Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Les dosages de SINEUP Non-coding RNAs qui peuvent améliorer spécifiquement la traduction de l’ARNm de base de cellules

doi: 10.3791/58627 Published: February 1, 2019
* These authors contributed equally

Summary

SINEUPs sont synthétique antisens non-codage RNAs, qui contiennent un domaine de liaison (BD) et un domaine effecteur (ED) et de la régulation traduction de ciblent des ARNm. Nous décrivons ici les méthodes de détection pour SINEUPs dans les lignées de cellules cultivées, analyse de leur activité de promotion de la traduction par Western blot et un débit élevé semi automatisé système d’imagerie.

Abstract

Amélioration de la protéine ciblée est d’une importance non seulement pour l’étude des processus biologiques, mais aussi pour des applications thérapeutiques et biotechnologiques. Nous présentons ici une méthode pour sélectivement la régulation expression de la protéine désirée gènes dans des cellules cultivées au moyen synthétique antisens non-codage RNAs connus comme SINEUPs. Ce contrôle positif de l’expression génique est au niveau post-transcriptionnel et exercée par un inversé court intercalé nucléaire élément (SINE) répéter à la fin de 3ʹ de SINEUPs qui comprend son domaine effecteur (ED). SINEUPs pouvez lier spécifiquement à un ARNm codant pour des protéines de choix par le biais de son domaine de liaison (BD), une région vise à compléter la séquence au sein de la région non traduite de 5ʹ (5ʹ UTR) et autour du codon de début de l’ARNm. Spécifique à la cible SINEUPs conçus de cette manière sont transfectées aux cellules cultivées, et ARN et les protéines sont extraites pour analyses en aval, généralement la transfection après 24-48 h. Protéine induite par le SINEUP vers le haut-règlement est détecté par Western-Blot et expression de RNA est mesurée à l’aide de la transcription inverse quantitative PCR en temps réel. Nous avons dit que conception de BD est essentielle pour parvenir à une activité SINEUP optimale et que tester différentes tailles de BD et des positions en ce qui concerne le codon de début de la cible qu'adn messagère est recommandé. Par conséquent, nous décrivons ici une méthode d’imagerie semi-automatisée de haut débit basée sur la détection par fluorescence qui peut être implémentée pour cibles Qu'arnm fusionné avec la protéine fluorescente verte (GFP). SINEUPs renforcer spécifiquement traduction au sein de la gamme physiologique normale de la cellule, sans altérer le niveau cible de la transcription. Cette méthode a été utilisée avec succès contre un éventail de cibles endogènes et exogènes, dans une grande variété de l’homme, la souris et des lignées de cellules insectes ainsi que des systèmes in vivo. En outre, SINEUPs ont été signalés à augmenter la production d’anticorps et de travailler comme un ARN thérapeutique contre gènes haploïdes. Le caractère polyvalent et modulaire de SINEUPs rend un outil approprié pour contrôle traductionnel de gène-spécifique.

Introduction

Dans l’ère post-génomique, plusieurs idées ont été acquis dans les rôles régulateurs de gène de transcriptions non codantes dues à l’évolution des technologies de séquençage de génération1,2,3 et outils d’édition de gène. Cette catégorie de transcriptions, qui était auparavant considérée comme « transcriptional trash », est maintenant établie comme un acteur clé de la régulation génétique. Nous rapportons les transcriptions pour moduler la chromatine et contrôle de stabilité et l’expression de leurs analogues codant pour des protéines sens ARNm4,5. Dans la plupart des cas, ce mode de régulation est négatif et transcriptions silence leurs homologues de sens à ARN-ARN interactions6,7. Ce trait de transcriptions naturels a été utilisé aux gènes régulent désiré sous forme de synthèse petits ARN interférents (siARN), microARN (miARN) et oligonucléotides antisens (ASO)8,9,10 ,11 , laissant un vide technique pour ciblé up-régulation des gènes.

Une étude intéressante a changé la perspective du champ RNA antisens en démontrant qu’antisens longtemps non-coding RNAs (comme lncRNAs) des gènes Uchl1 (ubiquitine C-terminal hydrolase L1) et Uxt (transcription de façon ubiquitaire exprimés) réguler positivement les traduction de leur apparenté sens ARNm au niveau post-transcriptionnel souris12. La fin de la 5ʹ de ces lncRNAs chevauche plusieurs bases dans la région non traduite de 5ʹ (5ʹ UTR) de leurs transcriptions correspondantes de sens, et la fin 3ʹ de non-cumul contient une répétition inversée d’un rétrotransposon appartenance à court entrecoupées nucléaire famille de l’élément (SINE). Fait intéressant, nous avons constaté que la principale force motrice derrière cette régulation traductionnelle est le sinus embarqué répéter et il n’est pas limitée aux souris que sine répète seulement. Humaine Alu répétition contenant comme lncRNAs a également renforcé la traduction des ARNm de cible de sens, renforçant l’idée d’une nouvelle classe d’antisens réglementation axée sur les sinus non-coding RNAs, bien nommé SINEUPs13. Des études récentes ont montré que le potentiel de SINEUPs naturelles est préservé dans SINEUPs synthétiques conçus pour cibler spécifiquement divers gènes endogènes et exogènes14,15. SINEUPs ont deux caractéristiques importantes : première du « domaine de liaison » (BD) qui est généralement la région de fin de 5ʹ complémentaire de la séquence qui englobe le primaire start codon d’un ARNm codant pour des protéines et deuxièmement « domaine effecteur » (ED) qu’il intègre une inversé la répétition du sinus qui est une condition sine qua non pour SINEUP fonction14 (Figure 1). SINEUPs peuvent être personnalisés pour la conception d’une BD en ciblant un gène de choix. Ceci peut ensuite être exploitée pour disséquer la fonction d’un gène particulier impliqué dans une voie biologique, comme une meilleure alternative à une stratégie conventionnelle de surexpression des ARNm. En outre, cet outil polyvalent peut être appliqué pour stimuler la production d’anticorps et comme un médicament pour traiter la semi-dominantes maladies causées par des doses insuffisantes de protéines fonctionnelles16,17,18, 19,20,21.

Les avantages de la technologie SINEUP sont multiples. Il ne modifie pas l’expression de la cible au niveau transcriptionnel. BDs plus fournissent plus de spécificité à SINEUPs, en n’induisant ne pas une contrainte dépendante de dsRNA réponse15. L’induction de la protéine est maintenue dans les limites physiologiques normaux de la cellule, prévenir tout effet néfaste en raison de l’expression de la protéine anormale ou excessive. SINEUPs sont compatibles avec une grande variété de souris, humaine, et hamster cultivées des lignées de cellules, par exemple, HEK293T/17, HepG2, HeLa, CHO, MN9D et beaucoup plus12,13,14,15,18 ,,19. SINEUPs peut cibler efficacement les gènes endogènes, les gènes transitoirement surexprimées et gènes luciférase-fusion ou l’indicateur-étiquetées, éliminant le besoin de gène-spécifique anticorps14,18. L’analyse de SINEUP base nécessite culture cellulaire systématique, transfection, sodium dodecyl sulfate polyacrylamide gel électrophorèse (SDS-PAGE), instruments de réaction en chaîne (qRT-PCR) en temps réel quantitative transcription inverse-amplification et paramètres, et compétences peuvent être obtenues en peu de temps.

Nous décrivons ici une méthode pour le ciblage de gènes synthétiques SINEUPs pour la traduction, un effet contraire à d’autres technologies telles que RNA interference9 et ASO gapmers11,22,23la régulation. Une méthode couramment utilisée pour l’activation du gène RNA guidée est en cluster régulièrement dois‑je courte palindromique axée sur les répétitions activation (CRISPRa), où l’expression des gènes est déclenchée au niveau transcriptionnel24. Cette méthode, bien que simple et rapide, nécessite plusieurs guide unique RNAs (sgRNAs) ciblant le gène même pour un rendement plus élevé, ce qui augmente les chances de liaison hors-cible25. En outre, l’enzyme clé du système CRISPRa, la protéine catalytiquement morts associés à CRISPR 9 (dCas9) a spécificité de liaison faible et ciblant les sgRNAs régions promotrices bidirectionnelle peuvent non spécifique de la régulation est proche de gènes25. À l’inverse, SINEUPs lier à cibler les ARNm à une région de liaison unique avec une grande spécificité et n’affectent pas l’expression des gènes voisins. Nous discutons les étapes de base impliqués dans la conception SINEUP, transfection, protéines et analyses d’expression RNA. Par ailleurs, nous présentons un système d’imagerie semi-automatisé, haut débit pour plusieurs SINEUPs d’écran à la fois, ce qui est utile pour la détection des SINEUPs optimales.

Protocol

1. conception des BDs de SINEUP construit pour l’ARNm cible

  1. Vérifier la transcription départ (TSS) et traduction départ site de cibles ARNm dans les cellules d’intérêt. Acquérir les données de TSS de l’encoder et FANTOM projets (analyse de la calotte de l’expression génique, CAGE) (ZENBU : http://fantom.gsc.riken.jp/zenbu/).
  2. Ouvrez le navigateur, recherche de gènes d’intérêt et vérifiez TSS en CAGE pics.
  3. Consulter l’analyse de l’exemple des cellules et tissus TSS de Parkinson maladie protéine spécifique 7 (PARK7) mRNA illustré à la Figure 2.
  4. Conception des séquences BD de plusieurs longueurs différentes correspondant à 40 bases bases en amont et 32 en aval de la première méthionine (AUG), 72 nt au total.
  5. Custom commander le BDs conçu en vecteur d’expression SINEUP (voir la Table des matières).
    Remarque : Outil de recherche de base alignement local (BLAST) pour éviter les effets hors cible26pour vérifier la spécificité de séquence.

2. Culture et SINEUP la Transfection des cellules

  1. Cellules de semence d’intérêt dans un puits 6-plaque ou plaque 24 puits pendant 24 h avant la transfection de SINEUPs. Dans le cas de la lignée de cellules embryonnaires de rein humain (HEK293T/17) (voir la Table des matières), graine de 0,5 x 106 cellules / puits d’une 6 cellules de puits-plaque ou 1,5 x 105 / puits d’une poly-D-lysine couché 24 puits-plaque (voir Table des matières). Il devient confluent de 70 % après 24 h.
  2. Après 24h, changer le milieu à 1,5 mL de milieu frais pour une 6 plaque puits ou 0,4 mL de milieu frais pour une plaque 24 puits. En cas de SINEUP-GFP, transfecter 0,6 µg de pEGFP-C2 (voir Table des matières) et 3,4 µg de SINEUP-GFP dans un puits d’une 6 puits-plaque ou 130 ng de pEGFP-C2 et 670 ng de SINEUP-GFP dans un puits d’une plaque 24 puits avec le réactif de transfection (10 µL à 6 µ puits-plaque et 3 L en plaques 24 puits) en suivant les instructions du fabricant (voir Table des matières) et incuber à 37 ° C dans une étuve à 5 % de CO2 pendant 24 h.
  3. Laver les cellules avec 2 mL de solution saline tampon phosphate (PBS) (37 mM NaCl, 8 mM Na2HPO4, 2,6 mM 1,5 mM et KCl KH2PO4) dans chaque puits d’une plaque 6 puits ou 0,5 mL de PBS dans chaque puits d’une plaque 24 puits. Uniquement pour les bon 24 revêtu de poly-D-lysine-plat, ajouter 25 µL de 0,05 % en poids par volume trypsine, incuber dans une étuve à2 CO 5 % pendant 5 min et ajouter 275 µL de milieu cellulaire / puits. Dans le cas de 6 puits-plaque, ajouter 2 mL de PBS dans chaque puits. Pipette de haut en bas pour récolter les 3/4 des cellules (1,5 mL pour une plaque 6 puits) ou 225 µL pour une plaque 24 puits de 1 bien pour l’extraction de la protéine (passer au protocole n° 3 pour l’extraction de la protéine) et 1/4 des cellules (0,5 mL pour une plaque 6 puits) ou 75 µL pour une plaque 24 puits pour Extraction de l’ARN et centrifuger à 6 000 x g pendant 5 min à 4 ° C (passez à l’étape 5 pour extraction de l’ARN).
    Remarque : Analyser l’effet de SINEUP-GFP en un poly-D-lysine 24 puits-plaque par imagerie. Passez à l’étape 7 (analyse d’imagerie).

3. Extraction de protéine

  1. Soigneusement aspirer 1,5 mL de PBS et ajouter 140 µL de solution de lyse (20 mM Tris-HCl (pH 7,5), 150 mM NaCl, 1 mM Na2EDTA 1 mM EGTA, 1 % (p/v) Triton, pyrophosphate de sodium 2,5 mM, β-glycérophosphate de 1 mM, 1 mM Na3VO4 1 μg/mL leupeptine et le fluorure de phénylméthylsulfonyle (PMSF) de 0,005 % (p/v)) (voir la Table des matières) pour un 6 µL puits-plaque ou 60 pour une plaque 24 puits pour les pellets de la cellule.
  2. Mélanger en pipettant également et puis bien mélanger en tournant au ralenti pendant 1 h à 4 ° C. Recueillir le liquide surnageant par centrifugation à 14 000 x g pendant 10 min à 4 ° C.
  3. Vérifier la concentration de protéines par dosage colorimétrique (voir Table des matières). Préparer toutes les réactions à la température ambiante.
    1. Préparer la dilution de 5 à 6 fois de protéine d’albumine sérique bovine (BSA) standard dans l’eau ultrapure avec des concentrations allant de 0,2 à 1,5 mg/protéine mL. Élaborer des normes frais chaque fois.
    2. Préparer le réactif de travail Aʹ de mélanger 1 mL de réactif (solution alcaline de tartrate cuivre) avec 20 µL de réactif S (solution d’agent tensio-actif).
    3. Charger 5 µL d’eau (témoin négatif), norme de BSA (contrôle de standard et positive des protéines) ou échantillon de protéine dans chaque puits d’une plaque à 96 puits.
    4. Ajouter 25 µL de réactif de Aʹ dans chaque puits. Ajouter 200 µL de réactif B (réactif de Folin) avec précaution par bien en évitant toute formation de bulles. Couvrir la plaque avec du papier aluminium et attendre 5-10 min.
    5. Mesurer l’absorption de protéines à 750 nm avec un spectrophotomètre. L’absorbance est stable pendant au moins 1 h.
    6. Préparer la courbe standard de traçage les concentrations de protéine standard de BSA (mg/mL) sur l’axe des abscisses et leurs absorbances respectives sur l’axe y. Calculer la concentration de protéines échantillon en appliquant l’équation de la courbe d’étalonnage.
      Remarque : Interrompre le protocole à cette étape si nécessaire ou passez à l’étape 4. Pour le stockage à long terme, clin d’oeil congeler les échantillons de protéines dans l’azote liquide et conserver à-80 ° C.

4. les protéines séparation par SDS-PAGE et détection de protéines cibles avec des anticorps (analyse Western blot)

  1. Ajouter un volume de 2 x chargement colorant (0,1 M Tris-HCl (pH 6,8), 4 % SDS, 20 % de glycérol, 2-mercaptethanol de 1,42 % et 0,2 % de bleu de bromophénol) à chaque volume de l’échantillon de protéine à l’étape 3.3. Faire chauffer à 90 ° C pendant 5 minutes et refroidir immédiatement sur la glace pendant 1 min.
  2. Charger de 10 à 20 µg d’échantillons de protéines à 10 % gel de poly-acrylamide SDS et séparer à 100-150 V) (voir la Table des matières).
  3. Protéine de transfert du gel à la membrane de nitrocellulose de 0,45 µm (voir Table des matières) de l’instrument de transfert semi-sec avec tampon de transfert (25 mM Tris, glycine 192 mM et 20 % de méthanol) à 25 V pendant 30 min.
  4. Ajouter la solution de saturation (5 % non-lait écrémé à 1 x TBST tampon (137 mM NaCl, 20 mM Tris-HCl (pH 7,6), 0,1 % Tween-20)) (voir la Table des matières) dans le conteneur jusqu'à ce que la membrane est complètement trempé et il incuber à température ambiante pendant 30 min.
  5. Dans le cas de SINEUP-GFP, hybrider la protéine avec anticorps anti-GFP (dilué 1 : 2000 en bloquant la solution) (voir la Table des matières) en incubant la membrane pendant 30 min avec agitation à température ambiante. Comme une protéine de contrôle interne, détecter la protéine β-actine en hybridant avec les anticorps Anti-β-actine (dilué 1 : 2000 en bloquant la solution) (voir la Table des matières) pendant 30 min avec agitation à température ambiante.
  6. Ajouter 1 x TBST tampon au conteneur jusqu'à ce que la membrane soit complètement imbibé et lavage pour 5 min à température ambiante. Répétez l’étape de lavage deux plusieurs fois (un total de trois lavages).
  7. Hybrider protéine GFP à dilué (1/1000 en bloquant la solution) anti-lapin anticorps conjugués à la peroxydase de raifort (HRP) et s’hybrident protéine β-actine dilué (1/1000 en bloquant la solution) d’anticorps anti-souris conjugués à la HRP sur la membrane pendant 30 min avec agitation à température ambiante.
  8. Laver la membrane avec 1 tampon de x TBST pendant 5 min à température ambiante. Répétez l’étape de lavage deux plusieurs fois (un total de trois lavages).
  9. Mélanger un volume égal de réactif de détection par chimiluminescence améliorée HRP (ECL) 1 et 2 (voir la Table des matières). Transférer la membrane au mélange réactif 2 mL ECL, recouvrir la boîte avec du papier aluminium et laisser incuber pendant 1 à 2 min à température ambiante. Retirez délicatement la membrane de mélange réactif ECL et exposer à l’aide d’une luminescence instrument d’imagerie.

5. RNA Extraction et traitement de DNase

  1. Suit de RNA total extrait de la norme du protocole pour l’extraction de l’ARN des cellules cultivées en une monocouche27 ou vous pouvez également utiliser une extraction de l’ARN disponible dans le commerce nécessaire (voir la Table des matières). Pour énoncer brièvement, ajouter tout réactif de lyse monophasique (MLR) d’isothiocyanate de guanidine et phénol aux cellules récoltées en étape 2,3 (1 mL MLR par 5 millions de cellules)27.
    Remarque : Changer fréquemment. Utiliser des réactifs RNase-libre et le diéthylpyrocarbonate (DEPC)-traité en plastique vaisselle et verrerie pour prévenir la dégradation de l’ARN. Mettre en pause le protocole à cette étape si nécessaire. Magasin extrait RNA à-80 ° C.
  2. Ajouter 0,1 volume de mémoire tampon DNase 10 x et 2 U de DNase à l’ARN purifié de l’étape 5.1 (voir Table des matières).
  3. Définir le volume réactionnel de 50 µL d’eau exempte de nucléase et mélanger doucement. Incuber à 37 ° C pendant 30 min.
  4. Ajouter 0,1 volume de remises en suspension réactif d’inactivation de DNase et bien mélanger (voir Table des matières). Incuber 5 min à température ambiante avec agitant doucement.
  5. Centrifuger à 10 000 x g pendant 90 s. transfert surnageant (sans ADN ARN) dans un nouveau tube de 1,5 mL RNase-libre. Veillez à ne pas toucher le culot car cela peut provoquer le report de DNase qui est gênant pour les étapes en aval.
  6. Quantifier la RNA en mesurant un260 et un ratio de280 260/a (pour l’ARN pure, la gamme est 1.8-2.0) dans un spectrophotomètre UV.

6. premier cDNA de brin synthèse et analyse qRT-PCR

  1. Effectuer la première synthèse de cDNA de brin selon un protocole de synthèse de cDNA standard comme ci-dessous (voir Table des matières).
    1. Mélanger 0,75 µM oligo dT amorce, 4,3 amorces aléatoires µM, dNTPs (10 mM) avec 200-500 ng ARN total (étapes 5-8) à 10 µL de volume de réaction totale. Incuber à 65 ° C pendant 5 min et ensuite mettre immédiatement sur la glace.
    2. Mélanger 1 tampon de transcriptase inverse de x, 1 U de RNase inhibiteur, 10 U de la transcriptase inverse et ajoutez à 10 µL mix amorce d’ARN de 6.1.1.
    3. Réglez le volume de réaction totale à 20 µL d’eau exempte de nucléase si nécessaire. Mélanger doucement et laisser incuber le mélange réactionnel à 30 ° C pendant 10 min, puis à 42 ° C pendant 60 min et enfin à 95 ° C pendant 5 min inactiver les enzymes. Refroidir les tubes sur la glace.
      Remarque : Décongeler les échantillons d’ARN et de tous les réactifs sur la glace et préparer le mélange de réaction sur la glace. Si l’ARN cible est seulement polyA RNAs, utilisez oligo dT l’apprêt seulement (2,5 µM). Mettre en pause le protocole si nécessaire. Stocker le cDNA synthétisé à-20 ° C.
  2. Effectuer qRT-PCR en techniques réanalysés (n = 3, Cт écart > 0,2) et dans les réplicats biologiques (n ≥ 3) à l’aide de 1 µL de 10 ng cDNA, 0,4 µL d’apprêt inverse (10 µM), 0,4 µL d’apprêt avant (10 µM), 10 µL de solution de mélange de l’ADN polymérase , 0,4 µL d’ADN double brin, coloration teinture, 10 µL d’eau exempte de nucléase (volume de réaction a été de 20 µL) de détecter des produits PCR à l’aide de la suite des conditions ; tenir la scène (1 cycle) pendant 30 s à 95 ° C, cyclisme étape (40 cycles) pour 5 s à 95 ° C, pendant 30 s à 60 ° C, faire fondre le stade de la courbe. Sont des exemples de l’apprêt pour Gapdh_Fw humaine : TCTCTGCTCCTCCTGTTC, Gapdh_Rv humain : GCCCAATACGACCAAATCC, EGFP_Fw : GCCCGACAACCACTACCTGAG, EGFP_Rv : CGGCGGTCACGAACTCCAG, SINEUP-GFP_Fw : CTGGTGTGTATTATCTCTTATG et SINEUP-GFP_Rv : CTCCCGAGTCTCTGTAGC. Voir Table des matières. Analyser l’expression quantitative RNA avec 2∆∆Ct- ± SD méthode28.

7. analyse des SINEUPs par la méthode de détection semi-automatique d’imagerie

  1. Laver les cellules avec 0,5 mL de PBS pour un puits d’une plaque 24 puits.
  2. Ajouter 2.0 μg de Hoechst 33342 (voir Table des matières) (dissoudre dans 500 μl de PBS) à chaque puits de la plaque de 24 puits et incuber à 37 ° C pendant 20 min colorer le noyau des cellules.
  3. Hoechst mesure teinté de cellules pour compter le nombre total de cellules à un maximum d’émission bleue de 461 nm et l’intensité de fluorescence verte pour compter le nombre de cellules positives GFP au maximum d’émission vert à 510 nm en utilisant une image de micro-bien haut débit cytomètre ( voir Table des matières). Analyser l’effet d’up-régulation protéique des SINEUPs en calculant l’intensité GFP intégré, qui est la somme de toutes les intensités de pixels affichage signal dans des objets segmentés calculées pour chaque canal, à l’aide de logiciels d’imagerie29.
  4. Récolter les cellules afin de vérifier l’expression RNA (retour aux étapes 5 et 6).

Representative Results

SINEUP-GFP est un SINEUP synthétique contenant les deux une BD optimale (-28 / + 4 se chevauchent à GFP ARNm) et un ED (inversé SINE B2 de AS -Uchl1) qui peut la régulation traduction de l’ARNm de la GFP (figures 3 a et 3 b) sans modifier l’expression de la GFP ARNm (Figure 3 et 3D). Pour écran optimale BDs et EDs pour SINEUPs, nous avons développé un protocole d’analyse d’images semi-automatisé qui améliore le temps de détection et a augmenté le nombre d’échantillons étant projeté simultanément par rapport à un classique Western blot analyse15. Comme illustré à la Figure 4, ce système d’imagerie de haut-débit a pris 3 jours (analyse Western blot a pris 2 semaines pour 48 SINEUPs). Avoir démontré que SINEUP-GFP augmente la translation de la GFP, nous avons détecté GFP intégré intensité par le cytomètre en image. La BD optimale des SINEUP-GFP a induit une augmentation de 1.4-fold dans l’expression de la protéine GFP. Bien que nous avons observé la compression des signaux de 2,6 (analyse Western blot, voir Figure 3 a) à 1.4-fold (Imaging analyse, voir la Figure 5), la différence pourrait être due à l’étalonnage du logiciel instrument d’imagerie. Néanmoins, nous avons détecté des niveaux significativement plus élevés de la fluorescence GFP comparée au témoin (Figure 5 a et 5 b).

Figure 1
Figure 1 : conception de base des synthèse SINEUPs. BD = domaine de liaison pour cibler des ARNm, ED = domaine effecteur contenant une séquence de sinus inversée. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Transcription à partir de sites (TSSs) de protéine humaine de la maladie Parkinson 7 (PARK7) ARNm dans les cellules tel que détecté par l’analyse de la CAGE et des tissus spécifiques. (A) A snapshot montrant les résultats d’une recherche de TSS pour l’ADN messagère PARK7 humaine à l’aide d’une intégration de données omique et visualisation interactive système30. La flèche verte horizontale dans la piste de hg19 gène Entrez indique la position de génomique de la référence humaine PARK7 ARNm et les barres verticales vertes dans le FANTOM5 CAGE 1 et 2 pistes indiquent la somme de TSSs (mesurée en transcriptions par million (tpm)) de 1 829 types de tissus et de cellules. Zoom (B) dans la région marquée du TSS en groupe A (échelle 1/354 : 35,4 Ko à 100 bp). Gris ombragé dans la phase de FANTOM5 CAGE pistes 1 et 2 indiquent la TSS de 6 cellules spécifiques hors le total 1 829, qui figurent au bas de la figure. Les nombres (11.369, 4.998, 4.304, 3.509, 3.477 et 3.055) correspondant à ces cellules énumérées indiquent des transcriptions par million de chaque cellule spécifique à la grey shaded postes du TSS. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : analyse de Western blot confirmant une régulation de la traduction de SINEUP-GFP. (A) SINEUP-GFP a été étudiée par Western-blot avec anticorps anti-GFP. (B) résultats ont été normalisées à l’intensité de la bande de protéine β-actine. (C) GFP ARNm et expression de l’ARN SINEUP (D) ont été détectés par qRT-PCR. p < 0,0005, n = 3, test t de student bilatéral, barres d’erreur sont écart-type. Ce chiffre a été modifié par Takahashi Al.15. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : schéma SINEUP semi-automatique d’analyse d’image. Jour 1 : Graine de cellules d’intérêt dans une plaque 24 puits. Jour 2 : Transfecter GFP et SINEUP-GFP. Jour 3 : Analyser l’effet de SINEUPs en mesurant l’intensité de la GFP intégré. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : analyse de haut-débit de translation vers le haut-règlement par SINEUP-GFP. (A) comparaison de fluorescence GFP entre contrôle et SINEUP-GFP transfecté des cellules15. Echelle = 2 mm. (B), GFP intensité intégrée a été normalisée au nombre total de cellules comptée par coloration des noyaux avec Hoechst 33342. p < 0,0005, n = 3, test t de student bilatéral, barres d’erreur sont écart-type. Champ de vision : champ de vision. Ce chiffre a été modifié par Takahashi Al.15. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Discussion

Nous décrivons un protocole afin d’améliorer plus particulièrement la production de protéines d’une cible à l’ARNm au moyen d’un sinus contenant ARN non codants appelé SINEUPs. Comme un exemple représentatif, optimale synthétique SINEUP-GFP est montré à la traduction de l’ARNm de la GFP 2,6 telle que mesurée par Western-Blot la régulation.

Conception d’une BD optimale est essentielle d’assurer la spécificité de la SINEUP et la puissance (mesure des protéines vers le haut-règlement). Auparavant, nous projeté BDs 17 de SINEUP-GFP par Western blot analyse15 et trouvé que la BD optimale superpose à la séquence de KOZAK-AUG de l’ARNm de la GFP, bien qu’il est peut-être pas le cas avec les autres ARNm et doit être vérifiée pour chaque cas. Un autre groupe indépendant a également projeté la BD en utilisant une méthode différente de la31. Comme beaucoup de BDs de dépistage peut être assez long et fastidieux, nous avons introduit une méthode de détection haut débit SINEUP ici. Cette méthode mesure les changements relatifs en densité GFP intégré dans SINEUP transfectées-cellules par rapport aux commande vector transfectées-cellules. Pour s’assurer que dans un endroit bien particulier d’une plaque de culture, les cellules sont transfectées également et signal GFP n’est pas concentrée dans seulement une certaine région du puits, il est très important de distribuer les cellules également dans les puits à l’étape 2.1. À cette fin, agiter la plaque 10 fois en arrière (↑↓) après l’ensemencement les cellules à l’intérieur d’un banc propre doucement et répéter dans l’étuve à2 CO 5 % avant le début de l’incubation.

Une autre étape critique est le calcul de la concentration de la protéine à l’étape 3.3. Erreurs de calcul ici peuvent entraîner le chargement d’un montant erroné de protéine pendant l’analyse Western blot, donc empêchant la détection de petits changements dans l’expression de la protéine par certains des SINEUPs faibles ou générer des faux positifs de surcharger. Il est recommandé de préparer fraîchement à la courbe standard de protéines chaque fois, en s’assurant que des quantités égales de protéines échantillons et étalons sont mesurées à l’étape 3.3.3. Le protocole décrit ici se concentre sur SINEUP-GFP, mais analyse Western blot peut être utilisée pour une cible d’ADN messagère d’intérêt. Le temps d’incubation et la concentration d’anticorps doivent être optimisés pour chaque cible afin d’obtenir le meilleur résultat.

Une des originalités de SINEUPs est que le niveau d’expression cible-ARNm demeure inchangée. Il est important de traiter l’ARN avec DNase pour éviter la détection de SINEUPs transfectées et l’ADN génomique par qRT-PCR. SINEUP RNAs et expression de l’ARNm cible doivent être mesurées par qRT-PCR pour confirmer le succès de transfection et l’activité SINEUP. SINEUPs contient une séquence SINE, qui est abondante dans l’ensemble les deux l’humain et le génome de la souris. Pour éviter la détection non spécifiques des séquences SINE, il n’est pas recommandé de concevoir des amorces qRT-PCR de la séquence SINE.

Dans ce protocole, nous avons utilisé des lignées cellulaires humaines, mais SINEUPs sont efficaces dans un certain nombre de lignées de cellules de plusieurs différentes espèces12,13,14,18,19. Les conditions de culture et de la transfection de cellules peuvent être modifiées selon différentes lignées cellulaires, aussi longtemps que ces maintiennent l’efficacité de la transfection des vecteurs SINEUP. En outre, les méthodes alternatives de RNA extraction, synthèse de cDNA et vérification de la concentration protéique peuvent être employés, étant donné qu’elles préservent la qualité requise d’ARN et de protéine pour qRT-PCR et l’analyse de Western blot. Alors que nous avons utilisé un cytomètre de micro-bien haut débit spécifique, qui permit à détection de fluorescence GFP dans l’ensemble bien, autres cytomètres de flux avec une gamme de détection similaires peuvent être utilisés31. Il est à noter que si la distribution des cellules et de transfection est égale dans un puits, alors il n’est pas nécessaire d’analyser l’ensemble bien pour fluorescence GFP : la moitié ou un quart de la superficie d’un puits pourrait être suffisant pour discerner effet SINEUP selon expérience compétences de l’al.

Établissement d’un protocole de détection de SINEUP de haut-débit permet pour une projection simultanée de plusieurs BDs ciblant une donnée ARNm dans les cellules cultivées. Ceci est important car les règles régissant un ciblage optimal de la BD sont encore peu clairs. Tel un multiplex, système de contrôle permet de tester à grande échelle de nombreux SINEUPs contre différents gènes, utiles pour cibler plusieurs gènes impliqués dans une voie de signalisation particulière par exemple. En outre, il peut être utilisé pour étendre la recherche pour SINEUPs efficaces ciblant plusieurs ARNm, conception différentes BDs SINEUP environs AUG-Kozak (voir Figure 1), co-transfection pleine longueur cible ARNm (5ʹ UTR-CD-3ʹ UTR) fusionnée à la GFP ARNm dans les cellules cultivées pour trouver le SINEUPs optimales et par la suite test BD candidats contre l’ARNm endogène dans les cellules cultivées et des animaux modèles in vivo, chez l’homme et de la souris à d’autres espèces animales et végétales.

Ce protocole de dépistage est très rapide. Il ne faut pas de difficulté et de prélever des cellules, mais suffit de placer la vie culture plaque dans l’instrument d’imagerie cellulaire. Nous vous proposons d’utiliser ce protocole de criblage à haut débit pour sélectionner BDs optimal de SINEUPs et évaluer les candidats potentiels par Western-Blot. Ainsi, les candidats sélectionnés avec BDs optimales peuvent être appliqués afin d’accroître les anticorps production18,19,21. Actuellement, le champ thérapeutique de RNA croît considérablement. Par exemple, siRNA, ASO, ARNm et thérapies CRISPR ARN, sont largement employées pour contrôler l’expression de l’ARNm de leurs cibles respectives9,32. Dans ce contexte, SINEUPs sont à leurs premiers balbutiements, mais jusqu'à présent, aucun d'entre les SINEUPs étudiés changé expression des ARNm cible. En outre, les SINEUPs n’éditez pas cibler des ARNm, mais seulement de la régulation traduction de l’ARNm. En outre, perte de fonction des maladies résultant de SIM1 peuvent être ciblées par une thérapie SINEUP, réalisation d’une facteur 2 induction de la protéine déficiente17,33. Bien que les effets hors cible doivent être étudiées plus loin, SINEUPs spécifiquement et potentiellement cibler un ARNm unique, exprimée avec une séquence complémentaire à la BD.

Une limitation du présent protocole à haut débit, c’est qu’il n’est pas adapté à l’écran BDs de SINEUPs dans les modèles de souris in vivo car l’intensité seulement d’intégrer les mesures de protocole la GFP. Comme SINEUPs naturel lncRNAs antisens qui agissent post-traductionnelle, ils ne s’appliquent lorsque la cible ADN messagère est manquant dans les cellules ou les échantillons de tissus.

Néanmoins, SINEUPs peuvent être appliquées à des études de gain de fonction, pour améliorer la production d’anticorps et comme thérapie d’expression des protéines déficientes au sein de l’ordre de 1,5 à 3,0 fois la régulation RNA. Les méthodes décrites ici présentent un guide utile pour cibler et détecter l’amélioration induite par le SINEUP traduction des ARNm désiré et offrir un nouvel outil pour la régulation des gènes post-transcriptionnels.

Disclosures

L’auteur-correspondant Piero Carninci est l’un des fondateurs de TransSINE Technologies Co. Ltd., qui détient la propriété intellectuelle sur des brevets déposés (EP2691522A4 et JP2017169573A) et brevet délivré (US9353370B2) pour la technologie SINEUP.

Acknowledgments

Cette étude a été partiellement soutenue par le programme de technologie de plate-forme et sciences fondamentales pour les médicaments biologiques innovants, n° 17 am 0301014, de l’Agence japonaise pour la recherche médicale et le développement (AMED), subvention de recherche du MEXT à RIKEN Center for Life Sciences Technologies et une subvention de recherche du MEXT à l’IMS de RIKEN. Nous remercions les membres du laboratoire du PC et du réseau SINEUP (SISSA, Université du Piémont oriental et RIKEN) pour des discussions qui suscitent la réflexion. Nous remercions le Dr Matthew Valentine pour la relecture.

Materials

Name Company Catalog Number Comments
Synthetic SINEUP Cell Guidance Systems Ltd. in UK and K.K.DNAFORM in Japan https://www.cellgs.com/items/sineupand8482.html and https://www.dnaform.jp/en/information/20130320 Step 1.5
HEK293T/17 ATCC ATCC CRL-11268 Step 2.1
Falcon Multiwell Plate For Cell Culture 6 well plate Corning 6902A01 Step 2.1
Corning BioCoat Poly-D-Lysine 24 well Plate Corning 08-774-124 Step 2.1
Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific 11668027 Step 2.2
pEGFP-C2 Clontech #6083-1 Step 2.2
Cell Lysis Buffer (10x) Cell Signaling Technology #9803S Step 3.1 This is pre-mixed cell lysis solution.
PMSF Cell Signaling Technology #8553S Step 3.1 To complete cell lysis buffer, add 0.005% (w/v) PMSF to 1x cell lysis buffer.
DC protein assay kit II BIO RAD #5000112JA Step 3.3
10% Mini-PROTEAN TGX Precast Protein Gels, 12-well, 20 µL BIO RAD #4561035 Step 4.2
Amersham Protran Premium NC 0.45 (150 mm×4 m) Amasham 10600013 Step 4.3, This is a 0.45 µm nitrocellulose membrane.
Nonfat Dry Milk Cell Signaling Technology #9999S Step 4.4 A component of the blocking solution.
GFP Tag Antibody Thermo Fisher Scientific A-6455 Step 4.5 Lot number: 1495850, RRID: AB_221570
Monoclonal Anti-β-Actin antibody produced in mouse SIGMA A5441 Step 4.5 Lot number: 026M4780V, RRID: AB_476744
Polyclonal Goat Anti Rabbit Immunoglobulins Dako P0448 Step 4.5 This is secondary antibody conjugating with HRP for anti GFP antibody. Lot number: 20017525, RRID:AB_2617138
Polyclonal Goat Anti mouse Immunoglobulins Dako P0447 Step 4.5 This is secondary antibody conjugating with HRP for anti β-Actin antibody. Lot number: 20019698, RRID:AB_2617137
ECL Western Blotting Detection Reagents Amersham RPN2109 Step 4.9
Maxwell Rapid Sample Concentrator (RSC) Instrument Promega AS4500 Step 5.1 This is commercially available RNA exreaction instrument.
Maxwell RSC simplyRNA Cells Kit Promega AS1390 Step 5.1 This is commercially available RNA exreaction kit.
TURBO DNA-free Kit ambion AM1907 Step 5.2 and 5.4 The kit contains DNase, DNase buffer and inactivation reagent.
PrimeScrip 1st strand cDNA Synthesis Kit TaKaRa 6110A Step 6.1 The kit contains reagents of first strand cDNA synthesis.
TB Green Premix Ex Taq II TaKaRa RR820A Step 6.2
Hoechst3342 Thermo Fisher Scientific H3570 Step 7.2
Celigo S Nexcelom Bioscience 200-BFFL-S Step 7.3 This is a high throughput micro-well image cytometer.

DOWNLOAD MATERIALS LIST

References

  1. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, (5740), 1564-1566 (2005).
  2. Carninci, P., et al. The transcriptional landscape of the mammalian genome. Science. 309, (5740), 1559-1563 (2005).
  3. Hon, C. C., et al. An atlas of human long non-coding RNAs with accurate 5' ends. Nature. 543, (7644), 199-204 (2017).
  4. Tufarelli, C., et al. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nature Genetics. 34, (2), 157-165 (2003).
  5. Yu, W., et al. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature. 451, (7175), 202-206 (2008).
  6. Carninci, P., Hayashizaki, Y. Noncoding RNA transcription beyond annotated genes. Current Opinion in Genetics & Development. 17, (2), 139-144 (2007).
  7. Chu, Y., Yue, X., Younger, S. T., Janowski, B. A., Corey, D. R. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 38, (21), 7736-7748 (2010).
  8. Ha, M., Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology. 15, (8), 509-524 (2014).
  9. Takahashi, H., Carninci, P. Widespread genome transcription: new possibilities for RNA therapies. Biochemical and Biophysical Research Communications. 452, (2), 294-301 (2014).
  10. Lam, J. K. W., Chow, M. Y. T., Zhang, Y., Leung, S. W. S. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy-Nucleic Acids. 4, e252 (2015).
  11. Nishina, K., et al. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nature communications. 6, 7969 (2015).
  12. Carrieri, C., et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 491, (7424), 454-457 (2012).
  13. Schein, A., Zucchelli, S., Kauppinen, S., Gustincich, S., Carninci, P. Identification of antisense long noncoding RNAs that function as SINEUPs in human cells. Scientific Reports. 6, 33605 (2016).
  14. Zucchelli, S., et al. SINEUPs are modular antisense long non-coding RNAs that increase synthesis of target proteins in cells. Frontiers in Cellular Neuroscience. 9, 174 (2015).
  15. Takahashi, H., et al. Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation. PLOS ONE. 13, (2), e0183229 (2018).
  16. Deutschbauer, A. M., et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 169, (4), 1915-1925 (2005).
  17. Indrieri, A., et al. Synthetic long non-coding RNAs [SINEUPs] rescue defective gene expression in vivo. Scientific Reports. 6, 27315 (2016).
  18. Patrucco, L., et al. Engineering mammalian cell factories with SINEUP noncoding RNAs to improve translation of secreted proteins. Gene. (2015).
  19. Sasso, E., et al. A long non-coding SINEUP RNA boosts semi-stable production of fully human monoclonal antibodies in HEK293E cells. MAbs. 1-8 (2018).
  20. Dang, V. T., Kassahn, K. S., Marcos, A. E., Ragan, M. A. Identification of human haploinsufficient genes and their genomic proximity to segmental duplications. European Journal of Human Genetics. 16, (11), 1350-1357 (2008).
  21. Zucchelli, S., Patrucco, L., Persichetti, F., Gustincich, S., Cotella, D. Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs. Computational and Struct Biotechnology Journal. 14, 404-410 (2016).
  22. Hua, Y., et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes & Development. 24, (15), 1634-1644 (2010).
  23. Watts, J. K., Corey, D. R. Silencing disease genes in the laboratory and the clinic. Journal of Pathology. 226, (2), 365-379 (2012).
  24. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  25. Wu, X., et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nature Biotechnology. 32, (7), 670-676 (2014).
  26. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  27. Liu, X., Harada, S. RNA isolation from mammalian samples. Current Protocols in Molecular Biology. Chapter 4 Unit 4.16 (2013).
  28. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  29. Schneider, C. A., Rasband, W. S., Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 9, (7), 671-675 (2012).
  30. Severin, J., et al. Interactive visualization and analysis of large-scale sequencing datasets using ZENBU. Nature Biotechnology. 32, (3), 217-219 (2014).
  31. Yao, Y., et al. RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat. Nucleic Acids Research. 43, (9), e58 (2015).
  32. Savić, N., Schwank, G. Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research. 168, 15-21 (2016).
  33. Long, H., et al. RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy. Biotechnology Letters. (2016).
Les dosages de SINEUP Non-coding RNAs qui peuvent améliorer spécifiquement la traduction de l’ARNm de base de cellules
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).More

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter