Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Zellbasierte Assays der SINEUP nicht-kodierende RNAs, die speziell mRNA Übersetzung verbessern können

doi: 10.3791/58627 Published: February 1, 2019
* These authors contributed equally

Summary

SINEUPs sind synthetische antisense nicht-kodierende RNAs, die enthalten eine Bindung (BD) und ein Effektor-Domäne (ED) und Übersetzung bis zu regulieren Ziel mRNA. Hier beschreiben wir Nachweismethoden für SINEUPs in kultivierten Zelllinien, Analyse ihrer Tätigkeit zur Förderung der Übersetzung von Western-Blot und eine halbautomatische Hochdurchsatz imaging-System.

Abstract

Gezielt-Protein ist nicht nur für die Untersuchung biologischer Prozesse, sondern auch für therapeutische und biotechnologische Anwendungen von Bedeutung. Hier präsentieren wir Ihnen eine Methode, um selektiv Up-Protein-Expression des gewünschten Gene in kultivierten Zellen mittels synthetischer Antisense nicht-kodierende RNAs bekannt als SINEUPs zu regulieren. Diese positive Kontrolle der Genexpression ist auf posttranskriptionale Ebene und durch ein umgekehrtes kurze eingestreuten nuklearen Element (Sinus) Wiederholung am 3ʹ Ende des SINEUPs ausgeübt, die die Effektor-Domäne (ED) umfasst. SINEUPs können speziell an Protein-kodierenden mRNA Wahl durch seine bindende Domäne (BD), eine Region ergänzen die Reihenfolge innerhalb der 5ʹ unübersetzte Region (5ʹ UTR) und um das Start-Codon der mRNA binden. Target-spezifische SINEUPs entwickelt, die auf diese Weise sind in kultivierten Zellen transfiziert und Proteine und RNA für nachgelagerte Analysen, in der Regel 24-48 h nach Transfektion extrahiert werden. SINEUP-induzierte Protein Up-Verordnung von Western-Blot Analyse erkannt und RNA-Ausdruck wird mit Echtzeit-quantitative reverse Transkription PCR gemessen. Wir haben beobachtet, dass BD-Design entscheidend ist für die Erreichung optimaler SINEUP Aktivität und, die Erprobung BD Größen und Positionen in Bezug auf die Start-Codon des Ziels, die mRNA wird empfohlen. Daher beschreiben wir hier eine halbautomatische Hochdurchsatz-bildgebende Methode basiert auf Fluoreszenz-Detektion, die zum Ziel umgesetzt werden kann, die mRNA mit grün fluoreszierenden Proteins (GFP) verschmolzen. SINEUPs verbessern speziell Übersetzung im normalen physiologischen Bereich der Zelle, ohne Veränderung der Zielebene Transkript. Diese Methode wurde bereits erfolgreich gegen eine Reihe von endogenen und exogenen Ziele in eine Vielzahl von Mensch, Maus und Insekten Zelllinien zusammen mit in-vivo-Systemen eingesetzt. Darüber hinaus berichteten SINEUPs Antikörperproduktion zu steigern und arbeiten als eine therapeutische gegen Haploinsufficient Gene RNA. Vielseitig und modular Artder SINEUPs macht sie ein geeignetes Werkzeug für Gen-spezifischen translational Steuerung.

Introduction

In der post-genomische Ära, wurden viele Erkenntnisse in die gen regulatorischen Rollen von nicht-kodierenden antisense Transkripte aufgrund der Entwicklung der Next Generation Sequencing Technologien1,2,3 und gen-editing-Tools. Diese Kategorie der Transkripte, die zuvor als "transkriptionelle Papierkorb" galt, ist heute als wichtiger Akteur der Genregulation etabliert. Antisense Transkripte werden berichtet, um Chromatin und Regelstabilität und Ausdruck ihrer Verwandten Protein-kodierenden Sinn mRNA4,5modulieren. In den meisten Fällen diese Verordnung ist negativ und antisense Transkripte Stille Gegenstücke Sinn durch RNA-RNA Interaktionen6,7. Dieses Merkmal des natürlichen antisense Transkripte ist Downregulate gewünschte Gene in Form von synthetischen kleine interferierende RNA (SiRNA), MicroRNA (MiRNA) und antisense Oligos (ASO)8,9,10 verwendet worden ,11 verlassen eine technologische Lücke für gezielte Up-Genregulation.

Eine faszinierende Studie verändert die Perspektive des Feldes antisense RNA durch den Nachweis, dass Antisense lange nicht-kodierende RNAs (als LncRNAs) der Gene Uchl1 (Ubiquitin C-terminale Hydrolase L1) und Uxt (ubiquitär ausgedrückt Transkript) Übersetzung von ihrem Cognate positiv regulieren mRNA posttranskriptionale Ebene in Mäusen12spüren. 5ʹ Ende dieser durchsetzt wie LncRNAs überschneidet sich mit mehrere Stützpunkte in der 5ʹ unübersetzte Region (5ʹ UTR) ihre entsprechenden Sinn Transkripte und nicht überlappende 3ʹ Ende enthält eine umgekehrte Wiederholung der eine Zugehörigkeit zu den kurzen Retrotransposon nuklearen Elementfamilie (Sinus). Interessanterweise fanden wir, dass die treibende Kraft hinter dieser translationale Up-Verordnung ist der eingebetteten Sinus wiederholen und es beschränkt sich nicht auf Maus Sinus nur Wiederholungen. Menschlichen Alu Wiederholung-haltigen benannt LncRNAs auch Übersetzung des Ziels Sinn mRNAs, verstärkte verstärken die Idee einer neuartigen Klasse von Sinus-driven regulatorischen Antisense nicht-kodierende RNAs, entsprechend SINEUPs13. Jüngste Studien zeigten, dass das Potenzial der natürlichen SINEUPs im synthetischen SINEUPs entwickelt, um speziell Ziel verschiedene endogene und exogene Gene erhaltene14,15. SINEUPs haben zwei wichtige Eigenschaften: erste "bindende Domäne" (BD) ist in der Regel 5ʹ Endbereich komplementär zu der Sequenz umfasst die primäre beginnen Sie Codon für eine Protein-kodierenden mRNA und als zweites die "Effektor-Domäne" (ED) als es enthält eine umgekehrte Wiederholung des Sinus ist eine Voraussetzung für die SINEUP Funktion14 (Abbildung 1). SINEUPs kann angepasst werden, um eine BD ein Gen Wahl gezielt zu entwerfen. Dies kann dann genutzt werden, um die Funktion eines bestimmten Gens beteiligt einen biologischen Weg als bessere Alternative zu einer herkömmlichen mRNA Überexpression Strategie zu sezieren. Darüber hinaus kann das vielseitige Tool angewendet werden, um Antikörper-Produktion zu steigern und als Medikament zur Behandlung von Haploinsufficient Krankheiten, die durch unzureichende Dosierungen Funktionsproteine16,17,18, 19,20,21.

Die Vorteile der SINEUP-Technologie sind vielfältig. Den Ausdruck des Ziels auf transkriptioneller Ebene werden nicht verändert. Längere BDs bieten mehr Spezifität für SINEUPs, während nicht induzieren eine DsRNA-abhängige Stress Antwort15. Die Protein-Induktion bleibt im normalen physiologischen Bereich der Zelle, die keine schädliche Wirkung durch aberrante oder übermäßige Protein-Expression zu verhindern. SINEUPs sind kompatibel mit einer Vielzahl von Maus, Mensch, und Hamster kultivierten Zelllinien, z. B. HEK293T/17, HepG2 HeLa, CHO, MN9D und viele weitere12,13,14,15,18 ,19. SINEUPs können effizient endogene Gene, Transient überexprimieren Gene und Flagge markiert oder Luciferase-Fusion Gene, wodurch die Notwendigkeit von Gen-spezifischen Antikörper14,18ausrichten. Die grundlegende SINEUP Analyse erfordert Routine Zellkultur, Transfektion, Sodium Dodecyl Sulfat-Polyacrylamid-Gelelektrophorese (SDS-PAGE), Real-Time quantitative reverse Transkription-Polymerase-Kettenreaktion (qRT-PCR) Instrumente und Einstellungen, und Kompetenz kann in kurzer Zeit gewonnen werden.

Hier beschreiben wir eine Methode für das targeting Gene mit synthetischen SINEUPs, Übersetzung, eine Wirkung im Gegensatz zu anderen Technologien wie RNA Interferenz9 und ASO Gapmers11,22,23bis zu regulieren. Eine weit verbreitete Methode zur RNA-geführte Genaktivierung ist gruppierten regelmäßig dazwischen kurze palindromische Wiederholungen-basierte Aktivierung (CRISPRa), wo die Genexpression auf transkriptioneller Ebene24ausgelöst wird. Diese Methode, aber einfach und schnell, erfordert mehrere einzelne Führer RNAs (SgRNAs) Ausrichtung auf dasselbe Gen für höhere Effizienz, wodurch die Chancen des Ziel-Bindung25. Darüber hinaus hat das Schlüsselenzym des CRISPRa Systems, die katalytisch tot CRISPR-assoziierten Protein 9 (dCas9) geringe Bindung Spezifität und SgRNAs Ausrichtung, die Bi-direktionale Förderer Regionen unspezifisch Up-in der Nähe Gene25regulieren können. Im Gegensatz dazu SINEUPs binden an mRNA an einer einzigen verbindlichen Region mit hoher Spezifität Zielgruppe und haben keinen Einfluss auf die Expression von Genen in der Nähe. Wir diskutieren die Grundschritte in SINEUP Design, Transfektion, Proteine und RNA Expressionsanalysen beteiligt. Darüber hinaus präsentieren wir eine halbautomatische, Hochdurchsatz-imaging-System mehrere SINEUPs auf einmal auf dem Bildschirm ist nützlich zur Erkennung von optimalen SINEUPs.

Protocol

1. Aufbau des BDs von SINEUP baut für Target mRNAs

  1. Überprüfen Sie Transkription Startseite (TSS) und Übersetzung Startseite des Ziel-mRNAs in den Zellen von Interesse. TSS Daten aus den ENCODE und FANTOM Projekten (GAP-Analyse der Genexpression, Käfig) zu erwerben (ZENBU: http://fantom.gsc.riken.jp/zenbu/).
  2. Öffnen Sie den Browser, suchen Sie Gene von Interesse zu und überprüfen Sie TSS von CAGE Gipfeln zu.
  3. Konsultieren Sie die Beispiel-Analyse der Zell- und spezifische TSS der Parkinson Krankheit Protein 7 (PARK7) mRNA in Abbildung 2dargestellt.
  4. Design BD Sequenzen von verschiedenen Längen verfügbar, 40 entspricht Basen stromaufwärts und 32 Basen stromabwärts von der ersten Methionin (AUG), 72 nt insgesamt.
  5. Individuell gestaltete BDs in SINEUP Expressionsvektor bestellen (siehe Tabelle der Materialien).
    Hinweis: Überprüfen Sie die Sequenz Besonderheit, indem grundlegende lokale Ausrichtung such-Tool (BLAST), Ziel-Effekte26zu vermeiden.

2. Handy-Kultur und SINEUP Transfektion

  1. Samenzellen des Interesses an einer 6-Well-Platte oder 24 Well-Platte für 24 h vor Transfektion von SINEUPs. Im Falle von menschlichen embryonalen Nieren-Zell-Linie (HEK293T/17) (siehe Tabelle der Materialien), 0,5 x 106 Samenzellen pro Bohrloch eine 6 Well-Platte oder 1,5 x 105 Zellen pro Bohrloch eine Poly-D-Lysin beschichteten 24 Well-Platte (siehe Tabelle der Materialien). Nach 24 Stunden wird es 70 % Zusammenfluss.
  2. Nach 24 h ändern Sie das Medium in 1,5 mL frisches Medium für eine 6-Well-Platte oder 0,4 mL frisches Medium für eine 24-Well-Platte. Im Falle eines SINEUP-GFP transfizieren 0,6 µg pEGFP-C2 (siehe Tabelle der Materialien) und 3,4 µg SINEUP-GFP in einen Brunnen von einem 6-Well-Platte oder 130 ng pEGFP-C2 und 670 ng der SINEUP-GLP in einen Brunnen von einem 24 Well-Platte mit Transfection Reagens (10 µL in 6 Well-Platte und 3 µ L in 24-Well-Platte) folgen Sie den Anweisungen des Herstellers (siehe Tabelle der Materialien), und Inkubation bei 37 ° C in einem 5 % CO2-Inkubator für 24 h.
  3. Waschen Sie Zellen mit 2 mL von Phosphat Puffer Kochsalzlösung (PBS) (37 mM NaCl, 8 mM Na2HPO4, 2,6 mM KCl und 1,5 mM KH2PO4) in jede Vertiefung eine 6-Well-Platte oder 0,5 mL PBS in jede Vertiefung von einer 24-Well-Platte. Nur für Poly-D-Lysin beschichteten 24 Well-Platte fügen Sie 25 µL von 0,05 % Gewicht pro Volumen Trypsin hinzu, in einem 5 % CO2 Inkubator für 5 min inkubieren Sie und 275 µL Zelle Medium pro Bohrloch. Fügen Sie bei 6-Platte 2 mL PBS in jede Vertiefung hinzu. Pipettieren rauf und runter auf 3/4 der Zellen (1,5 mL für eine 6-Well-Platte) oder 225 µL für eine 24-Well-Platte von 1 gut für Proteingewinnung (gehen Sie zu Protokoll Nr. 3 für die Protein-Extraktion) und 1/4 der Zellen (0,5 mL für eine 6-Well-Platte) oder 75 µL für eine 24-Well-Platte für die Ernte RNA-Extraktion und Zentrifuge bei 6.000 x g für 5 min bei 4 ° C (gehen Sie zu Schritt 5 für die RNA-Extraktion).
    Hinweis: Analysieren Sie die Wirkung der SINEUP-GLP in einer Poly-D-Lysin beschichteten 24 Well-Platte durch Bildgebung. Gehen Sie zu Schritt 7 (bildgebende Analyse).

(3) Proteingewinnung

  1. Vorsichtig aspirieren Sie 1,5 mL PBS und fügen 140 µL Lyse-Lösung (20 mM Tris-HCl (pH 7,5), 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1 % (w/V) Triton, 2,5 mM Natrium Pyrophosphat, β-Glycerophosphat 1 mM, 1 mM Na3VO4 hinzu 1 μg/mL Leupeptin und 0,005 % (w/V) Phenylmethylsulfonyl Fluorid (PMSF)) (siehe Tabelle der Materialien) für ein 6-Well-Platte oder 60 µL für eine 24-Platte, die Zelle-Pellets.
  2. Mischen von pipettieren und dann gründlich mischen, durch drehen bei langsamer Geschwindigkeit für 1 h bei 4 ° C. Sammeln Sie überstand durch Zentrifugation bei 14.000 X g für 10 min bei 4 ° C.
  3. Proteinkonzentration von farbmetrischen Assay zu überprüfen (siehe Tabelle der Materialien). Bereiten Sie die Reaktionen bei Raumtemperatur.
    1. Bereiten Sie 5-6mal Verdünnung Rinderserumalbumin (BSA) Protein standard Reinstwasser mit Konzentrationen von 0,2-1,5 mg/mL Protein. Bereiten Sie frische Standards jedes Mal.
    2. Bereiten Sie arbeiten Reagenz Aʹ durch Mischen von 1 mL Reagenz (alkalische Kupfer-Tartrat-Lösung) mit 20 µL des Reagenz S (Tensid-Lösung).
    3. 5 µL Wasser (Negativkontrolle), BSA Standard (Protein standard und positive Kontrolle) oder Protein Probe in jede Vertiefung eine 96-Well-Platte zu laden.
    4. 25 µL des Reagenz Aʹ in jede Vertiefung hinzufügen. Fügen Sie sorgfältig 200 µL des Reagenz B (Folin-Reagenz) pro auch Blasenbildung zu vermeiden. Die Platte mit Alufolie abdecken und ca. 5-10 min. warten.
    5. Messen Sie die Protein-Absorption bei 750 nm mit einem Spektrophotometer. Die Extinktion ist für mindestens 1 h stabil.
    6. Bereiten Sie die Standardkurve durch Plotten BSA standard Proteinkonzentrationen (mg/mL) auf der x-Achse und ihre jeweiligen Absorption auf der y-Achse. Berechnen Sie Protein Probenkonzentration anhand der Standardkurve Gleichung.
      Hinweis: Halten Sie des Protokolls auf diesen Schritt bei Bedarf an oder gehen Sie zu Schritt 4. Für die langfristige Lagerung Einfrieren Snap Proteinproben in flüssigem Stickstoff und Store bei-80 ° C.

(4) Protein Trennung von SDS-PAGE und Erkennung von Zielproteinen mit Antikörpern (Western-Blot-Analyse)

  1. Fügen Sie ein Volumen von 2 x laden Farbstoff (0,1 M Tris-HCl (pH 6,8), 4 % SDS, 20 % Glycerin, 1,42 % 2-Mercaptethanol und 0,2 % Bromophenol blue) für jedes Volume Protein Probe aus Schritt 3.3. Bei 90 ° C für 5 min erhitzen und sofort für 1 min auf Eis abkühlen.
  2. 10-20 µg Protein Proben zu 10 % SDS Polyacrylamidgel geladen und bei 100-150 V trennen) (siehe Tabelle der Materialien).
  3. Protein vom Gel auf 0,45-µm-Nitrozellulose-Membran übertragen (siehe Tabelle der Materialien) durch semi-dry Transfer Instrument mit Transfer-Puffer (25 mM Tris, 192 mM Glycin und 20 % Methanol) auf 25 V für 30 Minuten.
  4. Fügen Sie blockieren-Lösung (5 % fettfreie Trockenmilch in 1 X TBST-Puffer (137 mM NaCl, 20 mM Tris-HCl (pH 7,6), 0,1 % Tween-20)) (siehe Tabelle of Materials) in den Container bis die Membran ist völlig durchnässt und bei Zimmertemperatur 30 min inkubieren.
  5. Bei SINEUP-GFP, hybridisieren das Protein mit Anti-GFP Antikörper (verdünnt 1: 2000 in blocking-Lösung) (siehe Tabelle der Materialien) durch Inkubation der Membran für 30 min unter Schütteln bei Raumtemperatur. Als interne Kontrolle-Protein, β-Aktin-Protein durch Hybridisierung mit Anti-β-Aktin-Antikörper (verdünnt 1: 2000 in blocking-Lösung) zu erkennen (siehe Tabelle der Materialien) für 30 min unter Schütteln bei Raumtemperatur.
  6. Füllen Sie 1 X TBST-Puffer in den Behälter, bis die Membran völlig durchnässt und waschen für 5 min bei Raumtemperatur ist. Wiederholen Sie die Waschschritt zwei mehr Zeiten (insgesamt drei Wäschen).
  7. Hybridisieren GFP-Protein verdünnt (1: 1000 in blocking-Lösung) Anti-Kaninchen-Antikörper konjugiert mit Meerrettich-Peroxidase (HRP) und β-Aktin Protein zu hybridisieren verdünnt (1: 1000 in blocking-Lösung)-Anti-Maus-Antikörper konjugiert mit HRP auf der Membran für 30 min unter Schütteln bei Raumtemperatur.
  8. Waschen Sie die Membran mit 1 X TBST Puffer für 5 min bei Raumtemperatur. Wiederholen Sie die Waschschritt zwei mehr Zeiten (insgesamt drei Wäschen).
  9. Mischen Sie gleiches Volumen des HRP-verstärkte Chemilumineszenz (ECL) Erkennung Reagenz 1 und 2 (siehe Tabelle of Materials). Die Membran 2 mL ECL Reagenz Mischung, decken Sie die Box mit Alu-Folie ab und lasse Sie es für 1-2 min bei Raumtemperatur inkubieren. Sorgfältig entfernen Sie die Membrane aus ECL Reagenz Mischung und setzen mit einer Lumineszenz imaging Instrument.

(5) RNA-Extraktion und DNase-Behandlung

  1. Extrakt total RNA folgt der Standard Protokoll für RNA-Extraktion aus Zellen in einem monomolekularen Film27 angebaut oder alternativ verwenden Sie eine handelsübliche RNA-Extraktion kit (siehe Tabelle der Materialien). Kurz anzugeben, fügen Sie monophasisch Lyse-Reagenz (MLR) von Guanidin erfolgt und Phenol auf die geernteten Zellen in Schritt 2.3 (1 mL MLR pro 5 Millionen Zellen)27.
    Hinweis: Ändern Sie häufig Handschuhe. RNase-freie Reagenzien und Diethylpyrocarbonate (DEPC) verwenden-behandelt Kunststoff Geschirr und Glaswaren, RNA-Abbau zu verhindern. Pausieren Sie das Protokoll in diesem Schritt bei Bedarf. Store extrahiert RNA bei-80 ° C.
  2. Die gereinigten RNA fügen Sie 0,1 Volumen von 10 x DNase Puffer, 2 U von DNase aus Schritt 5.1 (siehe Tabelle der Materialien hinzu).
  3. Das Reaktionsvolumen zu 50 µL mit Nuklease-freies Wasser gesetzt und vorsichtig mischen. Bei 37 ° C für 30 min inkubieren.
  4. 0,1 Volumen neu suspendierten DNase Inaktivierung Reagenz hinzufügen und gut verrühren (siehe Tabelle der Materialien). 5 min bei Raumtemperatur mit sanft schütteln inkubieren.
  5. Zentrifugieren Sie bei 10.000 X g 90 S. Übertragung des Überstands (DNA-freie RNA), einem frischen RNase-freie 1,5 mL-Tube. Achten Sie darauf, dass Sie nicht das Pellet zu berühren, denn dadurch können Verschleppung von DNase ist lästig für nachgelagerte Schritte.
  6. Quantitate RNA durch Messung einer260 und260/a280 Verhältnis (der Bereich ist für reine RNA, 1.8-2.0) in einem UV-Spektrophotometer.

6. erste Strang cDNA Synthese und qRT-PCR-Analyse

  1. Führen Sie erste Strang cDNA Synthese nach einem standard cDNA Synthese Protokoll als unten (siehe Tabelle der Materialien).
    1. Mischen Sie 0,75 µM-Oligo-dT-Grundierung, 4,3 µM zufällige Primer, dNTPs (10 mM) mit 200-500 ng Gesamt-RNS (von Schritte 5 bis 8) in 10 µL des gesamten Reaktionsvolumen. Bei 65 ° C für 5 min inkubieren und dann sofort auf Eis gelegt.
    2. Mischen Sie 1 X Reverse Transkriptase Puffer, 1 U RNase-Inhibitor, 10 U der reversen Transkriptase und 10 µL fügen Sie RNA-Primer Mischung aus 6.1.1 hinzu.
    3. Die Lautstärke total Reaktion auf 20 µL mit Nuklease-freies Wasser bei Bedarf. Vorsichtig mischen und die Reaktion Mischung bei 30 ° C für 10 Minuten, dann bei 42 ° C für 60 min inkubieren und schließlich bei 95 ° C für 5 min, das Enzym zu inaktivieren. Die Rohre auf Eis abkühlen.
      Hinweis: Tauen Sie RNA-Proben und alle Reagenzien auf Eis auf und bereiten Sie die Reaktion Mischung auf Eis. Wenn Ziel RNAs nur PolyA RNAs sind, verwenden Sie Oligo dT Grundierung nur (2,5 µM). Pausieren Sie das Protokoll, wenn nötig. Speichern der synthetisierten cDNA bei-20 ° C.
  2. QRT-PCR in technischen Triplicates durchführen (n = 3, Cт Standardabweichung > 0,2) und innerhalb biologischer Replikate (n ≥ 3) mit 1 µL 10 ng cDNA, 0.4 µL des rückwärts-Primer (10 µM), 0.4 µL forward Primer (10 µM), 10 µL Gemisch Lösung der DNA-Polymerase , 0.4 µL Doppel-Strang DNA-Färbung Farbstoff, 10 µL Nuklease-freies Wasser (Reaktionsvolumen war 20 µL) zu erkennen, PCR-Produkte mit folgenden Bedingungen; halten Sie Bühne (1 Zyklus) für 30 s bei 95 ° C, Radfahren Bühne (40 Zyklen) für 5 s bei 95 ° C und für 30 s bei 60 ° C schmelzen Kurve Bühne. Primer-Beispiele sind für menschliche Gapdh_Fw: TCTCTGCTCCTCCTGTTC, menschliche Gapdh_Rv: GCCCAATACGACCAAATCC, EGFP_Fw: GCCCGACAACCACTACCTGAG, EGFP_Rv: CGGCGGTCACGAACTCCAG, SINEUP-GFP_Fw: CTGGTGTGTATTATCTCTTATG und SINEUP-GFP_Rv: CTCCCGAGTCTCTGTAGC. Siehe Tabelle der Materialien. Quantitativen Ausdruck der RNA mit 2- ∆∆Ct ± SD Methode28zu analysieren.

7. imaging Analyse der SINEUPs durch halbautomatische Nachweismethode

  1. Waschen Sie Zellen mit 0,5 mL PBS für einen Brunnen von einer 24-Well-Platte.
  2. Hinzufügen 2.0 μg Hoechst 33342 (siehe Tabelle der Materialien) (auflösen in 500 μl PBS) zu jedem der 24-Well-Platte gut und inkubieren Sie Zellen bei 37 ° C für 20 min, den Kern zu beflecken.
  3. Maßnahme Hoechst gefärbten Zellen zählen, die Gesamtzahl der Zellen an blaue Emission maximal 461 nm und Intensität der grünen Fluoreszenz, Anzahl der GFP positive Zellen bei grünen Emission maximal 510 nm mit einer Hochdurchsatz-Mikro-gut Bild Cytometer ( siehe Tabelle der Materialien). Analysieren Sie Protein Up-regulierende Wirkung von der SINEUPs durch die Berechnung von GFP integriert Intensität, die die Summe aller Pixel Intensitäten Signal in segmentierten Objekte berechnet für jeden Kanal, mit Imaging-Software29anzeigen.
  4. Ernten Sie Zellen, RNA-Expression (zurück zu Schritt 5 und 6) zu überprüfen.

Representative Results

SINEUP-GFP ist eine synthetische SINEUP, die sowohl eine optimale BD enthalten (-28 / + 4 überlappen, GFP-mRNA) und ein ED (invertiert Sinus B2 von AS -Uchl1), die Up-regulieren kann GFP mRNA Übersetzung (Abb. 3A und 3 b) ohne Änderung des Ausdrucks der GFP mRNA (Abbildung 3 und 3D). Optimale BDs und EDs für SINEUPs auf dem Bildschirm, entwickelten wir ein Protokoll der semi-automatischen Bildanalyse, die Erkennungszeit verbessert und erhöht die Anzahl der Samples, die gleichzeitig gezeigt im Vergleich mit einem herkömmlichen Western-Blot Analyse15. Wie in Abbildung 4dargestellt, nahm dieser Hochdurchsatz-imaging-System 3 Tage (Western-Blot Analyse dauerte 2 Wochen für 48 SINEUPs). Haben gezeigt, dass SINEUP-GFP GFP Übersetzung erhöht, erkannt wir GFP integriert Intensität durch die Bild-Cytometer. Die optimale BD SINEUP-GFP induziert einen 1,4fache Anstieg der GFP-Protein-Expression. Obwohl wir Kompression der Signale von 2,6-fache beobachtet (Western-Blot Analyse, siehe Abbildung 3A) bis 1,4fache (Imaging-Analyse, siehe Abbildung 5), der Unterschied könnte durch die Kalibrierung des die Instrumentensoftware zur Abbilderstellung sein. Trotzdem erkannt wir deutlich höhere Ebenen der GFP Fluoreszenz im Vergleich mit dem Regler (Abb. 5A und 5 b).

Figure 1
Abbildung 1: grundlegende Design der synthetischen SINEUPs. BD = bindende Domäne auf mRNA, ED = Effektor-Domäne mit einer umgekehrten Sinus-Sequenz. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Transkription ab Websites (TSK) der menschlichen Parkinson Krankheit Protein 7 (PARK7) mRNA in bestimmten Geweben und Zellen wie vom Käfig Analyse erkannt. (A) A Snapshot zeigt ein TSS-Suchergebnis für menschliche PARK7 mRNA mit einem Omics Datenintegration und interaktive Visualisierung System30. Die horizontalen grüne Pfeil in der Entrez gen hg19 Spur zeigt die genomische Position des Verweises menschlichen PARK7 mRNA und die vertikalen grünen Balken in der FANTOM5 Käfig 1 und 2 Tracks zeigen die Summe der TSK (gemessen als Abschriften pro million (Tpm)) von 1.829 Arten von Geweben und Zellen. (B) Zoom in den markierten Bereich der TSS in zentrale A (1/354 Skala: 35,4 kb bis 100 bp). Grau schattierte Bereich in der FANTOM5 Käfig-Phase 1 und 2 Spuren zeigt das TSS 6 bestimmter Zellen aus den insgesamt 1.829, die am unteren Rand der Abbildung aufgeführt sind. Die Zahlen (11.369, 4.998, 4.304, 3.509, 3.477 und 3.055) entspricht diese aufgelisteten Zellen zeigen Abschriften pro million für jede spezifische Zelle auf das grau schattiert Positionen der TSS. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: Western-Blot Analyse bestätigt Up-Regulierung der Übersetzung von SINEUP-GFP. (A) SINEUP-GFP wurde durch Western-Blot mit Anti-GFP-Antikörper untersucht. (B) Ergebnisse wurden auf die Intensität der β-Aktin Protein Band normalisiert. (C) GLP mRNA und (D) SINEUP RNAs Ausdruck wurden von qRT-PCR erkannt. p < 0,0005, n = 3, zweiseitigen Student t-Test, Fehlerbalken sind Standardabweichung. Diese Zahl wurde von Takahashi geändert Et Al.15. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: Schematische SINEUP semi-automatischen Bildanalyse. Tag 1: Samenzellen des Interesses an einer 24-Well-Platte. 2. Tag: Transfizieren Sie GFP und SINEUP-GFP. 3. Tag: Analysieren Sie die Wirkung des SINEUPs durch Messung der Intensität der GFP integriert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5: Hochdurchsatz-Analyse der Übersetzung bis-Regulierung von GFP-SINEUP. (A) Vergleich der GFP Fluoreszenz zwischen Kontrolle und SINEUP-GFP transfizierten Zellen15. Maßstabsleiste = 2 mm. (B) GLP integrierte Intensität wurde normiert auf die Ergebniszelle Anzahl von nuklearen Färbung mit Hoechst 33342 gezählt. p < 0,0005, n = 3, zweiseitigen Student t-Test, Fehlerbalken sind Standardabweichung. FOV: Sichtfeld. Diese Zahl wurde von Takahashi geändert Et Al.15. Bitte klicken Sie hier für eine größere Version dieser Figur.

Discussion

Wir beschrieben hier ein Protokoll um speziell Proteinproduktion zu erhöhen eines Ziels mRNA mittels einer Sinus-mit nicht-kodierende RNA, genannt SINEUPs. Als ein repräsentatives Beispiel ist optimale synthetische SINEUP-GFP gezeigt, um die Übersetzung der GFP mRNA 2,6-fache gemessen mittels Western-Blot Analyse bis zu regulieren.

Gestaltung eines optimalen BD ist entscheidend für SINEUP Spezifität und Wirksamkeit (Umfang der Protein Up-Verordnung) zu gewährleisten. Zuvor wir 17 BDs SINEUP-GFP von Western-Blot Analyse15 überprüft und festgestellt, dass die optimale BD die AUG-KOZAK Abfolge der GFP mRNA, überlappt obwohl es möglicherweise nicht der Fall mit anderen mRNAs und für jeden Fall überprüft werden sollte. Eine weitere unabhängige Gruppe gezeigt auch mit einer anderen Methode31BD. Wie viele BDs screening ziemlich zeitaufwändig und umständlich sein kann, haben wir eine Hochdurchsatz-SINEUP Methode hier eingeführt. Diese Methode misst relative Änderungen in der GFP integriert Dichte in SINEUP transfiziert-Zellen im Vergleich zu den Vektor transfected-Kontrollzellen. Um sicherzustellen, dass die Zellen in einem bestimmten gut einer Kultur-Platte sind ebenso transfiziert und GFP Signal konzentriert sich nicht auf nur eine bestimmte Region des Brunnens, ist es sehr wichtig, die Zellen in die Vertiefungen im Schritt 2.1 gleichermaßen zu verteilen. Zu diesem Zweck die Platte 10 mal hin und her (↑↓) nach der Aussaat der Zellen innerhalb einer sauberen Werkbank schütteln und vor Beginn der Inkubation im Brutschrank 5 % CO2 wiederholen.

Ein weiterer wichtiger Schritt ist die Berechnung der Proteinkonzentration im Schritt 3.3. Hier Fehlkalkulationen führen zu das Laden von einer falschen Menge des Proteins während der Western-Blot Analyse, folglich verhindern Erkennung von kleinen Änderungen im Protein-Expression von einigen der schwachen SINEUPs oder Fehlalarme aus Überlastung zu generieren. Es empfiehlt sich, frisch zubereiten die Standardkurve Protein jedes Mal dafür sorgen, dass gleiche Mengen von Standards und Proteinproben in Schritt 3.3.3 gemessen werden. Das Protokoll beschrieben hier konzentriert sich auf SINEUP-GFP, aber Western-Blot Analyse eignet sich für jede Zielgruppe mRNA von Interesse. Für jedes Ziel das beste Resultat zu erzielen sollte die Inkubationszeit und die Konzentration der Antikörper optimiert werden.

Die Besonderheiten des SINEUPs gehört, dass die Ziel-mRNA Ausdruck Ebene bleibt unberührt. Es ist wichtig zur Behandlung von RNA mit DNase zur Erkennung von transfizierten SINEUPs und genomische DNA durch qRT-PCR zu vermeiden. SINEUP RNAs und Ziel-mRNA-Expression sollte durch qRT-PCR, bestätigen den Erfolg der Transfektion und SINEUP Aktivität gemessen werden. SINEUPs enthalten eine Sinus-Sequenz, die reichlich in der Mensch und Maus Genomen. Zur Vermeidung von unspezifischer Nachweis von SINE Sequenzen empfiehlt es nicht qRT-PCR-Primer an die Sinus-Sequenz zu entwerfen.

In diesem Protokoll wir humanen Zelllinien verwendet, aber SINEUPs sind wirksam in einer Reihe von Zelllinien aus mehreren verschiedenen Arten12,13,14,18,19. Die Zelle Kultur und Transfektion Bedingungen können nach verschiedenen Zelllinien geändert werden, solange diese Transfection Leistungsfähigkeit der SINEUP Vektoren zu erhalten. Darüber hinaus können alternative Methoden der RNA Extraktion, cDNA Synthese und das Protein Konzentration überprüfen eingesetzt werden, angesichts der Tatsache, dass sie die erforderlichen RNA und Protein Qualität für qRT-PCR und Western-Blot Analyse erhalten. Während wir eine spezifische Hochdurchsatz-Mikro-Brunnen Cytometer, die Erkennung der GFP Fluoreszenz der gesamten gut rüber aktiviert verwendet, kann andere Cytometers mit einem ähnlichen Erfassungsbereich verwendeten31sein. Es ist darauf hinzuweisen, dass die Verteilung von Zellen und Transfektion in einen Brunnen gleich sind, dann nicht notwendig, das ganze gut für GFP Fluoreszenz Scannen wird: die Hälfte oder ein Viertel des Gebiets eines Brunnens könnte ausreichen, um SINEUP Wirkung je nach Experiment erkennen Al-Fähigkeiten.

Zur Gründung einer Hochdurchsatz-SINEUP Erkennung Protokoll ermöglicht die gleichzeitige Vorführung von mehreren BDs Ausrichtung auf einen bestimmten mRNA in kultivierten Zellen. Dies ist wichtig, da die Regeln für optimale Ausrichtung durch die BD noch unklar sind. Solch ein Multiplex screening-System ermöglicht eine umfangreiche Prüfung von vielen SINEUPs gegen verschiedene Gene, nützlich für die Ausrichtung auf mehrere Gene, die zum Beispiel einen bestimmten Signalweg beteiligt. Darüber hinaus kann es genutzt werden, um die Suche nach effektiven SINEUPs gezielt verschiedene mRNAs, Gestaltung von verschiedenen SINEUP BDs AUG-Kozak Region erweitern (siehe Abbildung 1), Co transfecting voller Länge Ziel mRNAs (5ʹ UTR-CDS-3ʹ UTR) verschmolzen mit GFP mRNA in kultivierten Zellen, die optimale SINEUPs und anschließend Test BD Kandidaten gegen endogene mRNA in kultivierten Zellen und in-vivo Modell Tiere von Menschen und Mäusen, andere Tier- und Pflanzenarten zu finden.

Dieses Screening Protokoll ist sehr schnell. Wir brauchen nicht zu beheben und Zellen zu sammeln, sondern müssen nur um die lebenden zu platzieren Zell-Kultur-Platte in der Bildgebung Instrument. Wir schlagen vor, dieses Hochdurchsatz-Screening-Protokoll verwenden, um optimale BDs SINEUPs Auswahl und Bewertung potenzielle Kandidaten durch Western-Blot Analyse. So können ausgewählte Kandidaten mit optimalen BDs angewendet werden, um Antikörper Produktion18,19,21zu erhöhen. Derzeit ist die RNA therapeutischen Bereich rasant. Zum Beispiel werden SiRNA, ASO, mRNA und CRISPR RNA Therapien, weithin eingesetzt, um mRNA Expression von ihrer jeweiligen Ziele9,32zu kontrollieren. In diesem Zusammenhang SINEUPs sind noch in den Kinderschuhen, aber bisher keiner der untersuchten SINEUPs Ausdruck der Ziel-mRNAs geändert. Darüber hinaus bearbeiten Sie SINEUPs nicht gezielt mRNA, aber nur bis regulieren Übersetzung von mRNA. Darüber hinaus können der Verlustfunktion Krankheiten infolge Haploinsufficiency durch SINEUP Therapie, Erreichung einer 2-fold Induktions der mangelhafte Protein17,33ausgerichtet sein. Obwohl Ziel Effekte weiter untersucht werden müssen, richten sich SINEUPs potenziell und speziell einen einzigen, ausgedrückt mRNA mit einer komplementären Sequenz, BD.

Eine Einschränkung dieses Hochdurchsatz-Protokolls ist, dass es nicht Bildschirm BDs von SINEUPs in in-vivo Mausmodellen geeignet ist, da die Protokoll Maßnahmen der GFP Intensität nur integriert. Wie SINEUPs natürliche antisense LncRNAs, die post-transcriptionally wirken, können sie angewendet werden, wenn das Ziel mRNA in den Zellen oder Gewebeproben fehlt.

Dennoch können SINEUPs Gain of Function Studien zur Verbesserung der Antikörper-Produktion, sowie eine RNA-Therapie, mangelhafte Proteinexpression im Bereich von 1,5-3,0-Fach bis zu Regeln angewendet werden. Die hier beschriebenen Methoden präsentieren einen nützlichen Leitfaden zum Ziel und SINEUP-induzierten Übersetzung Verbesserung der gewünschten mRNA zu erkennen und bieten ein neues Tool für posttranskriptionelle Genregulation.

Disclosures

Der korrespondierende Autor Piero Carninci ist einer der Gründer von TransSINE Technologies Co. Ltd., die geistiges Eigentum auf eingereichte Patent (EP2691522A4 und JP2017169573A) und erteilte Patent (US9353370B2) für SINEUP hält.

Acknowledgments

Diese Studie wurde teilweise durch die wissenschaftlichen Grundlagen und Plattform-Technologie-Programm für Innovative biologische Medizin unterstützt, Nr. 17 bin 0301014, von der Japan-Agentur für medizinische Forschung und Entwicklung (AMED), Research Grant von MEXT, RIKEN Center for Life Technologien und ein Forschungsstipendium von MEXT, RIKEN IMS. Wir danken Mitglieder des PC-Labor und das SINEUP-Netzwerk (SISSA, Universität des östlichen Piemont und RIKEN) für anregende Diskussionen. Wir danken Dr. Matthew Valentine für das Korrekturlesen.

Materials

Name Company Catalog Number Comments
Synthetic SINEUP Cell Guidance Systems Ltd. in UK and K.K.DNAFORM in Japan https://www.cellgs.com/items/sineupand8482.html and https://www.dnaform.jp/en/information/20130320 Step 1.5
HEK293T/17 ATCC ATCC CRL-11268 Step 2.1
Falcon Multiwell Plate For Cell Culture 6 well plate Corning 6902A01 Step 2.1
Corning BioCoat Poly-D-Lysine 24 well Plate Corning 08-774-124 Step 2.1
Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific 11668027 Step 2.2
pEGFP-C2 Clontech #6083-1 Step 2.2
Cell Lysis Buffer (10x) Cell Signaling Technology #9803S Step 3.1 This is pre-mixed cell lysis solution.
PMSF Cell Signaling Technology #8553S Step 3.1 To complete cell lysis buffer, add 0.005% (w/v) PMSF to 1x cell lysis buffer.
DC protein assay kit II BIO RAD #5000112JA Step 3.3
10% Mini-PROTEAN TGX Precast Protein Gels, 12-well, 20 µL BIO RAD #4561035 Step 4.2
Amersham Protran Premium NC 0.45 (150 mm×4 m) Amasham 10600013 Step 4.3, This is a 0.45 µm nitrocellulose membrane.
Nonfat Dry Milk Cell Signaling Technology #9999S Step 4.4 A component of the blocking solution.
GFP Tag Antibody Thermo Fisher Scientific A-6455 Step 4.5 Lot number: 1495850, RRID: AB_221570
Monoclonal Anti-β-Actin antibody produced in mouse SIGMA A5441 Step 4.5 Lot number: 026M4780V, RRID: AB_476744
Polyclonal Goat Anti Rabbit Immunoglobulins Dako P0448 Step 4.5 This is secondary antibody conjugating with HRP for anti GFP antibody. Lot number: 20017525, RRID:AB_2617138
Polyclonal Goat Anti mouse Immunoglobulins Dako P0447 Step 4.5 This is secondary antibody conjugating with HRP for anti β-Actin antibody. Lot number: 20019698, RRID:AB_2617137
ECL Western Blotting Detection Reagents Amersham RPN2109 Step 4.9
Maxwell Rapid Sample Concentrator (RSC) Instrument Promega AS4500 Step 5.1 This is commercially available RNA exreaction instrument.
Maxwell RSC simplyRNA Cells Kit Promega AS1390 Step 5.1 This is commercially available RNA exreaction kit.
TURBO DNA-free Kit ambion AM1907 Step 5.2 and 5.4 The kit contains DNase, DNase buffer and inactivation reagent.
PrimeScrip 1st strand cDNA Synthesis Kit TaKaRa 6110A Step 6.1 The kit contains reagents of first strand cDNA synthesis.
TB Green Premix Ex Taq II TaKaRa RR820A Step 6.2
Hoechst3342 Thermo Fisher Scientific H3570 Step 7.2
Celigo S Nexcelom Bioscience 200-BFFL-S Step 7.3 This is a high throughput micro-well image cytometer.

DOWNLOAD MATERIALS LIST

References

  1. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, (5740), 1564-1566 (2005).
  2. Carninci, P., et al. The transcriptional landscape of the mammalian genome. Science. 309, (5740), 1559-1563 (2005).
  3. Hon, C. C., et al. An atlas of human long non-coding RNAs with accurate 5' ends. Nature. 543, (7644), 199-204 (2017).
  4. Tufarelli, C., et al. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nature Genetics. 34, (2), 157-165 (2003).
  5. Yu, W., et al. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature. 451, (7175), 202-206 (2008).
  6. Carninci, P., Hayashizaki, Y. Noncoding RNA transcription beyond annotated genes. Current Opinion in Genetics & Development. 17, (2), 139-144 (2007).
  7. Chu, Y., Yue, X., Younger, S. T., Janowski, B. A., Corey, D. R. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 38, (21), 7736-7748 (2010).
  8. Ha, M., Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology. 15, (8), 509-524 (2014).
  9. Takahashi, H., Carninci, P. Widespread genome transcription: new possibilities for RNA therapies. Biochemical and Biophysical Research Communications. 452, (2), 294-301 (2014).
  10. Lam, J. K. W., Chow, M. Y. T., Zhang, Y., Leung, S. W. S. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy-Nucleic Acids. 4, e252 (2015).
  11. Nishina, K., et al. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nature communications. 6, 7969 (2015).
  12. Carrieri, C., et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 491, (7424), 454-457 (2012).
  13. Schein, A., Zucchelli, S., Kauppinen, S., Gustincich, S., Carninci, P. Identification of antisense long noncoding RNAs that function as SINEUPs in human cells. Scientific Reports. 6, 33605 (2016).
  14. Zucchelli, S., et al. SINEUPs are modular antisense long non-coding RNAs that increase synthesis of target proteins in cells. Frontiers in Cellular Neuroscience. 9, 174 (2015).
  15. Takahashi, H., et al. Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation. PLOS ONE. 13, (2), e0183229 (2018).
  16. Deutschbauer, A. M., et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 169, (4), 1915-1925 (2005).
  17. Indrieri, A., et al. Synthetic long non-coding RNAs [SINEUPs] rescue defective gene expression in vivo. Scientific Reports. 6, 27315 (2016).
  18. Patrucco, L., et al. Engineering mammalian cell factories with SINEUP noncoding RNAs to improve translation of secreted proteins. Gene. (2015).
  19. Sasso, E., et al. A long non-coding SINEUP RNA boosts semi-stable production of fully human monoclonal antibodies in HEK293E cells. MAbs. 1-8 (2018).
  20. Dang, V. T., Kassahn, K. S., Marcos, A. E., Ragan, M. A. Identification of human haploinsufficient genes and their genomic proximity to segmental duplications. European Journal of Human Genetics. 16, (11), 1350-1357 (2008).
  21. Zucchelli, S., Patrucco, L., Persichetti, F., Gustincich, S., Cotella, D. Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs. Computational and Struct Biotechnology Journal. 14, 404-410 (2016).
  22. Hua, Y., et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes & Development. 24, (15), 1634-1644 (2010).
  23. Watts, J. K., Corey, D. R. Silencing disease genes in the laboratory and the clinic. Journal of Pathology. 226, (2), 365-379 (2012).
  24. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  25. Wu, X., et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nature Biotechnology. 32, (7), 670-676 (2014).
  26. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  27. Liu, X., Harada, S. RNA isolation from mammalian samples. Current Protocols in Molecular Biology. Chapter 4 Unit 4.16 (2013).
  28. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  29. Schneider, C. A., Rasband, W. S., Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 9, (7), 671-675 (2012).
  30. Severin, J., et al. Interactive visualization and analysis of large-scale sequencing datasets using ZENBU. Nature Biotechnology. 32, (3), 217-219 (2014).
  31. Yao, Y., et al. RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat. Nucleic Acids Research. 43, (9), e58 (2015).
  32. Savić, N., Schwank, G. Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research. 168, 15-21 (2016).
  33. Long, H., et al. RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy. Biotechnology Letters. (2016).
Zellbasierte Assays der SINEUP nicht-kodierende RNAs, die speziell mRNA Übersetzung verbessern können
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).More

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter