Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

תא המבוסס על מבחני של SINEUP ללא קידוד RNAs זה במיוחד יכולה לשפר את התרגום mRNA

doi: 10.3791/58627 Published: February 1, 2019
* These authors contributed equally

Summary

SINEUPs הם סינתטיים antisense ללא קידוד RNAs, אשר מכילים תחום הכריכה (BD), תחום אפקטור (אד) ו- up-לווסת את התרגום של יעד ה-mRNA. כאן, אנו מתארים שיטות איתור עבור SINEUPs של שורות תאים בתרבית, ניתוח של פעילותם קידום תרגום על ידי המערב-כתם של תפוקה גבוהה חצי אוטומטי מערכת הדמיה.

Abstract

שיפור ממוקד-חלבון יש חשיבות לא רק לצורך המחקר של תהליכים ביולוגיים, אלא גם עבור יישומים טיפוליים, הביו-טכנולוגיה. כאן, אנו מציגים שיטה להסדיר באופן סלקטיבי למעלה-חלבון ביטוי של גנים הרצוי בתאים בתרבית על-ידי antisense סינתטי ללא קידוד RNAs המכונה SINEUPs. פקד חיובי זה גנים ברמת post-transcriptional, שהופעל על ידי הפוך קצר interspersed גרעיני רכיב (סינוס) אני חוזר בסוף 3ʹ SINEUPs אשר כוללת את המחשבים אפקטור שלו (אד). SINEUPs יכול במיוחד לאגד מכל mRNA חלבון-קידוד של בחירה דרך המחשבים מחייב (BD), אזור ומתוכננת הרצף בתוך אזור לא מתורגם 5ʹ (5ʹ UTR) וליד codon את ההתחלה של mRNA. SINEUPs במטרה תוכנן באופן זה הם transfected בתרבית תאים, חלבון ו- RNA שחולצו עבור ניתוחים במורד הזרם, בדרך כלל תקנים לאחר 24-48 שעות. חלבון SINEUP-induced למעלה-תקנה מאותרים על ידי ניתוח המערבי-כתם, ביטוי RNA נמדד באמצעות שעתוק במהופך כמותיים PCR בזמן אמת. הבחנו כי עיצוב BD הוא קריטי להשגת פעילות SINEUP אופטימום וכי בדיקות שונות BD הגדלים והמיקומים ביחס codon ההתחלה של המטרה ש-mrna מומלץ. לכן, אנו מתארים כאן חצי אוטומטיות תפוקה גבוהה הדמיה שיטה המבוססת על זיהוי פלורסצנטיות, זה יכול להיות מיושם למטרה ש-mrna התמזגו עם חלבון פלואורסצנטי ירוק (GFP). SINEUPs במיוחד לשפר את התרגום בטווח הנורמלי פיזיולוגיים של התא, מבלי לשנות את רמת התעתיק היעד. שיטה זו ננקטה בהצלחה נגד מגוון של מטרות אנדוגני, אקסוגני, מגוון רחב של האדם, עכבר, שורות תאים חרקים יחד עם מערכות ויוו. יתר על כן, SINEUPs דווחו להגביר את ייצור נוגדנים ולעבוד כמו RNA טיפולית נגד גנים haploinsufficient. אופי תכליתי ומודולרית SINEUPs גורם להם כלי מתאים עבור פקד translational גנים ספציפיים.

Introduction

בעידן הפוסט-גנומי, תובנות רבות הרווחנו דבר לתוך התפקידים ג'ין הרגולציה של הפרוטוקולים antisense ללא קידוד בשל התפתחות הדור הבא רצפי טכנולוגיות1,2,3 , כלים לעריכת ג'ין. קטגוריה זו של הפרוטוקולים, אשר נחשבה בעבר להיות "תעתיק אשפה", מוקמת עכשיו בתור שחקן המפתח של תקנה גנטי. תעתיקים antisense מדווחים לווסת כרומטין. בקרת יציבות ואת הביטוי שלהם cognate חלבונים הגיוני mRNA4,5. ברוב המקרים, במצב זה של תקנה שלילי, תעתיקים antisense להשתיק את עמיתיהם הגיוני עד ה-RNA-RNA אינטראקציות6,7. תכונה זו של הפרוטוקולים antisense טבעי יש כבר מנוצל כדי downregulate הרצוי הגנים בצורה של RNA מפריעות קטן סינתטי (siRNA), microRNA (miRNA) ו- oligos antisense (אסו)8,9,10 ,11 בהותירם חלל ריק טכנולוגי עבור ממוקד למעלה-הכונה.

מחקר מסקרן אחד שינתה את הפרספקטיבה של השדה antisense RNA על ידי הפגנת antisense באותו זמן ללא קידוד RNAs (כמו lncRNAs) של גנים Uchl1 (אוביקוויטין C-מסוף ההידרולז L1) ו Uxt (תעתיק מבוטא ubiquitously) חיובי לווסת את התרגום של cognate שלהם לחוש mRNA ברמת post-transcriptional עכברים12. 5ʹ סוף אלה כפי lncRNAs חופף עם מספר בסיסים באזור לא מתורגם 5ʹ (5ʹ UTR) של הפרוטוקולים הישר המקביל שלהם, הסוף 3ʹ שאינם חופפים מכיל חוזר הפוכה של רטרוטרנספוזון השייכים הקצרה וביניהם גרעינית רכיב (סינוס) המשפחה. מעניין, מצאנו כי הכוח המניע העיקרי מאחורי למעלה-תקנה translational זו הוא הסינוס מוטבע חוזר. וזה לא מוגבל העכבר שסינוס חוזר רק... האדם Alu חוזר המכילות כפי lncRNAs משופרת גם תרגום של היעד הגיוני mRNAs, מחזק את הרעיון של מחלקה הרומן של מונחי-סינוס antisense תקינה ללא קידוד RNAs, כראוי בשם SINEUPs13. מחקרים שנעשו לאחרונה הראו כי הפוטנציאל של SINEUPs טבעי נשמרת ב- SINEUPs סינתטי המיועד במיוחד למטרה גנים שונים אנדוגני, אקסוגני14,15. SINEUPs יש שתי תכונות חשובות: הראשונה "איגוד התחום" (BD) שהיא לרוב באזור הקצה 5ʹ משלים הרצף המקיף העיקרית להתחיל codon של mRNA חלבונים, ודבר שני, "התחום אפקטור" (אד) כמו זה משלבת הפוך חוזר של סינוס המהווה תנאי הכרחי עבור הפונקציה SINEUP14 (איור 1). יכול להיות מותאם אישית SINEUPs לעיצוב של BD המכוון כלפי הגן של בחירה. לאחר מכן ניתן לרתום זה כדי לנתח את הפונקציה של גן מסוים מעורב מסלול ביולוגי, כחלופה טובה יותר קונבנציונאלי mRNA ביטוי לאסטרטגיה. בנוסף, כלי רב-תכליתי זה יכול להיות מיושם כדי להגביר את ייצור נוגדנים, וכן תרופה לטיפול haploinsufficient מחלות שנגרמות על ידי מינונים לא מספקת של חלבונים פונקציונליים16,17,18, 19,20,21.

היתרונות של טכנולוגיית SINEUP הן מגוונות. זה אינו משנה את הביטוי של היעד ברמה תעתיק. עוד BDs לספק ירידה לפרטים נוספים SINEUPs, בעוד לא מתחילים dsRNA תלוית מתח תגובה15. אינדוקציה החלבון נשמר בטווח פיזיולוגי נורמלי של התא, מניעת כל משמעית עקב ביטוי חלבון חריגה או מוגזם. SINEUPs עולים בקנה אחד עם מגוון רחב של העכבר, אנושי, ותרבותית אוגר שורות תאים, למשל, HEK293T/17, HepG2, הלה, צ'ו, MN9D ורבים יותר12,13,14,15,18 ,19. SINEUPs ניתן לייעד ביעילות גנים אנדוגני, גנים transiently overexpressed ו מתויג דגל או לוציפראז-fusion גנים, ומבטל את הצורך של נוגדנים ספציפיים ג'ין14,18. הניתוח SINEUP הבסיסי מחייב תרבית תאים שגרתית, תרביות תאים, נתרן dodecyl סולפט-לזיהוי בג'ל (מרחביות-עמוד), בזמן אמת שעתוק לאחור כמותית-פולימראז תגובת שרשרת (לרביעיית-PCR) כלים והגדרות, ו ניתן להשיג התמחות בתוך זמן קצר.

כאן נתאר שיטת המיקוד גנים עם SINEUPs סינתטי להסדיר להמציא תרגום, אפקט בניגוד טכנולוגיות אחרות כגון התערבות RNA9 אסו gapmers11,22,23. שיטה בשימוש נרחב עבור הפעלת גנים מונחה RNA הוא באשכולות interspaced בקביעות קצר palindromic חזרה הפעלה מבוססת-(CRISPRa), שבו בביטוי הגן מופעלת ברמה תעתיק24. שיטה זו, למרות פשוטה ומהירה, דורשת מרובים מדריך בודד RNAs (sgRNAs) מיקוד אותו גן ליעילות גבוהה יותר, ובכך מגדיל את הסיכויים של חופש-יעד מחייב25. בנוסף, האנזים מפתח של מערכת CRISPRa, החלבון catalytically מת CRISPR-הקשורים 9 (dCas9) יש ירידה לפרטים קשירה נמוכה ולווסת מיקוד sgRNAs אזורים דו-כיוונית יזם יכול הלא ספציפית למעלה-בקרבת הגנים25. לעומת זאת, SINEUPs לאגד יעד ה-mRNA-אזור יחיד מחייב עם ירידה לפרטים גבוה, אינם משפיעים על ביטוי של גנים הסמוכה. נדון הצעדים הבסיסיים הכרוכים SINEUP עיצוב, תרביות תאים, חלבון וניתוחים ביטוי RNA. יתר על כן, אנו מציגים אוטומטית למחצה תפוקה גבוהה הדמיה מערכת למסך SINEUPs מרובים בבת אחת, אשר שימושית לצורך זיהוי של האופטימלית SINEUPs.

Protocol

1. עיצוב של ה-BDs של SINEUP בונה עבור היעד mRNAs

  1. בדיקת האתר מתחיל שעתוק (TSS) תרגום אתר המוצא של היעד mRNAs בתאים של ריבית. TSS נתוני מפרוייקטים קדד והן שהפאנטום (ניתוח שווי של ביטוי גנים, כלוב) (ZENBU: http://fantom.gsc.riken.jp/zenbu/).
  2. לפתוח את הדפדפן, חפש את הגנים של עניין ולבדוק TSS על ידי פסגות הכלוב.
  3. להתייעץ עם ניתוח דוגמא של תאים ורקמות ספציפי TSS של פרקינסון מחלת חלבון 7 (PARK7) mRNA באיור 2.
  4. עיצוב BD רצפים של מספר באורכים שונים המתאימים ל- 40 בסיסים במעלה ו- 32 בסיסים downstream של מתיונין הראשון (אוגוסט), 72 nt בסך הכל.
  5. מנהג להזמין את ה-BDs מעוצב SINEUP ביטוי וקטור (ראה טבלה של חומרים).
    הערה: בדוק יחודיות רצף באמצעות הכלי חיפוש בסיסי יישור המקומי (פיצוץ) כדי למנוע השפעות-יעד26.

2. התא תרבות, תרביות תאים SINEUP

  1. תאי זרע של עניין טוב-צלחת 6 או טוב-צלחת 24 עבור 24 שעות לפני תרביות תאים של SINEUPs. במקרה של שורת התאים בכליה עובריים אנושיים (HEK293T/17) (ראה טבלה של חומרים), הזרע 0.5 x 106 תאים לכל טוב של 6 טוב-לוחית או 1.5 x 105 תאים לכל טוב של פולי-D-ליזין מצופה 24 באר-צלחת (ראה טבלה של חומרים). הוא הופך confluent 70% לאחר 24 שעות.
  2. לאחר 24 שעות, לשנות המדיום 1.5 מיליליטר בינוני טריים לצלחת 6 טוב- או מ 0.4 ל בינונית טרייה עבור טוב-צלחת 24. במקרה של SINEUP-GFP, transfect 0.6 µg של pEGFP-C2 (ראה טבלה של חומרים) ו- 3.4 µg של SINEUP-GFP ב אחד טוב של ng 6 טוב-לוחית או 130 של pEGFP-C2 ו- 670 ng של SINEUP-GFP ב אחד טוב של הבאר-צלחת 24 עם ריאגנט תרביות תאים (µL 10 ב 6 ממוצע טוב-plate ו- 3 L בצלחת-24 טוב) לפי הוראות היצרן (ראה טבלה של חומרים), דגירה -37 מעלות צלזיוס חממה 5% CO2 עבור 24 שעות.
  3. רחץ תאים עם 2 מ ל תמיסת מאגר פוספט (PBS) (37 מ מ NaCl, 8 מ"מ Na2HPO4, 2.6 מ"מ בלבד אשלגן ו- 1.5 מ מ ח'2PO4) בכל טוב של הבאר-צלחת 6 או 0.5 מ של PBS ב כל טוב של הבאר-צלחת 24 שעות ביממה. רק עבור פולי-D-ליזין מצופה 24 באר-צלחת, להוסיף 25 µL של 0.05% משקל לכל אמצעי אחסון טריפסין, דגירה ב חממה2 CO 5% עבור 5 דקות ולהוסיף µL 275 תא בינוני לכל טוב. במקרה של 6 טוב-צלחת, להוסיף 2 מ של PBS מכל קידוח. Pipet למעלה ולמטה כדי לקצור 3/4 תאים (1.5 mL עבור טוב-צלחת 6) או µL 225 לצלחת 24 באר-1 טוב לחילוץ חלבון (םירוציק פרוטוקול 3 לחילוץ חלבון) ו- 1/4 של תאים (0.5 mL עבור טוב-צלחת 6) או 75 µL לצלחת 24. טוב- החילוץ-RNA, צנטריפוגה ב g 6,000 x למשך 5 דקות ב 4 ° C (םירוציק שלב 5 לחילוץ RNA).
    הערה: לנתח את השפעת SINEUP-GFP בפולי-D-ליזין מצופה 24 באר-צלחת על ידי הדמיה. עבור לשלב 7 (ניתוח הדמיה).

3. חלבון החילוץ

  1. תשאף 1.5 מ של PBS ובזהירות להוסיף 140 µL של פירוק פתרון (20 מ מ טריס-HCl (pH 7.5), 150 מ מ NaCl, 1 מ מ נה2EDTA, 1 מ"מ EGTA, 1% (w/v), טריטון, רב-תכליתי נתרן 2.5 מ מ, מ מ 1 β-glycerophosphate, 1 מ מ נה3VO4 1 leupeptin μg/mL, ו- 0.005% (w/v) phenylmethylsulfonyl פלואוריד (PMSF)) (ראה טבלה של חומרים) עבור µL 6 טוב-לוחית או 60 לצלחת 24 באר-כדי כדורי התא.
  2. לערבב על-ידי pipetting, ואז מערבבים ביסודיות על ידי סיבוב במהירות איטית עבור h 1-4 מעלות צלזיוס. לאסוף את תגובת שיקוע על ידי צנטריפוגה ב 14,000 x g 10 דקות ב 4 º C.
  3. לבדוק אם ריכוז חלבון assay ערכי צבע מוחלטים (ראה טבלה של חומרים). להכין את כל התגובות בטמפרטורת החדר.
    1. להכין 5 - 6 פעמים דילול של חלבון אלבומין שור (BSA) תקן במים הנדסה גנטית עם ריכוזים הנע בין 0.2-1.5 mg/mL חלבון. הכנת תקנים טריים בכל פעם.
    2. להכין עבודה ריאגנט Aʹ על ידי ערבוב 1 מ"ל של ריאגנט (פתרון tartrate נחושת אלקליין) עם 20 µL של ריאגנט S (חומרים פעילי שטח פתרון).
    3. לטעון µL 5 של מים (בקרה שלילית), תקן BSA (חלבון סטנדרטית וחיובי פקד) או חלבון מדגם כל טוב של 96-ובכן-צלחת.
    4. להוסיף 25 µL של ריאגנט Aʹ כל טוב. להוסיף בזהירות µL 200 של ריאגנט B (ריאגנט Folin) לכל טוב הימנעות כל היווצרות בועה. כיסוי לצלחת עם נייר אלומיניום ולחכות 5-10 דקות.
    5. למדוד את ספיגת החלבון ב- 750 ננומטר עם ספקטרופוטומטרים. ספיגת יציב במשך לפחות שעה.
    6. הכן עיקול רגיל על ידי ההתוויה ריכוז חלבון סטנדרטית BSA (mg/mL) על ציר ה-x ואת ספיגת בהתאמה שלהם על ציר ה-y. חישוב ריכוז חלבון לדוגמה על-ידי החלת עקומת הסטנדרטי למשוואה.
      הערה: להשהות את הפרוטוקול בשלב זה אם יש צורך או עבור לשלב 4. לאחסון לטווח ארוך, הצמד הקפאת דגימות חלבון חנקן נוזלי, חנות ב-80 מעלות צלזיוס.

4. חלבון ההפרדה על ידי עמודים מרחביות וזיהוי של חלבונים היעד עם נוגדנים (ניתוח המערבי-כתם)

  1. להוסיף אחד בנפח 2 x טוען צבען (0.1 M טריס-HCl (pH 6.8), 4% מרחביות, 20% גליצרול, 1.42% 2-mercaptethanol ו- 0.2% bromophenol כחול) לנפח כל של חלבון הדוגמה מהשלב 3.3. מחממים ב 90 מעלות צלזיוס במשך 5 דקות. ומגניב מיד בקרח במשך 1 דקה
  2. לטעון 10-20 µg של דגימות חלבון 10% מרחביות פולי-אקרילאמיד ג'ל, נפרדות-100-150 V) (ראה טבלה של חומרים).
  3. להעביר חלבון ג'ל 0.45-מיקרומטר ניטרוצלולוזה ממברנה (ראה טבלה של חומרים) על ידי כלי העברת חצי יבש עם מאגר העברה (25 מ מ טריס, מ מ 192 גליצין ו- 20% מתנול) בגיל 25 V למשך 30 דקות.
  4. הוספת פתרון חסימה (5% שומן חלב יבש במאגר x TBST 1 (מ מ 137 NaCl, 20 מ מ טריס-HCl (pH 7.6), 0.1% Tween-20)) (ראה טבלה של חומרים) אל המיכל עד הקרום לחלוטין ספוגה, דגירה זה בטמפרטורת החדר למשך 30 דקות.
  5. במקרה של SINEUP-GFP, hybridize את החלבון עם נוגדן anti-GFP (מדולל 1:2000 בחסימה פתרון) (ראה טבלה של חומרים) מאת המקננת קרום למשך 30 דקות ברעידות בטמפרטורת החדר. כמו חלבון בקרה פנימית, לזהות β-אקטין חלבונים על-ידי hybridizing עם נוגדן Anti-β-אקטין (מדולל 1:2000 בחסימה פתרון) (ראה טבלה של חומרים) במשך 30 דקות ברעידות בטמפרטורת החדר.
  6. להוסיף 1 מאגר x TBST המיכל עד הקרום רטובה לחלוטין, תשטוף עבור 5 דקות בטמפרטורת החדר. חזור על השלב שטיפת שני יותר פעמים (סך של שלושה שוטף).
  7. Hybridize חלבון ה-GFP כדי מדולל (1:1000 בחסימה פתרון) נגד הארנב נוגדן מצומדת עם חזרת peroxidase (HRP) ולאחר hybridize β-אקטין חלבון כדי מדולל נוגדן אנטי עכבר (1:1000 בחסימה פתרון) מצומדת עם HRP על הקרום במשך 30 דקות ברעידות בטמפרטורת החדר.
  8. רחץ קרום עם מאגר x TBST 1 עבור 5 דקות בטמפרטורת החדר. חזור על השלב שטיפת שני יותר פעמים (סך של שלושה שוטף).
  9. מערבבים כמות שווה ריאגנט לזיהוי משופר HRP chemiluminescence (ECL) 1 ו- 2 (ראה טבלה של חומרים). להעביר את הקרום 2 מ"ל ECL ריאגנט לערבב, לכסות את התיבה עם רדיד אלומיניום ולתת לו תקופת דגירה של 1-2 דקות בטמפרטורת החדר. בזהירות להסיר את הקרום ECL ריאגנט מיקס ולחשוף באמצעות של הפריה חוץ גופית הדמיה כלי נגינה.

5. RNA חילוץ וטיפול DNase

  1. תמצית הכולל RNA בעקבות התקן פרוטוקול לחילוץ RNA מתאי גדל של טפט27 או לחלופין להשתמש החילוץ-RNA זמינים מסחרית של קיט (ראה טבלה של חומרים). לציין בקצרה, להוסיף כל ריאגנט פירוק monophasic (MLR) של guanidine isothiocyanate, פנול תאים שנקטפו צעד (1 מ"ל MLR לכל ~ 5 מיליון תאים) 2.327.
    הערה: משתנים לעתים קרובות כפפות. השתמש RNase ללא ריאגנטים, diethylpyrocarbonate (DEPC)-מטופלים וואר פלסטיק וכלי זכוכית כדי למנוע השפלה RNA. השהה את הפרוטוקול בשלב זה אם יש צורך. חנות שחולצו RNA ב-80 מעלות צלזיוס.
  2. להוסיף נפח 0.1 10 x DNase מאגר ו- 2 U DNase הרנ א מטוהרים מהשלב 5.1 (ראה טבלה של חומרים).
  3. הגדר שעוצמת התגובה µL 50 במים נטולי נוקלאז ומערבבים בעדינות. דגירה ב 37 מעלות צלזיוס למשך 30 דקות.
  4. מוסיפים נפח 0.1 של ריאגנט איון DNase מחדש על תנאי ומערבבים היטב (ראה טבלה של חומרים). תקופת דגירה של 5 דקות בטמפרטורת החדר עם טלטול עדין.
  5. Centrifuge ב x 10,000 ג'י להעברת ס' 90 את תגובת שיקוע (ללא ה-DNA RNA) לרכבת התחתית 1.5 mL ללא RNase טריים. יש להיזהר לא לגעת בגדר כי זה יכול לגרום carry-over של DNase וזה בעייתי עבור שלבי במורד הזרם.
  6. Quantitate רנ א על ידי מדידה של260 , יחס280 /A260(עבור RNA טהור, הטווח הוא 1.8-2.0) בספקטרופוטומטר UV.

6. סטרנד ראשית cDNA סינתזה וניתוח לרביעיית-PCR

  1. לבצע סינתזה cDNA סטרנד הראשונה, בעקבות פרוטוקול סינתזה cDNA רגיל כמו להלן (ראה טבלה של חומרים).
    1. מערבבים 0.75 מיקרומטר oligo dT פריימר, 4.3 פריימר אקראי מיקרומטר, dNTPs (10 מ מ כל אחד) עם 200-500 ng RNA הכולל (בין שלבים 5-8) ב- µL 10 נפח התגובה הכולל. דגירה-65 מעלות צלזיוס למשך 5 דקות, ואז מיד לשים קרח.
    2. מערבבים 1 x רוורס טרנסקריפטאז מאגר, 1 U של RNase מעכב, 10 U של רוורס טרנסקריפטאז, ולהוסיף 10 µL RNA-פריימר לערבב מ 6.1.1.
    3. הגדר שעוצמת התגובה הכולל 20 µL במים נטולי נוקלאז במידת הצורך. לערבב בעדינות, דגירה המיקס התגובה של 30 מעלות צלזיוס למשך 10 דקות, ואז ב 42 מעלות צלזיוס במשך 60 דקות, ולבסוף ב 95 מעלות צלזיוס במשך 5 דקות כדי להשבית את האנזים. מגניב הצינורות על קרח.
      הערה: הפשרת RNA ודוגמאות כל ריאגנטים על קרח, להכין את תערובת התגובה על קרח. אם היעד RNAs רק תיקים עשויים RNAs, השתמש oligo dT תחל רק (2.5 מיקרומטר). השהה את הפרוטוקול במידת הצורך. חנות מסונתז cDNA ב-20 ° C.
  2. לבצע PCR לרביעיית ב- triplicates טכני (n = 3, Cт סטיית תקן > 0.2) ובתוך ביולוגי משכפל (n ≥ 3) באמצעות µL 1 של 10 ng cDNA, µL 0.4 של פריימר הפוכה (10 מיקרומטר), µL 0.4 של פריימר לפנים (10 מיקרומטר), 10 µL של פתרון תערובת של ה-DNA פולימראז , µL 0.4 של ה-DNA כפול-strand צביעת צבע, 10 µL של מים נטולי נוקלאז (נפח התגובה היה 20 µL) כדי לזהות מוצרים PCR באמצעות בעקבות התנאים; להחזיק במה (מחזור 1) 30 s ב 95 מעלות צלזיוס, רכיבה על אופניים הבמה (40 מחזורים) עבור 5 s ב 95 ° C ו-30 s-60 ° C, להמיס עקומת הבמה. פריימר דוגמאות הן עבור האדם Gapdh_Fw: TCTCTGCTCCTCCTGTTC, Gapdh_Rv האנושית: GCCCAATACGACCAAATCC, EGFP_Fw: GCCCGACAACCACTACCTGAG, EGFP_Rv: CGGCGGTCACGAACTCCAG, SINEUP-GFP_Fw: CTGGTGTGTATTATCTCTTATG ו- SINEUP-GFP_Rv: CTCCCGAGTCTCTGTAGC. עיין בטבלה של חומרים. ניתוח ביטוי כמותי RNA עם 2- ∆∆Ct ± SD שיטת28.

7. הדמיה ניתוח של SINEUPs על ידי שיטת זיהוי אוטומטי למחצה

  1. רחץ תאים עם 0.5 מ של PBS עבור אחד טוב של הבאר-צלחת 24 שעות ביממה.
  2. להוסיף μg 2.0 של Hoechst 33342 (ראה טבלה של חומרים) (המסת ב μL 500 ל- PBS) לכל אחד טוב של 24-ובכן-הצלחת, דגירה תאים ב 37 מעלות צלזיוס במשך 20 דקות להכתים את הגרעין.
  3. מדד Hoechst צבעונית תאים כדי לספור את המספר הכולל של תאים פליטה כחול לכל היותר 461 nm, ואת עוצמת קרינה פלואורסצנטית ירוק כדי לספור את מספר התאים חיובי GFP-מקסימום ירוק פליטה של 510 ננומטר על-ידי שימוש (cytometer של תמונת מיקרו-ובכן תפוקה גבוהה ראה טבלה של חומרים). לנתח את השפעת הרגולציה-up חלבון SINEUPs על-ידי חישוב עוצמת GFP משולב, אשר הוא הסכום של כל פיקסל עוצמות הצגת האות מקוטע אובייקטים מחושבת עבור כל ערוץ, באמצעות תוכנת הדמיה29.
  4. קציר תאים כדי לבדוק ביטוי RNA (חזרה על שלבים 5 ו- 6).

Representative Results

SINEUP-GFP הוא SINEUP סינתטי המכיל שני BD האופטימלי של (-28 / +4 חופפים ל GFP mRNA) ואד (הפוכה סינוס B2 מ- AS -Uchl1) זה יכול להמציא-לווסת תרגום GFP mRNA (איור 3A ו- 3B) מבלי לשנות את הביטוי של GFP mRNA (3C איור ותלת מימד). על מסך ה-BDs ו- EDs עבור SINEUPs אופטימום, פיתחנו פרוטוקול של ניתוח תמונה אוטומטי למחצה שיפור זמן זיהוי, גדל מספר דגימות במקביל מוקרן לעומת ניתוח המערבי-כתם קונבנציונאלי15. כפי שמוצג באיור4, מערכת הדמיה זו תפוקה גבוהה לקח 3 ימים (ניתוח המערבי-כתם לקח 2 שבועות עבור 48 SINEUPs). שיש הדגימו כי SINEUP-GFP מגביר GFP תרגום, אנחנו שזיהה GFP משולבת בעוצמה cytometer התמונה. האופטימלית BD של SINEUP-GFP המושרה עלייה 1.4-fold בביטוי חלבונים GFP. למרות הבחנו דחיסה של אותות 2.6-fold (ניתוח המערבי-כתם, ראה איור 3A) כדי 1.4-fold (הדמיה ניתוח, ראה איור 5), ההבדל עשוי לנבוע הכיול של התוכנה כלי הדמיה. למרות זאת, גילינו רמות גבוהות באופן משמעותי של זריחה GFP לעומת הפקד (איור 5A , 5B).

Figure 1
איור 1: עיצוב בסיסי של SINEUPs סינתטי. BD = איגוד תחום היעד mRNA, אד = אפקטור תחום המכיל רצף SINE הפוכה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: תמלול החל באתרים (אזעקת דייט) של חלבון מחלת פרקינסון אנושי 7 (PARK7) mRNA ב ספציפי רקמות ותאים כפי שזוהה על-ידי ניתוח הכלוב. (א) א תמונת מראה תוצאת חיפוש TSS עבור mRNA PARK7 האנושי באמצעות טכנולוגיות אינטגרציית נתונים של מערכת הדמיה אינטראקטיבית30. החץ הירוק אופקי במסלול hg19 ג'ין Entrez מציין את המיקום גנומית של ההפניה mRNA PARK7 האנושי, האנכיים הירוקים FANTOM5 כלוב 1 ו 2 רצועות מצביעים על הסכום של אזעקת דייט (הנמדדת תעתיקים לכל מיליון (tpm)) מ 1,829 סוגי רקמות ותאים. זום (B) של אזור מסומן TSS בלוח A (בקנה מידה 1/354: 35.4 kb עד 100 bp). גריי מוצל באזור בשלב כלוב FANTOM5 1 ו-2 רצועות מציין את TSS של 6 תאים ספציפיים מתוך 1,829 הכולל, המפורטים בחלק התחתון של האיור. המספרים (11.369, 4.998, 4.304, 3.509, 3.477 ו 3.055) המתאים לתאים הרשומים אלו מצביעים על תעתיקים לכל מיליון עבור כל תא מסוים בבית האפור מוצל עמדות TSS. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: ניתוח המערבי-כתם המאשרת למעלה-רגולציה של תרגום על ידי SINEUP-GFP. (א) SINEUP-GFP נבחן על ידי המערב-כתם עם נוגדן anti-GFP. (B) התוצאות היו מנורמל ללחץ של הלהקה חלבון β-אקטין. (ג) GFP mRNA וביטוי (D) SINEUP RNAs אותרו על ידי לרביעיית-PCR. 0.0005 < p, n = 3, מבחן t דו-זנבית של סטודנט, קווי שגיאה הן סטיית תקן. דמות זו שונתה מ טאקאשי et al.15. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: סכימטי של ניתוח תמונה אוטומטי למחצה SINEUP. יום 1: תאי זרע עניין בובכן-צלחת 24 שעות ביממה. יום 2: Transfect ה-GFP, SINEUP-GFP. יום 3: לנתח את השפעת SINEUPs על ידי מדידת עוצמת GFP משולב. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5: ניתוח תפוקה גבוהה של תרגום למעלה-התקנה על-ידי SINEUP-GFP. השוואה (A) של ה-GFP זריחה בין שליטה SINEUP-GFP transfected תאים15. סרגל קנה מידה = 2 מ מ. (B) GFP עוצמה משולבת היה מנורמל למספר בתא סכום שנספר על ידי צביעת גרעיני עם Hoechst 33342. 0.0005 < p, n = 3, מבחן t דו-זנבית של סטודנט, קווי שגיאה הן סטיית תקן. FOV: שדה ראייה. דמות זו שונתה מ טאקאשי et al.15. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Discussion

אנו המתואר כאן לפרוטוקול במיוחד לשפר את ייצור החלבון של מטרה mRNA לפי פירושו של סינוס-המכיל ללא קידוד RNA, שנקרא SINEUPs. בתור דוגמא מייצגת, אופטימום SINEUP סינתטי-GFP מוצג למעלה-לווסת את התרגום של mRNA GFP 2.6-fold כפי שהיא נמדדת על ידי ניתוח המערבי-כתם.

עיצוב של האופטימלית BD הוא חיוני כדי להבטיח ירידה לפרטים SINEUP ואת העוצמה (היקף חלבון למעלה-תקנה). בעבר, אנחנו הוקרן 17 BDs של SINEUP-GFP על ידי ניתוח המערבי-כתם15 ומצא כי BD אופטימום חופף את רצף AUG-קוזאק GFP mRNA, למרות זאת ייתכן לא המקרה עם אחרים mRNAs צריך לאמת עבור כל מקרה. עוד קבוצה עצמאית הוקרן גם BD שימוש בשיטה שונה31. הקרנת BDs רבים יכולה להיות מסורבלת ולדרוש זמן רב למדי, הצגנו תפוקה גבוהה SINEUP זיהוי כאן שיטה. שיטה זו מודדת שינויים יחסית בצפיפות GFP משולב בתאים SINEUP transfected-לעומת שליטה וקטור transfected-התאים. כדי להבטיח כי בתאים טוב מסוים של צלחת תרבות הם transfected באותה מידה GFP אות אינה מרוכזת רק באזור מסוים של הבאר, חשוב מאוד להפיץ התאים באותה מידה הבארות בשלב 2.1. למטרה זו, בעדינות לנער את הצלחת 10 פעמים הלוך ושוב (↑↓) לאחר זריעה התאים בתוך ספסל נקי וחזור בחממה2 CO 5% לפני תחילת הדגירה.

עוד צעד קריטי הוא ריכוז חלבונים בשלב 3.3. חישובים מוטעים כאן יכול להוביל הטעינה של שגוי כמות חלבון במהלך ניתוח המערבי-כתם, כתוצאה מכך מניעת גילוי של שינויים קטנים בביטוי חלבונים על ידי כמה SINEUPs חלש או יצירת תוצאות חיוביות שגויות של עומס יתר. מומלץ להכין טרי העקומה סטנדרטי חלבון בכל פעם, כדי לוודא כי כמויות שוות של סטנדרטים ודוגמאות חלבון נמדדים בשלב 3.3.3. הפרוטוקול המתואר כאן מתמקדת על SINEUP-GFP, אבל המערבי-כתם ניתוח יכול לשמש לכל מטרה mRNA של עניין. זמן הדגירה של ריכוז של נוגדנים צריך להיות אופטימיזציה עבור כל מטרה להשיג את התוצאה הטובה ביותר.

אחד האלמנטים הייחודיים של SINEUPs הוא רמת ביטוי היעד-mRNA נותר ללא פגע. חשוב להתייחס RNA עם DNase כדי למנוע זיהוי של transfected SINEUPs ו DNA גנומי מאת לרביעיית-PCR. SINEUP RNAs וביטוי mRNA היעד צריך להימדד על-ידי לרביעיית-PCR כדי לאשר את ההצלחה של תרביות תאים והן פעילות SINEUP. SINEUPs להכיל רצף של הסינוס, אשר בשפע לאורך שני האדם ואת העכבר הגנום. כדי למנוע זיהוי שאינם ספציפיים של רצפי סינוס, לא מומלץ לתכנן לרביעיית-PCR תחל רצף SINE.

ב פרוטוקול זה השתמשנו שורות תאים אנושיים, אך SINEUPs אפקטיבי במספר שורות תאים בין מספר מינים שונים12,13,14,18,19. ניתן לשנות את התנאים של תרבות, תרביות תאים תאים על פי שורות תאים שונים כל עוד אלה לשמור על תרביות תאים היעילות של הווקטורים SINEUP. יתר על כן, שיטות אלטרנטיביות של RNA החילוץ, סינתזה cDNA ובדיקת חלבון ריכוז יכול להיות מועסק, בהתחשב בכך שהם שומרים על איכות RNA וחלבון נדרש לרביעיית-PCR וניתוח המערבי-כתם. בעוד השתמשנו cytometer מיקרו-ובכן תפוקה גבוהה ספציפיים, אשר איפשרה גילוי של GFP זריחה על פני הבאר כולו, אחרים cytometers עם טווח גילוי דומה יכול להיות בשימוש31. . זה ראוי לציין כי אם חלוקת תאים, תרביות תאים זהים בכל טוב, אז זה לא הכרחי לסרוק הבאר כולו על ידי קרינה פלואורסצנטית GFP: חצי או רבע של אזור טוב יכול להיות מספיק כדי להבחין SINEUP אפקט בהתאם ניסוי מיומנויות באל.

הקמת פרוטוקול זיהוי SINEUP תפוקה גבוהה מאפשר סימולטני הקרנת BDs מרובים פילוח של mRNA נתון בתאים בתרבית. זה חשוב כמו הכללים המסדירים מצב של פילוח אופטימלית על ידי BD הם עדיין לא ברור. כזה מתחם בתי קולנוע מערכת הסינון מאפשר בדיקה בקנה מידה גדול של SINEUPs רבים נגד גנים שונים, שימושי עבור מיקוד גנים מרובים מעורבים מסלול איתות מסוים למשל. יתר על כן, זה יכול להיות מנוצל כדי להרחיב את החיפוש אחר SINEUPs יעיל למטרה מספר mRNAs, עיצוב שונה SINEUP BDs ברחבי אזור אוג-קוזאק (ראה איור 1), שותף transfecting באורך מלא היעד mRNAs (UTR UTR-תקליטורים-3ʹ 5ʹ) התמזגו עם GFP mRNA בתאים בתרבית למצוא את SINEUPs אופטימום ולאחר בדיקה לאחר מכן המועמדים BD נגד mRNA אנדוגני תאים בתרבית וחיות דגם ויוו, של בני אדם ועכברים למינים אחרים מהחי והצומח.

פרוטוקול הקרנה זה הוא מהיר מאוד. אנחנו לא צריכים לתקן ואת איסוף תאים, אבל רק צריך מקום המגורים תא תרבות צלחת בכלי הדמיה. אנו מציעים להשתמש פרוטוקול הקרנה תפוקה גבוהה זה בחר BDs האופטימלי של SINEUPs ולהעריך מועמדים פוטנציאליים על ידי ניתוח המערבי-כתם. לפיכך, ניתן להחיל המועמדים שנבחרו עם ה-BDs האופטימלי כדי להגדיל את ייצור נוגדנים18,19,21. כיום, השדה הטיפולי RNA באופן דרמטי גדל. למשל, siRNA, אסו, mRNA, וטיפולים CRISPR RNA, מועסקים באופן נרחב כדי לשלוט בביטוי mRNA של9,שלהם מטרות בהתאמה32. בהקשר זה, SINEUPs הם בחיתוליהם, אך עד כה אף אחד SINEUPs למד שינה ביטוי של המטרה mRNAs. בנוסף, SINEUPs אל תערוך יעד ה-mRNA, אבל רק למעלה-לווסת את התרגום של mRNA. יתר על כן, ניתן לפלח אובדן-של-פונקציה מחלות הנובעות haploinsufficiency על ידי טיפול SINEUP, להשגת של אינדוקציה 2-fold של חלבון לקוי17,33. למרות ביטול-יעד אפקטים צריך שילמדו עוד יותר, SINEUPs פוטנציאלי, במיוחד יעד של mRNA יחיד, ביטוי עם רצף משלים ל BD.

מגבלה של פרוטוקול זה תפוקה גבוהה היא שזה לא מתאים מסך ה-BDs של SINEUPs במודלים של העכבר ויוו מכיוון האמצעים פרוטוקול GFP משולבת בעוצמה בלבד. כפי SINEUPs lncRNAs antisense טבעי להתנהג post-transcriptionally, אין אפשרות להחיל כאשר המטרה mRNA חסרה תאים או דגימות רקמה.

עם זאת, ניתן להחיל SINEUPs ללימודים רווח-של-פונקציה, להגברת ייצור נוגדנים, וכן טיפול RNA להסדיר למעלה-ביטוי של חלבונים לקוי בטווח של 1.5-3.0-קיפול. השיטות המתוארות כאן מציגים מדריך שימושי היעד, תרגום SINEUP-induced שיפור של mRNA הרצוי ויוכל לספק כלי חדש עבור הכונה post-transcriptional.

Disclosures

המחבר המקביל פיירו Carninci הוא אחד המייסדים של TransSINE טכנולוגיות בע מ המחזיקה קניין רוחני הגיש פטנט (EP2691522A4 ו- JP2017169573A), ואת הפטנט שהוענקה (US9353370B2) SINEUP טכנולוגיה.

Acknowledgments

מחקר זה חלקית נתמך על ידי מדע בסיסי של פלטפורמת טכנולוגיה תוכנית ללימודי רפואה ביולוגית חדשנית, מספר 17. אני 0301014, מסוכנות יפן למחקר רפואי, פיתוח (AMED), מענק מחקר MEXT למרכז RIKEN לכל החיים מדע וטכנולוגיות מענק מחקר מ MEXT השמ RIKEN. אנו מודים חברים של מעבדת PC ו של הרשת SINEUP (לירון אורלב, האוניברסיטה של פיימונטה המזרחי ו RIKEN) לדיונים מעורר מחשבה. אנו מודים ד ר מתיו האהבה על הגהה.

Materials

Name Company Catalog Number Comments
Synthetic SINEUP Cell Guidance Systems Ltd. in UK and K.K.DNAFORM in Japan https://www.cellgs.com/items/sineupand8482.html and https://www.dnaform.jp/en/information/20130320 Step 1.5
HEK293T/17 ATCC ATCC CRL-11268 Step 2.1
Falcon Multiwell Plate For Cell Culture 6 well plate Corning 6902A01 Step 2.1
Corning BioCoat Poly-D-Lysine 24 well Plate Corning 08-774-124 Step 2.1
Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific 11668027 Step 2.2
pEGFP-C2 Clontech #6083-1 Step 2.2
Cell Lysis Buffer (10x) Cell Signaling Technology #9803S Step 3.1 This is pre-mixed cell lysis solution.
PMSF Cell Signaling Technology #8553S Step 3.1 To complete cell lysis buffer, add 0.005% (w/v) PMSF to 1x cell lysis buffer.
DC protein assay kit II BIO RAD #5000112JA Step 3.3
10% Mini-PROTEAN TGX Precast Protein Gels, 12-well, 20 µL BIO RAD #4561035 Step 4.2
Amersham Protran Premium NC 0.45 (150 mm×4 m) Amasham 10600013 Step 4.3, This is a 0.45 µm nitrocellulose membrane.
Nonfat Dry Milk Cell Signaling Technology #9999S Step 4.4 A component of the blocking solution.
GFP Tag Antibody Thermo Fisher Scientific A-6455 Step 4.5 Lot number: 1495850, RRID: AB_221570
Monoclonal Anti-β-Actin antibody produced in mouse SIGMA A5441 Step 4.5 Lot number: 026M4780V, RRID: AB_476744
Polyclonal Goat Anti Rabbit Immunoglobulins Dako P0448 Step 4.5 This is secondary antibody conjugating with HRP for anti GFP antibody. Lot number: 20017525, RRID:AB_2617138
Polyclonal Goat Anti mouse Immunoglobulins Dako P0447 Step 4.5 This is secondary antibody conjugating with HRP for anti β-Actin antibody. Lot number: 20019698, RRID:AB_2617137
ECL Western Blotting Detection Reagents Amersham RPN2109 Step 4.9
Maxwell Rapid Sample Concentrator (RSC) Instrument Promega AS4500 Step 5.1 This is commercially available RNA exreaction instrument.
Maxwell RSC simplyRNA Cells Kit Promega AS1390 Step 5.1 This is commercially available RNA exreaction kit.
TURBO DNA-free Kit ambion AM1907 Step 5.2 and 5.4 The kit contains DNase, DNase buffer and inactivation reagent.
PrimeScrip 1st strand cDNA Synthesis Kit TaKaRa 6110A Step 6.1 The kit contains reagents of first strand cDNA synthesis.
TB Green Premix Ex Taq II TaKaRa RR820A Step 6.2
Hoechst3342 Thermo Fisher Scientific H3570 Step 7.2
Celigo S Nexcelom Bioscience 200-BFFL-S Step 7.3 This is a high throughput micro-well image cytometer.

DOWNLOAD MATERIALS LIST

References

  1. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, (5740), 1564-1566 (2005).
  2. Carninci, P., et al. The transcriptional landscape of the mammalian genome. Science. 309, (5740), 1559-1563 (2005).
  3. Hon, C. C., et al. An atlas of human long non-coding RNAs with accurate 5' ends. Nature. 543, (7644), 199-204 (2017).
  4. Tufarelli, C., et al. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nature Genetics. 34, (2), 157-165 (2003).
  5. Yu, W., et al. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature. 451, (7175), 202-206 (2008).
  6. Carninci, P., Hayashizaki, Y. Noncoding RNA transcription beyond annotated genes. Current Opinion in Genetics & Development. 17, (2), 139-144 (2007).
  7. Chu, Y., Yue, X., Younger, S. T., Janowski, B. A., Corey, D. R. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 38, (21), 7736-7748 (2010).
  8. Ha, M., Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology. 15, (8), 509-524 (2014).
  9. Takahashi, H., Carninci, P. Widespread genome transcription: new possibilities for RNA therapies. Biochemical and Biophysical Research Communications. 452, (2), 294-301 (2014).
  10. Lam, J. K. W., Chow, M. Y. T., Zhang, Y., Leung, S. W. S. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy-Nucleic Acids. 4, e252 (2015).
  11. Nishina, K., et al. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nature communications. 6, 7969 (2015).
  12. Carrieri, C., et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 491, (7424), 454-457 (2012).
  13. Schein, A., Zucchelli, S., Kauppinen, S., Gustincich, S., Carninci, P. Identification of antisense long noncoding RNAs that function as SINEUPs in human cells. Scientific Reports. 6, 33605 (2016).
  14. Zucchelli, S., et al. SINEUPs are modular antisense long non-coding RNAs that increase synthesis of target proteins in cells. Frontiers in Cellular Neuroscience. 9, 174 (2015).
  15. Takahashi, H., et al. Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation. PLOS ONE. 13, (2), e0183229 (2018).
  16. Deutschbauer, A. M., et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 169, (4), 1915-1925 (2005).
  17. Indrieri, A., et al. Synthetic long non-coding RNAs [SINEUPs] rescue defective gene expression in vivo. Scientific Reports. 6, 27315 (2016).
  18. Patrucco, L., et al. Engineering mammalian cell factories with SINEUP noncoding RNAs to improve translation of secreted proteins. Gene. (2015).
  19. Sasso, E., et al. A long non-coding SINEUP RNA boosts semi-stable production of fully human monoclonal antibodies in HEK293E cells. MAbs. 1-8 (2018).
  20. Dang, V. T., Kassahn, K. S., Marcos, A. E., Ragan, M. A. Identification of human haploinsufficient genes and their genomic proximity to segmental duplications. European Journal of Human Genetics. 16, (11), 1350-1357 (2008).
  21. Zucchelli, S., Patrucco, L., Persichetti, F., Gustincich, S., Cotella, D. Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs. Computational and Struct Biotechnology Journal. 14, 404-410 (2016).
  22. Hua, Y., et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes & Development. 24, (15), 1634-1644 (2010).
  23. Watts, J. K., Corey, D. R. Silencing disease genes in the laboratory and the clinic. Journal of Pathology. 226, (2), 365-379 (2012).
  24. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  25. Wu, X., et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nature Biotechnology. 32, (7), 670-676 (2014).
  26. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  27. Liu, X., Harada, S. RNA isolation from mammalian samples. Current Protocols in Molecular Biology. Chapter 4 Unit 4.16 (2013).
  28. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  29. Schneider, C. A., Rasband, W. S., Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 9, (7), 671-675 (2012).
  30. Severin, J., et al. Interactive visualization and analysis of large-scale sequencing datasets using ZENBU. Nature Biotechnology. 32, (3), 217-219 (2014).
  31. Yao, Y., et al. RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat. Nucleic Acids Research. 43, (9), e58 (2015).
  32. Savić, N., Schwank, G. Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research. 168, 15-21 (2016).
  33. Long, H., et al. RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy. Biotechnology Letters. (2016).
תא המבוסס על מבחני של SINEUP ללא קידוד RNAs זה במיוחד יכולה לשפר את התרגום mRNA
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).More

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter