Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

सेल SINEUP गैर कोडिंग RNAs है कि विशेष रूप से mRNA अनुवाद में वृद्धि कर सकते है आधारित परख

doi: 10.3791/58627 Published: February 1, 2019
* These authors contributed equally

Summary

SINEUPs सिंथेटिक antisense गैर कोडिंग RNAs है, जो एक बाध्यकारी डोमेन (BD) और एक प्रभाव डोमेन (ED) और अप लक्ष्य mRNA के अनुवाद को विनियमित होते हैं । यहां, हम SINEUPs के लिए खोज तरीकों का वर्णन के लिए संस्कृति में सेल लाइनों, उनके अनुवाद का विश्लेषण-पश्चिमी दाग और एक अर्द्ध स्वचालित उच्च प्रवाह इमेजिंग प्रणाली द्वारा गतिविधि को बढ़ावा देने ।

Abstract

लक्षित प्रोटीन वृद्धि महत्व का न केवल जैविक प्रक्रियाओं के अध्ययन के लिए है, लेकिन यह भी चिकित्सकीय और जैव प्रौद्योगिकी अनुप्रयोगों के लिए । यहां, हम चुनिंदा अप करने के लिए एक विधि प्रस्तुत-कृत्रिम antisense गैर के माध्यम से संस्कृतिपूर्ण कोशिकाओं में वांछित जीन के प्रोटीन अभिव्यक्ति को विनियमित-कोडिंग RNAs SINEUPs के रूप में जाना जाता है । जीन अभिव्यक्ति के इस सकारात्मक नियंत्रण के बाद transcriptional स्तर पर है और एक औंधा लघु interspersed परमाणु तत्व (ज्या) SINEUPs के 3 पिरणामस्वरूप अंत है कि उसके प्रभाव डोमेन (एड) शामिल है पर दोहराने के द्वारा लागू । SINEUPs विशेष रूप से किसी भी प्रोटीन के लिए बाध्य कर सकते है अपने बाध्यकारी डोमेन (BD) के माध्यम से पसंद की कोडिंग mRNA, एक के लिए 5 पिरणामस्वरूप untranslated क्षेत्र (5 पिरणामस्वरूप UTR) और codon के शुरू mRNA के भीतर अनुक्रम पूरक डिजाइन क्षेत्र । लक्ष्य-विशिष्ट इस तरह से डिजाइन SINEUPs प्रसंस्कृत कोशिकाओं को transfected हैं, और प्रोटीन और आरएनए अनुप्रवाह विश्लेषण के लिए निकाले जाते हैं, आम तौर पर 24-48 एच पोस्ट-अभिकर्मक. SINEUP-प्रेरित प्रोटीन अप-विनियमन पश्चिमी दाग विश्लेषण और आरएनए अभिव्यक्ति द्वारा पता लगाया है वास्तविक समय मात्रात्मक रिवर्स प्रतिलेखन पीसीआर का उपयोग कर मापा जाता है । हमने देखा है कि bd डिजाइन इष्टतम SINEUP गतिविधि प्राप्त करने के लिए महत्वपूर्ण है और है कि लक्ष्य mRNA के शुरू codon के संबंध में विभिंन bd आकार और पदों के परीक्षण की सिफारिश की है । इसलिए, हम यहां एक अर्द्ध स्वचालित उच्च प्रवाह इमेजिंग विधि प्रतिदीप्ति पता लगाने कि लक्ष्य mRNA ग्रीन फ्लोरोसेंट प्रोटीन (GFP) के साथ जुड़े को लागू किया जा सकता है पर आधारित का वर्णन । SINEUPs विशेष रूप से सेल के सामांय शारीरिक सीमा के भीतर अनुवाद बढ़ाने के लिए, लक्ष्य प्रतिलिपि स्तर फेरबदल के बिना । इस विधि को सफलतापूर्वक अंतर्जात और exogenous लक्ष्य की एक सीमा के खिलाफ कार्यरत है, मानव, माउस की एक विस्तृत विविधता में, और vivo सिस्टम में साथ कीट सेल लाइनों । इसके अलावा, SINEUPs एंटीबॉडी उत्पादन में वृद्धि और एक आरएनए haploinsufficient जीन के खिलाफ चिकित्सकीय के रूप में काम करने के लिए सूचित किया गया है । SINEUPs की बहुमुखी और मॉड्यूलर प्रकृति उन्हें जीन-विशिष्ट शोधों के नियंत्रण के लिए एक उपयुक्त उपकरण बनाती है.

Introduction

जीनोमिक के बाद के दौर में, कई अंतर्दृष्टि के जीन विनियामक भूमिकाओं में प्राप्त किया गया है गैर कोडिंग antisense टेप अगली पीढ़ी अनुक्रमण प्रौद्योगिकियों के विकास के कारण1,2,3 और जीन संपादन उपकरण । टेप, जो पहले "transcriptional कचरा" माना जाता था की यह श्रेणी अब आनुवंशिक विनियमन के एक प्रमुख खिलाड़ी के रूप में स्थापित किया गया है । Antisense टेप को क्रोमेटिन और नियंत्रण स्थिरता और उनके cognate प्रोटीन की अभिव्यक्ति-कोडिंग नब्ज mRNA4,5की सूचना है । ज्यादातर मामलों में, विनियमन के इस विधा नकारात्मक और antisense टेप आरएनए-आरएनए6,7के माध्यम से उनकी भावना समकक्षों मौन है । प्राकृतिक antisense टेप की यह विशेषता सिंथेटिक छोटे हस्तक्षेप आरएनए (सिरना), microRNA (miRNA), और antisense ओलिगोस्पर्मिया (ASO) के रूप में downregulate वांछित जीन का उपयोग किया गया है8,9,10 ,11 लक्षित जीन अप के लिए एक तकनीकी शूंय छोड़ने-विनियमन ।

एक पेचीदा अध्ययन का प्रदर्शन है कि antisense लंबे समय से गैर कोडिंग RNAs (lncRNAs के रूप में) जीन Uchl1 (ubiquitin सी-टर्मिनल hydrolase L1) और Uxt (बैरे-प्रतिलिपि व्यक्त की) द्वारा antisense आरएनए क्षेत्र के परिप्रेक्ष्य बदल चूहों में transcriptional स्तर के पश्चात्12में उनके cognate भाव mRNA के अनुवाद को सकारात्मक रूप से विनियमित करना । इन के रूप में lncRNAs के 5 पिरणामस्वरूप अंत 5 पिरणामस्वरूप untranslated क्षेत्र में कई कुर्सियां (5 पिरणामस्वरूप UTR) उनके इसी भाव टेप के साथ ओवरलैप, और गैर अतिव्यापी 3 पिरणामस्वरूप अंत एक retrotransposon की एक औंधा दोहराने शामिल लघु interspersed परमाणु से संबंधित तत् (ज्या) कुटुंब. दिलचस्प है, हमने पाया है कि इस शोधों के पीछे मुख्य ड्राइविंग बल-विनियमन एंबेडेड साइन दोहराने है और यह केवल माउस को दोहराने के लिए सीमित नहीं है । मानव Alu दोहराने-lncRNAs के रूप में भी लक्ष्य भावना mRNAs का अनुवाद बढ़ाया, ज्या के एक उपंयास वर्ग के विचार मजबूत-विनियामक antisense गैर कोडिंग RNAs, उचित13SINEUPs नाम चालित । हाल के अध्ययनों से पता चला है कि प्राकृतिक SINEUPs की क्षमता सिंथेटिक SINEUPs में संरक्षित करने के लिए विशेष रूप से विभिंन अंतर्जात और exogenous जीन14,15लक्ष्य बनाया है । SINEUPs दो महत्वपूर्ण विशेषताएं हैं: पहले "बाध्यकारी डोमेन" (बी) जो आम तौर पर 5 पिरणामस्वरूप अंत एक प्रोटीन के प्राथमिक शुरू codon को शामिल अनुक्रम के पूरक क्षेत्र है mRNA कोडिंग, और दूसरा "प्रभाव डोमेन" (ईडी) के रूप में इसे शामिल एक SINEUP समारोह14 के लिए एक शर्त है जो ज्या के उल्टे दोहराने (चित्रा 1) । SINEUPs के लिए एक विशेष रूप से पसंद की एक जीन लक्ष्यीकरण BD डिजाइन अनुकूलित किया जा सकता है । यह तो एक विशेष एक जैविक मार्ग में शामिल जीन के समारोह काटना दोहन किया जा सकता है, एक पारंपरिक mRNA के लिए एक बेहतर विकल्प के रूप में व्यक्त की रणनीति । इसके अलावा, इस बहुमुखी उपकरण एंटीबॉडी उत्पादन को बढ़ावा देने के लिए लागू किया जा सकता है, और कार्यात्मक प्रोटीन की अपर्याप्त खुराकों की वजह से haploinsufficient रोगों के इलाज के लिए एक दवा के रूप में16,17,18, 19,20,21.

SINEUP टेक्नोलॉजी के फायदे कई गुना होते हैं. यह transcriptional स्तर पर लक्ष्य की अभिव्यक्ति में परिवर्तन नहीं करता है । अब बीडीएस SINEUPs को और अधिक विशिष्टता प्रदान करते हैं, जबकि एक dsRNA-निर्भर तनाव15प्रतिक्रिया उत्प्रेरण नहीं है । प्रोटीन प्रेरण कोशिका की सामान्य शारीरिक सीमा के भीतर बनाए रखा है, ंयायपालिका या अत्यधिक प्रोटीन अभिव्यक्ति के कारण किसी भी बचके प्रभाव को रोकने. SINEUPs माउस, मानव की एक विस्तृत विविधता के साथ संगत कर रहे हैं, और हंसटर प्रसंस्कृत सेल लाइनों, उदाहरण के लिए, HEK293T/17, HepG2, हेला, चो, MN9D, और कई और12,13,14,15,18 ,19. SINEUPs कुशलतापूर्वक अंतर्जात जीन लक्ष्य कर सकते हैं, क्षणिक जीन, और झंडा-टैग या luciferase फ्यूजन जीन, जीन विशिष्ट एंटीबॉडी14,18की जरूरत को नष्ट करने । बुनियादी SINEUP विश्लेषण नियमित सेल संस्कृति, अभिकर्मक, सोडियम dodecyl सल्फेट-polyacrylamide जेल ट्रो की आवश्यकता है (एसडीएस-पृष्ठ), वास्तविक समय मात्रात्मक रिवर्स प्रतिलेखन-पोलीमरेज़ चेन रिएक्शन (qRT-पीसीआर) उपकरणों और सेटिंग्स, और विशेषज्ञता कम समय में प्राप्त किया जा सकता है ।

यहाँ, हम अप करने के लिए कृत्रिम SINEUPs के साथ जीन लक्ष्यीकरण के लिए एक विधि का वर्णन-अनुवाद को विनियमित, आरएनए हस्तक्षेप9 और ASO gapmers11,22,23जैसे अन्य प्रौद्योगिकियों के विपरीत एक प्रभाव. आरएनए-निर्देशित जीन सक्रियण के लिए एक व्यापक रूप से इस्तेमाल विधि नियमित रूप से प्रतिक्रियाशील लघु palindromic दोहराया-आधारित सक्रियण (CRISPRa), जहां जीन अभिव्यक्ति transcriptional स्तर24पर शुरू हो रहा है संकुल है । इस विधि, हालांकि सरल और तेजी से, एकाधिक एकल गाइड RNAs (sgRNAs) उच्च दक्षता के लिए एक ही जीन लक्ष्यीकरण की आवश्यकता है, जिससे ऑफ लक्ष्य बंधन25की संभावना बढ़ रही है । इसके अलावा, CRISPRa प्रणाली के प्रमुख एंजाइम, उत्प्रेरक मृत CRISPR-जुड़े प्रोटीन 9 (dCas9) कम बाध्यकारी विशिष्टता और sgRNAs लक्ष्यीकरण द्वि-दिशात्मक प्रवर्तक क्षेत्रों गैर विशेष रूप से अप-पास के जीन25को विनियमित कर सकते हैं । इसके विपरीत, SINEUPs उच्च विशिष्टता के साथ एक एकल बंधन क्षेत्र में mRNA लक्ष्य को बांध और आसपास के जीन की अभिव्यक्ति को प्रभावित नहीं करते । हम SINEUP डिजाइन, अभिकर्मक, प्रोटीन और आरएनए एक्सप्रेशन विश्लेषण में शामिल बुनियादी कदमों पर चर्चा करते हैं । इसके अलावा, हम एक अर्द्ध स्वचालित, उच्च प्रवाह इमेजिंग प्रणाली को एक बार में कई SINEUPs स्क्रीन, जो इष्टतम SINEUPs का पता लगाने के लिए उपयोगी है वर्तमान ।

Protocol

1. SINEUP की बीडीएस की डिजाइन का निर्माण लक्ष्य mRNAs के लिए

  1. प्रतिलिपि प्रारंभ साइट (TSS) और ब्याज की कोशिकाओं में लक्ष्य mRNAs का अनुवाद शुरू साइट की जांच करें । दोनों सांकेतिक शब्दों में बदलना और FANTOM परियोजनाओं (जीन अभिव्यक्ति, पिंजरे के कैप विश्लेषण) (ZENBU: http://fantom.gsc.riken.jp/zenbu/) से TSS डेटा प्राप्त करें ।
  2. खुला ब्राउज़र, ब्याज की खोज जीन और पिंजरे चोटियों द्वारा TSS की जांच करें ।
  3. कोशिका और ऊतक विशिष्ट TSS पार्किंसंस रोग प्रोटीन 7 (PARK7) mRNA चित्रा 2में दिखाया गया है के उदाहरण के विश्लेषण से परामर्श करें ।
  4. डिजाइन BD कई अलग लंबाई के इसी ४० कुर्सियां ऊपर और ३२ कुर्सियां पहले methionine (AUG), ७२ nt के बहाव में कुल ।
  5. कस्टम क्रम SINEUP अभिव्यक्ति वेक्टर में डिजाइन बीडीएस ( सामग्री की तालिकादेखें) ।
    नोट: बंद लक्ष्य प्रभाव26से बचने के लिए बुनियादी स्थानीय संरेखण खोज उपकरण (ब्लास्ट) द्वारा अनुक्रम विशिष्टता की जाँच करें ।

2. सेल कल्चर और SINEUP अभिकर्मक

  1. एक 6 अच्छी तरह से प्लेट या 24 SINEUPs के अभिकर्मक से पहले ज के लिए अच्छी तरह से प्लेट में ब्याज की बीज कोशिकाओं । मानव भ्रूण गुर्दा कोशिका लाइन (HEK293T/17) के मामले में ( सामग्री की तालिकादेखें), बीज ०.५ x 106 अच्छी तरह से प्लेट या १.५ x 105 कोशिकाओं के प्रति अच्छी तरह से एक पाली-डी-lysine लेपित 24 अच्छी तरह से प्लेट ( सामग्री की तालिकादेखें) । यह 24 घंटे के बाद ७०% धाराप्रवाह हो जाता है ।
  2. 24 घंटे के बाद, मध्यम एक 6 अच्छी तरह से प्लेट के लिए ताजा माध्यम के १.५ मिलीलीटर या ताजा माध्यम के ०.४ मिलीलीटर के लिए बदल जाते हैं । SINEUP-GFP के मामले में transfect ०.६ pEGFP के µ जी-C2 ( सामग्री की तालिकादेखें) और ३.४ µ जी के SINEUP-GFP एक अच्छी तरह से एक 6 अच्छी प्लेट या १३० pEGFP के एनजी-C2 और ६७० SINEUP के एनजी-GFP में अच्छी तरह से एक 24 अच्छी तरह से प्लेट की अभिकर्मक रिएजेंट के साथ (10 µ l में 6 अच्छी तरह से प्लेट और 3 µ एल में 24 अच्छी तरह से प्लेट) निर्माता के निर्देशों का पालन करके ( सामग्री की तालिकादेखें), और ३७ ° c में एक 5% सीओ 2 मशीन में 24 घंटे के लिए मशीन ।
  3. फॉस्फेट बफर खारा (पंजाब) (३७ मिमी NaCl, 8 मिमी Na2HPO4, २.६ मिमी KCl और १.५ मिमी KH2पीओ4) के प्रत्येक कुआं में एक 6 अच्छी तरह से प्लेट या एक अच्छी तरह से एक 24 खैर की थाली में पंजाब के ०.५ मिलीलीटर के 2 मिलीलीटर के साथ कोशिकाओं को धो लें । केवल पाली के लिए डी-lysine लेपित 24 अच्छी तरह से प्लेट, जोड़ने की 25 µ एल ०.०५% वजन की मात्रा Trypsin, एक 5% में मशीन 5 मिनट के लिए सह2 मशीन और जोड़ने के लिए सेल मध्यम के २७५ µ l के प्रति अच्छी तरह से । 6 अच्छी तरह से प्लेट के मामले में, प्रत्येक कुआं में पंजाब के 2 मिलीलीटर जोड़ें । प्लास्टिक अप और नीचे फसल 3/4 कोशिकाओं के लिए (१.५ मिलीलीटर एक के लिए 6 अच्छी तरह से प्लेट या २२५ µ एल के लिए एक 24 अच्छी तरह से प्लेट) से 1 अच्छी तरह से प्रोटीन निष्कर्षण के लिए (प्रोटीन निष्कर्षण के लिए 3 प्रोटोकॉल के पास जाओ) और कोशिकाओं के 1/4 (एक अच्छी प्लेट के लिए ०.५ मिलीलीटर या एक 24 खैर प्लेट के लिए ७५ µ एल) के लिए आरएनए निष्कर्षण और 5 मिनट के लिए 4 डिग्री सेल्सियस पर ६,००० x g पर केंद्रापसारक (आरएनए निष्कर्षण के लिए चरण 5 पर जाएं) ।
    नोट: इमेजिंग द्वारा एक पाली-डी-lysine लेपित 24 वेल-प्लेट में SINEUP-GFP के प्रभाव का विश्लेषण करें । चरण 7 (इमेजिंग विश्लेषण) पर जाएं ।

3. प्रोटीन निष्कर्षण

  1. ध्यान से महाप्राण १.५ मिलीलीटर और पंजाब के १४० µ एल जोड़ने के lysis समाधान (20 मिमी Tris-एचसीएल (पीएच ७.५), १५० मिमी NaCl, 1 मिमी ना2EDTA, 1 मिमी EGTA, 1% (डब्ल्यू/वी) ट्राइटन, २.५ मिमी सोडियम pyrophosphate, 1 मिमी β-glycerophosphate, 1 मिमी न3VO4 , 1 μg/एमएल leupeptin, और ०.००५% (डब्ल्यू/वी) phenylmethylsulfonyl फ्लोराइड (PMSF)) ( सामग्री की तालिकादेखें) के लिए एक अच्छी प्लेट या ६० µ l के लिए 24 अच्छी तरह से प्लेट के लिए सेल छर्रों.
  2. pipetting द्वारा मिश्रण और फिर 4 डिग्री सेल्सियस पर 1 घंटे के लिए धीमी गति से घूर्णन द्वारा अच्छी तरह से मिश्रण । 4 डिग्री सेल्सियस पर 10 मिनट के लिए १४,००० x g पर केंद्रापसारक द्वारा supernatant इकट्ठा ।
  3. वर्णमिति परख द्वारा प्रोटीन एकाग्रता की जांच करें (सामग्री की तालिका देखें) । कमरे के तापमान पर सभी प्रतिक्रियाओं को तैयार करें ।
    1. तैयार 5-6 बार ultrapure पानी में गोजातीय सीरम एल्ब्युमिन (BSA) प्रोटीन मानक के कमजोर पड़ने 0.2 से लेकर सांद्रता के साथ-1.5 mg/ नए मानक हर बार तैयार ।
    2. एजेंट (surfactant समाधान) के 20 µ एल के साथ एक (क्षारीय तांबे tartrate समाधान) के 1 मिलीलीटर reagent के मिश्रण से एक पिरणामस्वरूप काम कर रिएजेंट तैयार करें ।
    3. लोड 5 पानी की µ एल (नकारात्मक नियंत्रण), BSA मानक (प्रोटीन मानक और सकारात्मक नियंत्रण) या एक ९६ के प्रत्येक कुआं में प्रोटीन का नमूना-अच्छी तरह से प्लेट ।
    4. प्रत्येक कुआं में रिएजेंट एक पिरणामस्वरूप के 25 µ एल जोड़ें । ध्यान से एक अच्छी तरह से किसी भी बुलबुला गठन से बचने के प्रति एजेंट बी (Folin एजेंट) के २०० µ एल जोड़ें । एल्यूमीनियम पंनी के साथ प्लेट को कवर और 5-10 मिनट के लिए रुको ।
    5. एक spectrophotometer के साथ ७५० एनएम पर प्रोटीन अवशोषक उपाय । िारी कम से 1 ज के लिए स्थिर होती है ।
    6. एक्स-अक्ष पर BSA मानक प्रोटीन सांद्रता (मिलीग्राम/एमएल) की साजिश रचने और y-अक्ष पर उनके संबंधित अवशोषक द्वारा मानक वक्र तैयार करें । मानक वक्र समीकरण लागू करने के द्वारा नमूना प्रोटीन एकाग्रता की गणना ।
      नोट: यदि आवश्यक हो, तो इस चरण पर प्रोटोकॉल रोकें या चरण 4 पर जाएं । लंबी अवधि के भंडारण के लिए, तरल नाइट्रोजन और स्टोर पर-८० डिग्री सेल्सियस में प्रोटीन नमूने फ्रीज स्नैप ।

4. एसडीएस द्वारा प्रोटीन जुदाई-पृष्ठ और एंटीबॉडी के साथ लक्ष्य प्रोटीन का पता लगाने (पश्चिमी दाग विश्लेषण)

  1. 2x लोड हो रहा है डाई का एक खंड जोड़ें (०.१ एम Tris-एचसीएल (पीएच ६.८), 4% एसडीएस, 20% ग्लिसरॉल, १.४२% 2-mercaptethanol और ०.२% bromophenol नीला) से कदम ३.३ से प्रोटीन के नमूने के प्रत्येक खंड के लिए । 5 मिनट के लिए ९० ° c पर गर्मी और तुरंत 1 मिनट के लिए बर्फ पर ठंडा ।
  2. 10% एसडीएस पाली-acrylamide जेल और 100-150 V पर अलग से प्रोटीन के नमूनों की 10-20 µ जी लोड) ( सामग्री की तालिकादेखें) ।
  3. ०.४५-µm nitrocellulose झिल्ली ( सामग्री की तालिकादेखें) अर्द्ध द्वारा स्थानांतरण बफर (25 मिमी Tris, १९२ मिमी glycine और 20% मेथनॉल) के साथ 30 मिनट के लिए 25 वी में-सूखी स्थानांतरण उपकरण के लिए जेल से प्रोटीन स्थानांतरण ।
  4. ब्लॉकिंग समाधान जोड़ें (5% नॉन-फैट ड्राई मिल्क 1x TBST बफर में (१३७ mM NaCl, 20 मिमी Tris-एचसीएल (पीएच ७.६), ०.१% के बीच-20)) ( सामग्री की तालिकादेखें) तक कंटेनर के लिए झिल्ली पूरी तरह से लथपथ और 30 मिनट के लिए कमरे के तापमान पर यह गर्मी है ।
  5. SINEUP-GFP के मामले में, संकरण विरोधी GFP एंटीबॉडी के साथ प्रोटीन (समाधान अवरुद्ध में पतला 1:2000) ( सामग्री की तालिकादेखें) कमरे के तापमान पर मिलाते के साथ 30 मिनट के लिए झिल्ली की मशीन द्वारा । एक आंतरिक नियंत्रण प्रोटीन के रूप में, एंटी-β-actin एंटीबॉडी के साथ hybridizing द्वारा β-actin प्रोटीन का पता लगाने (समाधान अवरुद्ध में 1:2000 पतला) कमरे के तापमान पर झटकों के साथ 30 मिनट के लिए ( सामग्री की तालिकादेखें) ।
  6. कंटेनर के लिए 1x TBST बफर जोड़ें जब तक झिल्ली पूरी तरह से लथपथ है और कमरे के तापमान पर 5 मिनट के लिए धो लो । दोहराएं कदम दो अधिक बार (तीन बहाकर की कुल) ।
  7. संकरण GFP प्रोटीन को पतला (1:1000 अवरुद्ध समाधान में) विरोधी खरगोश एंटीबॉडी संयुग्मित सहिजन peroxidase (एचआरपी) के साथ, और संकरण β-actin प्रोटीन पतला करने के लिए (1:1000 अवरुद्ध समाधान में) विरोधी माउस एंटीबॉडी झिल्ली पर संयुग्मित के साथ एचआरपी कमरे के तापमान पर झटकों के साथ 30 मिनट के लिए ।
  8. कमरे के तापमान पर 5 मिनट के लिए 1x TBST बफर के साथ धो झिल्ली । दोहराएं कदम दो अधिक बार (तीन बहाकर की कुल) ।
  9. मिश्रण बराबर मात्रा एचआरपी-एन्हांस्ड chemiluminescence (ECL) डिटेक्शन रिएजेंट 1 और 2 ( सामग्री की तालिकादेखें) । 2 मिलीलीटर ECL रिएजेंट मिश्रण करने के लिए झिल्ली स्थानांतरण, एल्यूमीनियम पंनी के साथ बॉक्स को कवर और इसे कमरे के तापमान पर 1-2 मिनट के लिए मशीन । ध्यान से ECL रिएजेंट मिश्रण से झिल्ली को हटाने और एक luminescence इमेजिंग साधन का उपयोग कर बेनकाब ।

5. आरएनए निष्कर्षण और DNase उपचार

  1. कुल आरएनए निकालने एक monolayer27 में हो कोशिकाओं से आरएनए निष्कर्षण के लिए मानक प्रोटोकॉल निम्नलिखित या वैकल्पिक रूप से एक व्यावसायिक रूप से उपलब्ध आरएनए निष्कर्षण किट का उपयोग ( सामग्री की तालिकादेखें). संक्षेप में राज्य करने के लिए, चरण २.३ (1 मिलीलीटर एमएलआर प्रति ~ ५,०००,००० कोशिकाओं)27में guanidine isothiocyanate और phenol की काटी गई कोशिकाओं के लिए किसी भी monophasic lysis रिएजेंट (एमएलआर) जोड़ें ।
    नोट: दस्ताने अक्सर बदलें । RNase-मुक्त रिएजेंट, और diethylpyrocarbonate (DEPC) का प्रयोग करें-आरएनए क्षरण को रोकने के लिए प्लास्टिक के बर्तन और कांच के बाहर का इलाज । यदि आवश्यक हो, तो इस चरण पर प्रोटोकॉल रोकें । -८० डिग्री सेल्सियस पर दुकान निकाली आरएनए ।
  2. ०.१ की मात्रा जोड़ें 10x DNase बफर और 2 DNase के U से शुद्ध आरएनए के लिए ५.१ कदम ( सामग्री की तालिकादेखें).
  3. nuclease मुक्त पानी के साथ ५० µ l करने के लिए प्रतिक्रिया मात्रा सेट और धीरे मिश्रण. 30 मिनट के लिए ३७ ° c पर मशीन ।
  4. जोड़ें ०.१ पुन: निलंबित DNase निष्क्रियण रिएजेंट की मात्रा और अच्छी तरह से मिश्रण ( सामग्री की तालिकादेखें) । कोमल मिलाते के साथ कमरे के तापमान पर 5 मिनट के लिए मशीन ।
  5. ९० एस के लिए १०,००० x g पर केंद्रापसारक एक ताजा RNase-मुक्त १.५ मिलीलीटर ट्यूब के लिए supernatant (डीएनए मुक्त आरएनए) हस्तांतरण । गोली को छूने के लिए नहीं सावधान रहना है क्योंकि यह बहाव चरणों के लिए परेशानी है जो DNase के ले-ओवर पैदा कर सकता है ।
  6. Quantitate आरएनए एक२६० और एक२६०/२८० अनुपात को मापने के द्वारा (शुद्ध आरएनए के लिए, सीमा 1.8-2.0 है) एक यूवी spectrophotometer में ।

6. पहला कतरा सीडीएनए संश्लेषण और qRT-पीसीआर विश्लेषण

  1. नीचे के रूप में एक मानक सीडीएनए संश्लेषण प्रोटोकॉल निम्नलिखित (सामग्री की तालिका देखें) पहले किनारा सीडीएनए संश्लेषण प्रदर्शन.
    1. मिक्स ०.७५ µ एम oligo डीटी प्राइमर, ४.३ µ एम यादृच्छिक प्राइमर, 200-500 एनजी कुल आरएनए के साथ dNTPs (10 मिमी प्रत्येक) कुल प्रतिक्रिया मात्रा के 10 µ एल में (कदम से 5-8) । 5 मिनट के लिए ६५ ° c पर मशीन और फिर तुरंत बर्फ पर डाल दिया ।
    2. मिश्रण 1x रिवर्स transcriptase बफर, RNase अवरोध करनेवाला के 1 यू, रिवर्स transcriptase के 10 यू, और 6.1.1 से 10 µ एल आरएनए-प्राइमरी मिश्रण करने के लिए जोड़ें ।
    3. यदि आवश्यक हो तो nuclease-मुक्त पानी के साथ कुल प्रतिक्रिया मात्रा 20 µ l के लिए सेट करें । धीरे मिश्रण और 10 मिनट के लिए 30 डिग्री सेल्सियस पर प्रतिक्रिया मिश्रण है, तो ६० मिनट के लिए ४२ डिग्री सेल्सियस पर, और अंत में ९५ ° c पर 5 मिनट के लिए एंजाइम निष्क्रिय करने के लिए । बर्फ पर ट्यूबों शांत ।
      नोट: गल आरएनए नमूने और बर्फ पर सभी रिएजेंट और बर्फ पर प्रतिक्रिया मिश्रण तैयार करते हैं । यदि लक्ष्य RNAs केवल polyA RNAs हैं, तो oligo डीटी प्राइमर केवल (२.५ µ m) का उपयोग करें । यदि आवश्यक हो तो प्रोटोकॉल रोकें । -20 डिग्री सेल्सियस पर संश्लेषित सीडीएनए स्टोर ।
  2. प्रदर्शन qRT-पीसीआर तकनीकी triplicates में (एन = 3, Cт मानक विचलन > ०.२) और जैविक प्रतिकृति के भीतर (एन ≥ 3) का उपयोग कर 1 µ एल के 10 एनजी सीडीएनए, ०.४ µ l की रिवर्स प्राइमरी (10 µ मी), ०.४ µ l की फॉरवर्ड प्राइमरी (10 µ मी), DNA µ के मिक्सचर सॉल्यूशन के 10 पोलीमरेज़ l , ०.४ µ एल के डबल-कतरा डीएनए धुंधला डाई, 10 µ एल के nuclease-नि: शुल्क जल (प्रतिक्रिया मात्रा 20 µ एल था) निंनलिखित शर्तों का उपयोग कर पीसीआर उत्पादों का पता लगाने के लिए; ९५ डिग्री सेल्सियस पर 30 एस के लिए स्टेज (1 चक्र) पकड़ो, साइकिल चालन स्टेज (४० साइकिल) 5 एस के लिए ९५ डिग्री सेल्सियस पर और 30 एस के लिए ६० ° c, पिघल वक्र अवस्था में । प्राइमरी उदाहरण मानव Gapdh_Fw के लिए हैं: TCTCTGCTCCTCCTGTTC, मानव Gapdh_Rv: GCCCAATACGACCAAATCC, EGFP_Fw: GCCCGACAACCACTACCTGAG, EGFP_Rv: CGGCGGTCACGAACTCCAG, SINEUP-GFP_Fw: CTGGTGTGTATTATCTCTTATG और SINEUP-GFP_Rv: CTCCCGAGTCTCTGTAGC । सामग्री की तालिकादेखें । 2-∆ ∆ सीटी ± एसडी विधि28के साथ मात्रात्मक आरएनए अभिव्यक्ति का विश्लेषण ।

7. अर्द्ध स्वचालित डिटेक्शन विधि द्वारा SINEUPs का इमेजिंग विश्लेषण

  1. एक अच्छी तरह से 24 प्लेट की एक अच्छी तरह के लिए पंजाब के ०.५ मिलीलीटर के साथ धो कोशिकाओं ।
  2. Hoechst ३३३४२ के २.० μg जोड़ें ( सामग्री की तालिकादेखें) (पंजाब के ५०० μL में भंग) 24 के प्रत्येक अच्छी तरह से प्लेट और ३७ डिग्री सेल्सियस पर गर्मी कोशिकाओं के लिए 20 मिनट के लिए नाभिक दाग ।
  3. माप Hoechst सना हुआ कोशिकाओं ४६१ एनएम के एक नीले उत्सर्जन अधिकतम पर कोशिकाओं की कुल संख्या की गणना करने के लिए, और हरे प्रतिदीप्ति की तीव्रता एक उच्च प्रवाह माइक्रो-well छवि cytometer का उपयोग करके एक हरे उत्सर्जन अधिकतम ५१० एनएम पर GFP सकारात्मक कोशिकाओं की संख्या गिनती करने के लिए ( सामग्री की तालिकादेखें) । GFP एकीकृत तीव्रता की गणना करके SINEUPs के प्रोटीन अप-विनियामक प्रभाव का विश्लेषण करें, जो प्रत्येक चैनल के लिए परिकलित किए गए सेगमेंट में संकेत प्रदर्शित करने वाली सभी पिक्सेल तीव्रता का योग है, इमेजिंग सॉफ्टवेयर29का उपयोग करके ।
  4. आरएनए अभिव्यक्ति की जांच करने के लिए हार्वेस्ट सेल (5 और 6 चरणों के लिए वापस) ।

Representative Results

SINEUP-GFP एक सिंथेटिक दोनों एक इष्टतम BD युक्त SINEUP है (-28/+ 4 GFP mRNA को ओवरलैप) और एक प्रवर्तन निदेशालय (के रूप में-Uchl1) कि अप कर सकते है विनियमित GFP mRNA अनुवाद (चित्रा 3 और बी) के GFP की अभिव्यक्ति को बदलने के बिना mRNA (चित्रा 3 सी और 3d) । SINEUPs के लिए इष्टतम बीडीएस और अनुदेशों के लिए स्क्रीन, हम अर्द्ध स्वचालित छवि विश्लेषण का एक प्रोटोकॉल है कि सुधार का पता लगाने के समय विकसित और एक साथ एक पारंपरिक पश्चिमी दाग विश्लेषण15के साथ तुलना में दिखलाई जा रहा नमूनों की संख्या में वृद्धि हुई । के रूप में चित्रा 4में दिखाया गया है, इस उच्च प्रवाह इमेजिंग प्रणाली 3 दिन लग गए (पश्चिमी दाग विश्लेषण ४८ SINEUPs के लिए 2 सप्ताह लग गए) । कर प्रदर्शन किया है कि SINEUP-GFP GFP अनुवाद बढ़ जाती है, हम छवि cytometer द्वारा GFP एकीकृत तीव्रता का पता चला । SINEUP के इष्टतम BD-GFP GFP प्रोटीन अभिव्यक्ति में एक १.४ गुना वृद्धि प्रेरित । हालांकि हम २.६-गुना (पश्चिमी दाग विश्लेषण से संकेतों के संपीड़न मनाया, चित्र 3ए देखें) १.४-गुना (इमेजिंग विश्लेषण, चित्रा 5देखें), अंतर इमेजिंग साधन सॉफ्टवेयर के अंशांकन के कारण हो सकता है । फिर भी, हम नियंत्रण (चित्र 5 ए और 5B) के साथ तुलना में GFP प्रतिदीप्ति के काफी उच्च स्तर का पता चला ।

Figure 1
चित्रा 1: सिंथेटिक SINEUPs के बुनियादी डिजाइन । BD = बंधन डोमेन mRNA लक्ष्य, एड = प्रभाव एक औंधा साइन अनुक्रम युक्त डोमेन । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: प्रतिलेखन शुरू साइटें (TSSs) मानव पार्किंसंस रोग प्रोटीन 7 (PARK7) mRNA विशिष्ट ऊतकों और कोशिकाओं में पिंजरे विश्लेषण द्वारा पता चला के रूप में । () एक ओमिक्स डेटा एकीकरण और इंटरैक्टिव दृश्य प्रणाली30का उपयोग mRNA मानव PARK7 के लिए एक TSS खोज परिणाम दिखा स्नैपशॉट । Entrez जीन hg19 ट्रैक में क्षैतिज हरे तीर संदर्भ मानव PARK7 mRNA और FANTOM5 पिंजरे 1 में ऊर्ध्वाधर हरी सलाखों के जीनोमिक स्थिति को इंगित करता है और 2 पटरियों TSSs की राशि से संकेत मिलता है (प्रति मिलियन (tpm) के रूप में मापा) १,८२९ ऊतकों और कोशिकाओं के प्रकार । () एक पैनल में TSS के चिह्नित क्षेत्र के ज़ूम में (1/354 स्केल: ३५.४ kb से १०० bp) । FANTOM5 पिंजरे चरण 1 और 2 पटरियों में ग्रे छायांकित क्षेत्र आंकड़ा के तल पर सूचीबद्ध हैं, जो कुल १,८२९ से बाहर 6 विशिष्ट कोशिकाओं के TSS इंगित करता है । इन सूचीबद्ध कक्षों के लिए संगत संख्याओं (११.३६९, ४.९९८, ४.३०४, ३.५०९, ३.४७७, और ३.०५५) TSS के धूसर छायांकित स्थितियों में प्रत्येक विशिष्ट कक्ष के लिए प्रति लाख लेखन इंगित करता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3: पश्चिमी दाग विश्लेषण की पुष्टि-SINEUP-GFP द्वारा अनुवाद के विनियमन । () SINEUP-GFP विरोधी GFP एंटीबॉडी के साथ पश्चिमी-दाग की जांच की गई. () β-actin प्रोटीन बैंड की तीव्रता के लिए परिणाम सामान्यीकृत थे । () qRT-पीसीआर द्वारा GFP mRNA और () SINEUP RNAs एक्सप्रेशन का पता लगाया गया. p < ०.०००५, n = 3, दो-पुच्छित विद्यार्थी का t-परीक्षण, त्रुटि पट्टियां मानक विचलन हैं । यह आंकड़ा ताकाहाशी एट अल.15से संशोधित किया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: SINEUP अर्द्ध स्वचालित छवि विश्लेषण के योजनाबद्ध । 1 दिन: एक 24 अच्छी तरह से प्लेट में ब्याज की बीज कोशिकाओं । Day 2: Transfect GFP और SINEUP-GFP । 3 दिन: GFP एकीकृत तीव्रता को मापने के द्वारा SINEUPs के प्रभाव का विश्लेषण । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्रा 5: अनुवाद के उच्च प्रवाह विश्लेषण-विनियमन SINEUP द्वारा-GFP । () नियंत्रण और SINEUP-GFP transfected कोशिकाओं के बीच GFP प्रतिदीप्ति की तुलना15. स्केल बार = 2 मिमी. () GFP एकीकृत तीव्रता Hoechst ३३३४२ के साथ परमाणु दाग द्वारा गिना कुल सेल संख्या को सामान्यीकृत किया गया. p < ०.०००५, n = 3, दो-पुच्छित विद्यार्थी का t-परीक्षण, त्रुटि पट्टियां मानक विचलन हैं । FOV: देखने के क्षेत्र । यह आंकड़ा ताकाहाशी एट अल.15से संशोधित किया गया है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Discussion

हम यहां विशेष रूप से एक साइन-गैर कोडिंग आरएनए, SINEUPs बुलाया के माध्यम से एक लक्ष्य mRNA के प्रोटीन उत्पादन बढ़ाने के लिए एक प्रोटोकॉल का वर्णन किया । एक प्रतिनिधि उदाहरण के रूप में, इष्टतम सिंथेटिक SINEUP-GFP अप करने के लिए दिखाया गया है-GFP mRNA २.६ के अनुवाद को विनियमित-के रूप में पश्चिमी दाग विश्लेषण से मापा ।

एक इष्टतम BD डिजाइनिंग SINEUP विशिष्टता और शक्ति (प्रोटीन की हद तक विनियमन) को सुनिश्चित करने के लिए महत्वपूर्ण है । इससे पहले, हमने पश्चिमी ब्लाटर विश्लेषण द्वारा SINEUP-GFP के 17 बीडीएस की जांच की और पाया कि इष्टतम BD GFP mRNA के AUG-श्मिट अनुक्रम को ओवरलैप करता है, हालांकि यह अन्य mRNAs के साथ मामला नहीं हो सकता और प्रत्येक मामले के लिए सत्यापित किया जाना चाहिए । एक अंय स्वतंत्र समूह भी एक अलग31विधि का उपयोग कर BD दिखलाई । स्क्रीनिंग के रूप में कई बीडीएस काफी समय लेने वाली और बोझिल हो सकता है, हम एक उच्च प्रवाह SINEUP जांच विधि यहां शुरू की । यह विधि नियंत्रण वेक्टर transfected-कोशिकाओं की तुलना में SINEUP transfected-कोशिकाओं में GFP एकीकृत घनत्व में सापेक्ष परिवर्तन के उपाय करता है । यह सुनिश्चित करने के लिए कि एक संस्कृति प्लेट के एक विशेष कुआं में कोशिकाओं को समान रूप से transfected है और GFP संकेत अच्छी तरह से केवल एक निश्चित क्षेत्र के लिए ध्यान केंद्रित नहीं है, यह बहुत ही कदम २.१ में कुओं में समान रूप से कोशिकाओं को वितरित करने के लिए महत्वपूर्ण है । इस प्रयोजन के लिए, धीरे थाली हिला 10 बार आगे पीछे (↑ ↓) एक साफ पीठ के अंदर कोशिकाओं बोने के बाद और 5% CO2 मशीन में दोहराने से पहले मशीन शुरू ।

एक और महत्वपूर्ण कदम ३.३ कदम में प्रोटीन एकाग्रता की गणना है । यहां गलत गणना पश्चिमी दाग विश्लेषण के दौरान प्रोटीन की एक ग़लत राशि की लोडिंग करने के लिए नेतृत्व कर सकते हैं, फलस्वरूप कमजोर SINEUPs के कुछ द्वारा प्रोटीन अभिव्यक्ति में छोटे परिवर्तन का पता लगाने या अतिभारित से झूठी सकारात्मक पैदा करने को रोकने । यह ताजा प्रोटीन मानक वक्र हर बार तैयार करने के लिए सिफारिश की है, सुनिश्चित करें कि मानकों और प्रोटीन के नमूनों की बराबर मात्रा में कदम 3.3.3 में मापा जाता है बना । प्रोटोकॉल यहां वर्णित SINEUP-GFP पर केंद्रित है, लेकिन पश्चिमी दाग विश्लेषण ब्याज की किसी भी लक्ष्य mRNA के लिए इस्तेमाल किया जा सकता है । मशीन समय और एंटीबॉडी की एकाग्रता के लिए सबसे अच्छा परिणाम प्राप्त करने के लिए प्रत्येक लक्ष्य के लिए अनुकूलित किया जाना चाहिए ।

SINEUPs की अनूठी विशेषताओं में से एक है कि लक्ष्य-mRNA अभिव्यक्ति स्तर अप्रभावित रहता है । यह qRT-पीसीआर द्वारा transfected SINEUPs और जीनोमिक डीएनए का पता लगाने से बचने के लिए DNase के साथ आरएनए का इलाज करने के लिए महत्वपूर्ण है । अभिकर्मक और SINEUP गतिविधि दोनों की सफलता की पुष्टि के लिए SINEUP RNAs और target mRNA एक्सप्रेशन को qRT-पीसीआर द्वारा मापा जाना चाहिए । SINEUPs एक साइन अनुक्रम है, जो दोनों मानव और माउस जीनोम भर में प्रचुर मात्रा में होते हैं । ज्या अनुक्रम का गैर-विशिष्ट डिटेक्शन से बचने के लिए, यह qRT-पीसीआर प्राइमरों को साइन अनुक्रम के लिए डिज़ाइन करने के लिए अनुशंसित नहीं है ।

इस प्रोटोकॉल में हम मानव कोशिका लाइनों का इस्तेमाल किया, लेकिन SINEUPs कई विभिंन प्रजातियों12,13,14,18,19से सेल लाइनों के एक नंबर में प्रभावोत्पादक हैं । सेल संस्कृति और अभिकर्मक स्थितियों के रूप में इन SINEUP वैक्टर के अभिकर्मक दक्षता बनाए रखने के रूप में लंबे समय के रूप में अलग सेल लाइनों के अनुसार संशोधित किया जा सकता है । इसके अलावा, आरएनए निष्कर्षण, सीडीएनए संश्लेषण, और प्रोटीन एकाग्रता जाँच के वैकल्पिक तरीकों को देखते हुए नियोजित किया जा सकता है कि वे qRT-पीसीआर और पश्चिमी दाग विश्लेषण के लिए आवश्यक आरएनए और प्रोटीन गुणवत्ता की रक्षा करते हैं । जब तक हम एक विशिष्ट उच्च प्रवाह माइक्रो-अच्छी तरह से cytometer, जो पूरी तरह से GFP प्रतिदीप्ति का पता लगाने में सक्षम थे, एक समान पता लगाने रेंज के साथ अन्य cytometers31इस्तेमाल किया जा सकता है. यह ध्यान दिया जाना चाहिए कि अगर कोशिकाओं और अभिकर्मक के वितरण के एक अच्छी तरह भर में बराबर हैं, तो यह आवश्यक नहीं है GFP प्रतिदीप्ति के लिए पूरी तरह से स्कैन: आधा या एक अच्छी तरह के क्षेत्र के एक चौथाई प्रयोग के आधार पर SINEUP प्रभाव विचार करने के लिए पर्याप्त हो सकता है अल कौशल ।

एक उच्च प्रवाह SINEUP का पता लगाने प्रोटोकॉल की स्थापना कई बीडीएस के एक साथ स्क्रीनिंग के लिए अनुमति देता है संस्कृतिपूर्ण कोशिकाओं में एक दिया mRNA लक्ष्यीकरण । यह महत्वपूर्ण है के रूप में BD द्वारा अधिकतम लक्ष्यीकरण शासी नियम अभी भी अस्पष्ट हैं । इस तरह के एक मल्टीप्लेक्स स्क्रीनिंग प्रणाली विभिंन जीन के खिलाफ कई SINEUPs के बड़े पैमाने पर परीक्षण के लिए अनुमति देता है, कई उदाहरण के लिए एक विशेष संकेत मार्ग में शामिल जीन लक्ष्यीकरण के लिए उपयोगी है । इसके अलावा, यह प्रभावी SINEUPs कई mRNAs लक्ष्यीकरण के लिए खोज का विस्तार करने के लिए उपयोग किया जा सकता है, अगस्त के आसपास विभिंन SINEUP बीडीएस डिजाइन-श्मिट क्षेत्र ( 1 चित्रादेखें), सह transfecting पूर्ण लंबाई लक्ष्य mRNAs (5 पिरणामस्वरूप UTR-सीडीएस-3 पिरणामस्वरूप UTR) GFP mRNA के साथ जुड़े प्रसंस्कृत कोशिकाओं में इष्टतम SINEUPs को खोजने के लिए, और बाद में अंतर्जात mRNA के खिलाफ BD के उम्मीदवारों का परीक्षण करने के लिए प्रसंस्कृत कोशिकाओं में और vivo मॉडल जानवरों में, मनुष्यों और चूहों से अन्य पशु और प्रजातियों के पौधे.

यह स्क्रीनिंग प्रोटोकॉल बहुत तेज है । हम ठीक है और कोशिकाओं को इकट्ठा करने की जरूरत नहीं है, लेकिन सिर्फ इमेजिंग साधन में रहने वाले सेल संस्कृति प्लेट जगह की जरूरत है । हम इस उच्च प्रवाह स्क्रीनिंग प्रोटोकॉल का उपयोग करने के लिए SINEUPs के इष्टतम बीडीएस का चयन करें और पश्चिमी दाग विश्लेषण द्वारा संभावित उंमीदवारों का मूल्यांकन करने का प्रस्ताव । इस प्रकार, इष्टतम बीडीएस के साथ चयनित उंमीदवारों एंटीबॉडी उत्पादन बढ़ाने के लिए लागू किया जा सकता है18,19,21। वर्तमान में, आरएनए चिकित्सीय क्षेत्र नाटकीय रूप से बढ़ रहा है । उदाहरण के लिए, सिरना, ASO, mRNA, और CRISPR आरएनए चिकित्सा, व्यापक रूप से उनके संबंधित लक्ष्य9,३२के mRNA अभिव्यक्ति को नियंत्रित करने के लिए कार्यरत हैं । इस संदर्भ में, SINEUPs अपने शैशव में हैं, लेकिन अब तक कोई भी अध्ययन SINEUPs लक्ष्य mRNAs की अभिव्यक्ति बदल दिया है । इसके अलावा, SINEUPs लक्ष्य mRNA संपादित नहीं करते हैं, लेकिन केवल अप-mRNA के अनुवाद को विनियमित । इसके अलावा, हानि-समारोह haploinsufficiency से उत्पंन रोगों SINEUP चिकित्सा द्वारा लक्षित किया जा सकता है, की कमी प्रोटीन17,३३की एक 2 गुना प्रेरण प्राप्त करने । बंद लक्ष्य प्रभाव हालांकि आगे का अध्ययन करने की जरूरत है, SINEUPs संभावित और विशेष रूप से एक लक्ष्य, BD के लिए एक पूरक अनुक्रम के साथ mRNA व्यक्त किया.

इस उच्च प्रवाह प्रोटोकॉल की एक सीमा यह है कि यह उपयुक्त नहीं है SINEUPs में vivo माउस मॉडल में बीडीएस स्क्रीन क्योंकि प्रोटोकॉल GFP एकीकृत तीव्रता केवल उपाय । के रूप में SINEUPs प्राकृतिक antisense lncRNAs कि अधिनियम के बाद transcriptionally हैं, वे लागू नहीं किया जा सकता है जब लक्ष्य mRNA कोशिकाओं या ऊतक नमूनों में लापता है ।

फिर भी, SINEUPs लाभ के समारोह अध्ययन करने के लिए लागू किया जा सकता है, एंटीबॉडी उत्पादन बढ़ाने के लिए, और एक आरएनए थेरेपी के रूप में अप-1.5-3.0-गुना की सीमा के भीतर कमी प्रोटीन की अभिव्यक्ति को विनियमित । तरीकों यहां वर्णित करने के लिए लक्ष्य और वांछित mRNA के SINEUP प्रेरित अनुवाद वृद्धि का पता लगाने के लिए एक उपयोगी गाइड वर्तमान और पोस्ट के लिए एक नया उपकरण-transcriptional जीन विनियमन प्रदान करते हैं ।

Disclosures

इसी लेखक पिएरो Carninci TransSINE टेक्नोलॉजीज कं लिमिटेड के संस्थापकों में से एक है कि दायर पेटेंट (EP2691522A4 और JP2017169573A) पर बौद्धिक संपदा रखती है, और US9353370B2 प्रौद्योगिकी के लिए पेटेंट (SINEUP) दी ।

Acknowledgments

इस अध्ययन में आंशिक रूप से अभिनव जैविक चिकित्सा, no 17am0301014 के लिए बुनियादी विज्ञान और मंच प्रौद्योगिकी कार्यक्रम, चिकित्सा अनुसंधान और विकास (एमएड) के लिए जापान एजेंसी से, अनुसंधान अनुदान MEXT से आरआईकेईएन केंद्र के लिए जीवन का समर्थन किया था विज्ञान प्रौद्योगिकी और MEXT से आरआईकेईएन आईएमएस के लिए एक अनुसंधान अनुदान । हम पीसी लैब के सदस्यों को धंयवाद और SINEUP नेटवर्क (SISSA, पूर्वी Piedmont और आरआईकेईएन के विश्वविद्यालय) सोचा उत्तेजक विचार विमर्श के लिए । हम ठीक करने के लिए डॉ मैथ्यू वेलेंटाइन धंयवाद ।

Materials

Name Company Catalog Number Comments
Synthetic SINEUP Cell Guidance Systems Ltd. in UK and K.K.DNAFORM in Japan https://www.cellgs.com/items/sineupand8482.html and https://www.dnaform.jp/en/information/20130320 Step 1.5
HEK293T/17 ATCC ATCC CRL-11268 Step 2.1
Falcon Multiwell Plate For Cell Culture 6 well plate Corning 6902A01 Step 2.1
Corning BioCoat Poly-D-Lysine 24 well Plate Corning 08-774-124 Step 2.1
Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific 11668027 Step 2.2
pEGFP-C2 Clontech #6083-1 Step 2.2
Cell Lysis Buffer (10x) Cell Signaling Technology #9803S Step 3.1 This is pre-mixed cell lysis solution.
PMSF Cell Signaling Technology #8553S Step 3.1 To complete cell lysis buffer, add 0.005% (w/v) PMSF to 1x cell lysis buffer.
DC protein assay kit II BIO RAD #5000112JA Step 3.3
10% Mini-PROTEAN TGX Precast Protein Gels, 12-well, 20 µL BIO RAD #4561035 Step 4.2
Amersham Protran Premium NC 0.45 (150 mm×4 m) Amasham 10600013 Step 4.3, This is a 0.45 µm nitrocellulose membrane.
Nonfat Dry Milk Cell Signaling Technology #9999S Step 4.4 A component of the blocking solution.
GFP Tag Antibody Thermo Fisher Scientific A-6455 Step 4.5 Lot number: 1495850, RRID: AB_221570
Monoclonal Anti-β-Actin antibody produced in mouse SIGMA A5441 Step 4.5 Lot number: 026M4780V, RRID: AB_476744
Polyclonal Goat Anti Rabbit Immunoglobulins Dako P0448 Step 4.5 This is secondary antibody conjugating with HRP for anti GFP antibody. Lot number: 20017525, RRID:AB_2617138
Polyclonal Goat Anti mouse Immunoglobulins Dako P0447 Step 4.5 This is secondary antibody conjugating with HRP for anti β-Actin antibody. Lot number: 20019698, RRID:AB_2617137
ECL Western Blotting Detection Reagents Amersham RPN2109 Step 4.9
Maxwell Rapid Sample Concentrator (RSC) Instrument Promega AS4500 Step 5.1 This is commercially available RNA exreaction instrument.
Maxwell RSC simplyRNA Cells Kit Promega AS1390 Step 5.1 This is commercially available RNA exreaction kit.
TURBO DNA-free Kit ambion AM1907 Step 5.2 and 5.4 The kit contains DNase, DNase buffer and inactivation reagent.
PrimeScrip 1st strand cDNA Synthesis Kit TaKaRa 6110A Step 6.1 The kit contains reagents of first strand cDNA synthesis.
TB Green Premix Ex Taq II TaKaRa RR820A Step 6.2
Hoechst3342 Thermo Fisher Scientific H3570 Step 7.2
Celigo S Nexcelom Bioscience 200-BFFL-S Step 7.3 This is a high throughput micro-well image cytometer.

DOWNLOAD MATERIALS LIST

References

  1. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, (5740), 1564-1566 (2005).
  2. Carninci, P., et al. The transcriptional landscape of the mammalian genome. Science. 309, (5740), 1559-1563 (2005).
  3. Hon, C. C., et al. An atlas of human long non-coding RNAs with accurate 5' ends. Nature. 543, (7644), 199-204 (2017).
  4. Tufarelli, C., et al. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nature Genetics. 34, (2), 157-165 (2003).
  5. Yu, W., et al. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature. 451, (7175), 202-206 (2008).
  6. Carninci, P., Hayashizaki, Y. Noncoding RNA transcription beyond annotated genes. Current Opinion in Genetics & Development. 17, (2), 139-144 (2007).
  7. Chu, Y., Yue, X., Younger, S. T., Janowski, B. A., Corey, D. R. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 38, (21), 7736-7748 (2010).
  8. Ha, M., Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology. 15, (8), 509-524 (2014).
  9. Takahashi, H., Carninci, P. Widespread genome transcription: new possibilities for RNA therapies. Biochemical and Biophysical Research Communications. 452, (2), 294-301 (2014).
  10. Lam, J. K. W., Chow, M. Y. T., Zhang, Y., Leung, S. W. S. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy-Nucleic Acids. 4, e252 (2015).
  11. Nishina, K., et al. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nature communications. 6, 7969 (2015).
  12. Carrieri, C., et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 491, (7424), 454-457 (2012).
  13. Schein, A., Zucchelli, S., Kauppinen, S., Gustincich, S., Carninci, P. Identification of antisense long noncoding RNAs that function as SINEUPs in human cells. Scientific Reports. 6, 33605 (2016).
  14. Zucchelli, S., et al. SINEUPs are modular antisense long non-coding RNAs that increase synthesis of target proteins in cells. Frontiers in Cellular Neuroscience. 9, 174 (2015).
  15. Takahashi, H., et al. Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation. PLOS ONE. 13, (2), e0183229 (2018).
  16. Deutschbauer, A. M., et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 169, (4), 1915-1925 (2005).
  17. Indrieri, A., et al. Synthetic long non-coding RNAs [SINEUPs] rescue defective gene expression in vivo. Scientific Reports. 6, 27315 (2016).
  18. Patrucco, L., et al. Engineering mammalian cell factories with SINEUP noncoding RNAs to improve translation of secreted proteins. Gene. (2015).
  19. Sasso, E., et al. A long non-coding SINEUP RNA boosts semi-stable production of fully human monoclonal antibodies in HEK293E cells. MAbs. 1-8 (2018).
  20. Dang, V. T., Kassahn, K. S., Marcos, A. E., Ragan, M. A. Identification of human haploinsufficient genes and their genomic proximity to segmental duplications. European Journal of Human Genetics. 16, (11), 1350-1357 (2008).
  21. Zucchelli, S., Patrucco, L., Persichetti, F., Gustincich, S., Cotella, D. Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs. Computational and Struct Biotechnology Journal. 14, 404-410 (2016).
  22. Hua, Y., et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes & Development. 24, (15), 1634-1644 (2010).
  23. Watts, J. K., Corey, D. R. Silencing disease genes in the laboratory and the clinic. Journal of Pathology. 226, (2), 365-379 (2012).
  24. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  25. Wu, X., et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nature Biotechnology. 32, (7), 670-676 (2014).
  26. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  27. Liu, X., Harada, S. RNA isolation from mammalian samples. Current Protocols in Molecular Biology. Chapter 4 Unit 4.16 (2013).
  28. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  29. Schneider, C. A., Rasband, W. S., Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 9, (7), 671-675 (2012).
  30. Severin, J., et al. Interactive visualization and analysis of large-scale sequencing datasets using ZENBU. Nature Biotechnology. 32, (3), 217-219 (2014).
  31. Yao, Y., et al. RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat. Nucleic Acids Research. 43, (9), e58 (2015).
  32. Savić, N., Schwank, G. Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research. 168, 15-21 (2016).
  33. Long, H., et al. RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy. Biotechnology Letters. (2016).
सेल SINEUP गैर कोडिंग RNAs है कि विशेष रूप से mRNA अनुवाद में वृद्धि कर सकते है आधारित परख
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).More

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter