SINEUP-NGL med Western blot analyse15 og fundet, at den optimale BD overlapper AUG-KOZAK-sekvensen af normal god landbrugspraksis mRNA, selvom det ikke måske være tilfældet med andre mRNAs og skal kontrolleres for hver enkelt sag. En anden uafhængig gruppe også screenet BD benytter en anden metode31. Som screening mange BDs kan være ret tidskrævende og besværlige, indført vi en høj overførselshastighed SINEUP påvisningsmetode her. Denne metode måler relative ændringer i normal god landbrugspraksis integreret tæthed i SINEUP transfekteret-celler i forhold til kontrol vektor transfekteret-celler. For at sikre at cellerne i en særlig godt af en kultur plade er transfekteret lige så og normal god landbrugspraksis signal er ikke koncentreret til kun en bestemt region af brønden, er det meget vigtigt at distribuere celler ligeligt i brønde i trin 2.1. Til dette formål, forsigtigt ryste plade 10 gange frem og tilbage (↑↓) efter såning celler inde i en ren bænk og Gentag i 5% CO2 inkubator før du starter inkubationen.

En anden kritisk trin er beregningen af proteinkoncentration taktfast 3.3. Fejlberegninger her kan føre til indlæsning af en forkert mængde protein under Western-skamplet analyse, dermed forhindre påvisning af små ændringer i protein udtryk af nogle af de svage SINEUPs eller generere falske positiver fra overbelastning. Det anbefales at frisk forberede protein standardkurven hver gang, og sørg for, at lige store mængder af standarder og protein prøver måles i trin 3.3.3. Protokollen beskrevet her fokuserer på SINEUP-normal god landbrugspraksis, men Western-skamplet analyse kan bruges til nogen målrette mRNA af interesse. Inkubationstiden og koncentration af antistoffer bør optimeres for hvert mål at få det bedste resultat.

En af de unikke kendetegn ved SINEUPs er, at målet-mRNA udtryk niveau forbliver upåvirket. Det er vigtigt at behandle RNA med DNase til at undgå afsløring af transfekteret SINEUPs og genomisk DNA af qRT-PCR. SINEUP RNA'er og target mRNA udtryk bør måles på qRT-PCR at bekræfte succes både Transfektion og SINEUP aktivitet. SINEUPs indeholder en sinus sekvens, som er rigelige i hele både menneskelige og mus genomer. For at undgå ikke-specifik detektion af sinus sekvenser, er det ikke anbefales at designe qRT-PCR primere til sinus sekvens.

Vi brugte humane cellelinjer i denne protokol, men SINEUPs er effektiv i en række cellelinier fra flere forskellige arter12,13,14,18,19. Celle kultur og Transfektion betingelser kan ændres afhængig forskellige cellelinjer, så længe disse opretholde Transfektion effektivitet af SINEUP vektorer. Derudover kan alternative metoder for RNA udvinding, cDNA syntese, og protein koncentration kontrol ansat, eftersom at de bevare den krævede RNA og protein kvalitet for qRT-PCR og Western blot analyse. Mens vi brugte en specifik høj overførselshastighed mikro-godt Flowcytometret, som aktiveret registrering af normal god landbrugspraksis fluorescens på tværs af hele brønden, kan andre cytometers med en lignende registreringsområde brugte31. Det er værd at bemærke, at hvis fordelingen af celler og Transfektion er ens overalt i en brønd, så det ikke er nødvendigt at scanne hele brønden for normal god landbrugspraksis fluorescens: halvdelen eller en fjerdedel af området med et brønd kan være nok til at skimte SINEUP virkning afhængig af eksperiment Al færdigheder.

Oprettelse af en høj overførselshastighed SINEUP opdagelse protokol giver mulighed for samtidige screening af flere BDs rettet mod en given mRNA i kulturperler celler. Dette er vigtigt, da reglerne for optimal målretning af BD er stadig uklare. Sådan en multiplex screening system giver mulighed for omfattende afprøvning af mange SINEUPs mod forskellige gener, nyttige for at målrette flere gener involveret i en bestemt signalvejen for eksempel. Derudover det kan udnyttes til at udvide search for effektiv SINEUPs rettet mod flere mRNAs, designe forskellige SINEUP BDs omkring august-Kozak region (Se figur 1), co transfecting fuld længde mål mRNAs (5ʹ UTR-cd'er-3ʹ UTR) sammensmeltet med normal god landbrugspraksis mRNA i dyrkede celler til at finde den optimale SINEUPs, og efterfølgende test BD kandidater mod endogene mRNA i kulturperler celler og in vivo model dyr, fra mennesker og mus til andre dyr og plante arter.

Denne screening protokol er meget hurtig. Vi behøver ikke at lave og indsamle celler, men skal bare placere levende celle kultur plade i den billeddiagnostiske instrument. Vi foreslår at bruge denne high throughput screening protokol at vælge optimal BDs af SINEUPs og evaluere potentielle kandidater med Western blot analyse. Således kan valgte kandidater med optimal BDs anvendes til at øge antistof produktion18,19,21. Feltet RNA terapeutiske vokser i øjeblikket, dramatisk. For eksempel, er siRNA, ASO, mRNA og CRISPR RNA behandlingsformer, bredt ansat til at styre mRNA udtryk for deres respektive mål9,32. I denne sammenhæng, SINEUPs er i deres vorden, men indtil videre ingen af de undersøgte SINEUPs ændret udtryk for target mRNAs. Derudover SINEUPs redigerer ikke målrette mRNA, men kun op-regulere oversættelse af mRNA. Endvidere kan tab af funktion sygdomme som følge af haploinsufficiency blive ramt af SINEUP terapi, at opnå en 2-fold induktion af mangelfuld protein17,33. Selv om off-target virkninger skal undersøges yderligere, målrette SINEUPs potentielt og specielt en enkelt, udtrykt mRNA med en supplerende sekvens til BD.

En begrænsning af denne høj overførselshastighed protokol er, at det ikke er egnet til skærmen BDs af SINEUPs i in vivo musemodeller fordi protokollen foranstaltninger for normal god landbrugspraksis integreret intensitet kun. SINEUPs kan ikke naturlige antisense lncRNAs, der virker post-transcriptionally, de anvendes når målet mRNA er mangler i celler eller vævsprøver.

Ikke desto mindre, kan SINEUPs anvendes til forstærkning af funktion studier, at forbedre antistof produktion, og som et RNA terapi til op-regulere udtryk for mangelfuld proteiner inden for intervallet af 1,5-3,0-fold. De metoder, der beskrives her præsenterer en nyttig guide for at målrette og opdage SINEUP-induceret oversættelse forbedring af ønskede mRNA og giver et nyt værktøj for post-transcriptional RIBOREGULATION.

Disclosures

Den tilsvarende forfatteren Piero Carninci er en af grundlæggerne af TransSINE Technologies Co. Ltd., der besidder immaterielle på gemt patent (EP2691522A4 og JP2017169573A), og gives patent (US9353370B2) for SINEUP teknologi.

Acknowledgments

Denne undersøgelse var delvist støttet af grundlæggende videnskab og Platform teknologi Program for Innovative biologisk medicin, no. 17 er 0301014, fra Japan Agency for medicinalforskning og udvikling (AMED), forskning tilskud fra MEXT RIKEN-Center for livet Videnskab teknologi og forskning tilskud fra MEXT til RIKEN IMS. Vi takke medlemmerne af PC lab og SINEUP netværket (SISSA, Universitet af østlige Piemonte og RIKEN) for tankevækkende drøftelser. Vi takker Dr. Matthew Valentine for korrekturlæsning.

Materials

Name Company Catalog Number Comments
Synthetic SINEUP Cell Guidance Systems Ltd. in UK and K.K.DNAFORM in Japan https://www.cellgs.com/items/sineupand8482.html and https://www.dnaform.jp/en/information/20130320 Step 1.5
HEK293T/17 ATCC ATCC CRL-11268 Step 2.1
Falcon Multiwell Plate For Cell Culture 6 well plate Corning 6902A01 Step 2.1
Corning BioCoat Poly-D-Lysine 24 well Plate Corning 08-774-124 Step 2.1
Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific 11668027 Step 2.2
pEGFP-C2 Clontech #6083-1 Step 2.2
Cell Lysis Buffer (10x) Cell Signaling Technology #9803S Step 3.1 This is pre-mixed cell lysis solution.
PMSF Cell Signaling Technology #8553S Step 3.1 To complete cell lysis buffer, add 0.005% (w/v) PMSF to 1x cell lysis buffer.
DC protein assay kit II BIO RAD #5000112JA Step 3.3
10% Mini-PROTEAN TGX Precast Protein Gels, 12-well, 20 µL BIO RAD #4561035 Step 4.2
Amersham Protran Premium NC 0.45 (150 mm×4 m) Amasham 10600013 Step 4.3, This is a 0.45 µm nitrocellulose membrane.
Nonfat Dry Milk Cell Signaling Technology #9999S Step 4.4 A component of the blocking solution.
GFP Tag Antibody Thermo Fisher Scientific A-6455 Step 4.5 Lot number: 1495850, RRID: AB_221570
Monoclonal Anti-β-Actin antibody produced in mouse SIGMA A5441 Step 4.5 Lot number: 026M4780V, RRID: AB_476744
Polyclonal Goat Anti Rabbit Immunoglobulins Dako P0448 Step 4.5 This is secondary antibody conjugating with HRP for anti GFP antibody. Lot number: 20017525, RRID:AB_2617138
Polyclonal Goat Anti mouse Immunoglobulins Dako P0447 Step 4.5 This is secondary antibody conjugating with HRP for anti β-Actin antibody. Lot number: 20019698, RRID:AB_2617137
ECL Western Blotting Detection Reagents Amersham RPN2109 Step 4.9
Maxwell Rapid Sample Concentrator (RSC) Instrument Promega AS4500 Step 5.1 This is commercially available RNA exreaction instrument.
Maxwell RSC simplyRNA Cells Kit Promega AS1390 Step 5.1 This is commercially available RNA exreaction kit.
TURBO DNA-free Kit ambion AM1907 Step 5.2 and 5.4 The kit contains DNase, DNase buffer and inactivation reagent.
PrimeScrip 1st strand cDNA Synthesis Kit TaKaRa 6110A Step 6.1 The kit contains reagents of first strand cDNA synthesis.
TB Green Premix Ex Taq II TaKaRa RR820A Step 6.2
Hoechst3342 Thermo Fisher Scientific H3570 Step 7.2
Celigo S Nexcelom Bioscience 200-BFFL-S Step 7.3 This is a high throughput micro-well image cytometer.

DOWNLOAD MATERIALS LIST

References

  1. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, (5740), 1564-1566 (2005).
  2. Carninci, P., et al. The transcriptional landscape of the mammalian genome. Science. 309, (5740), 1559-1563 (2005).
  3. Hon, C. C., et al. An atlas of human long non-coding RNAs with accurate 5' ends. Nature. 543, (7644), 199-204 (2017).
  4. Tufarelli, C., et al. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nature Genetics. 34, (2), 157-165 (2003).
  5. Yu, W., et al. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature. 451, (7175), 202-206 (2008).
  6. Carninci, P., Hayashizaki, Y. Noncoding RNA transcription beyond annotated genes. Current Opinion in Genetics & Development. 17, (2), 139-144 (2007).
  7. Chu, Y., Yue, X., Younger, S. T., Janowski, B. A., Corey, D. R. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 38, (21), 7736-7748 (2010).
  8. Ha, M., Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology. 15, (8), 509-524 (2014).
  9. Takahashi, H., Carninci, P. Widespread genome transcription: new possibilities for RNA therapies. Biochemical and Biophysical Research Communications. 452, (2), 294-301 (2014).
  10. Lam, J. K. W., Chow, M. Y. T., Zhang, Y., Leung, S. W. S. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy-Nucleic Acids. 4, e252 (2015).
  11. Nishina, K., et al. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nature communications. 6, 7969 (2015).
  12. Carrieri, C., et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 491, (7424), 454-457 (2012).
  13. Schein, A., Zucchelli, S., Kauppinen, S., Gustincich, S., Carninci, P. Identification of antisense long noncoding RNAs that function as SINEUPs in human cells. Scientific Reports. 6, 33605 (2016).
  14. Zucchelli, S., et al. SINEUPs are modular antisense long non-coding RNAs that increase synthesis of target proteins in cells. Frontiers in Cellular Neuroscience. 9, 174 (2015).
  15. Takahashi, H., et al. Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation. PLOS ONE. 13, (2), e0183229 (2018).
  16. Deutschbauer, A. M., et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 169, (4), 1915-1925 (2005).
  17. Indrieri, A., et al. Synthetic long non-coding RNAs [SINEUPs] rescue defective gene expression in vivo. Scientific Reports. 6, 27315 (2016).
  18. Patrucco, L., et al. Engineering mammalian cell factories with SINEUP noncoding RNAs to improve translation of secreted proteins. Gene. (2015).
  19. Sasso, E., et al. A long non-coding SINEUP RNA boosts semi-stable production of fully human monoclonal antibodies in HEK293E cells. MAbs. 1-8 (2018).
  20. Dang, V. T., Kassahn, K. S., Marcos, A. E., Ragan, M. A. Identification of human haploinsufficient genes and their genomic proximity to segmental duplications. European Journal of Human Genetics. 16, (11), 1350-1357 (2008).
  21. Zucchelli, S., Patrucco, L., Persichetti, F., Gustincich, S., Cotella, D. Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs. Computational and Struct Biotechnology Journal. 14, 404-410 (2016).
  22. Hua, Y., et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes & Development. 24, (15), 1634-1644 (2010).
  23. Watts, J. K., Corey, D. R. Silencing disease genes in the laboratory and the clinic. Journal of Pathology. 226, (2), 365-379 (2012).
  24. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  25. Wu, X., et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nature Biotechnology. 32, (7), 670-676 (2014).
  26. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  27. Liu, X., Harada, S. RNA isolation from mammalian samples. Current Protocols in Molecular Biology. Chapter 4 Unit 4.16 (2013).
  28. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  29. Schneider, C. A., Rasband, W. S., Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 9, (7), 671-675 (2012).
  30. Severin, J., et al. Interactive visualization and analysis of large-scale sequencing datasets using ZENBU. Nature Biotechnology. 32, (3), 217-219 (2014).
  31. Yao, Y., et al. RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat. Nucleic Acids Research. 43, (9), e58 (2015).
  32. Savić, N., Schwank, G. Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research. 168, 15-21 (2016).
  33. Long, H., et al. RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy. Biotechnology Letters. (2016).
Celle baseret Assays af SINEUP ikke-kodende RNA'er, der specifikt kan forbedre mRNA Oversættelse
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).More

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter