Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Célula com base em ensaios de SINEUP não-codificante RNAs que especificamente podem melhorar a tradução de mRNA

doi: 10.3791/58627 Published: February 1, 2019
* These authors contributed equally

Summary

SINEUPs são sintéticas antisentido não-codificantes RNAs, que contêm um domínio de ligação (BD) e um domínio efetor (ED) e up-regulam a tradução do mRNA de destino. Aqui, descrevemos os métodos de deteção para SINEUPs em linhas de células cultivadas, análise de sua atividade de tradução-promoção por Western-blot e um alto throughput semi-automático, sistema de imagem.

Abstract

Aprimoramento de proteína-alvo é de importância não só para o estudo de processos biológicos, mas também para aplicações terapêuticas e biotecnológicas. Aqui, apresentamos um método de seletivamente acima-regular a expressão de proteínas de genes desejados em células cultivadas através de antisentido sintético não-codificantes RNAs conhecidos como SINEUPs. Esse controle positivo da expressão do gene é a nível pós-transcricional e exercida por um invertido curto intercalado nuclear elemento (seno) repetir no final do SINEUPs 3ʹ que compreende seu domínio efetor (ED.). SINEUPs, especificamente, pode ligar para qualquer codificantes de proteínas mRNA de escolha através de seu domínio de ligação (BD), uma região concebido para complementar a sequência dentro da região untranslated 5ʹ (UTR 5ʹ) e próximo a iniciar codão do mRNA. SINEUPs de destino específico projetados dessa maneira são transfectadas para culturas de células e proteínas e RNA são extraídos para análises a jusante, geralmente do pós-transfection 24-48 h. Regulação da proteína induzida por SINEUP é detectada pela análise de Western-blot e expressão do RNA é medido usando a transcrição reversa quantitativa em tempo real do PCR. Temos observado que o BD design é fundamental para alcançar o ideal SINEUP de atividade e que testando diferentes tamanhos de BD e posições em relação ao códon de início do alvo que mRNA é recomendado. Portanto, aqui descrevemos um método de imagem da elevado-produção semi automatizado baseado na deteção de fluorescência que pode ser implementada para alvo que mRNA fundidos com a proteína verde fluorescente (GFP). SINEUPs especificamente aumentar tradução níveis fisiológicos normais da célula, sem alterar o nível de transcrição de alvo. Este método tem sido empregado com sucesso um leque de alvos endógenos e exógenos, em uma grande variedade de humanos, mouse e linhas de células de insetos, juntamente com sistemas in vivo. Além disso, SINEUPs têm sido relatados para aumentar a produção de anticorpos e funcionar como um terapêutico contra haploinsufficient genes de RNA. A natureza versátil e modular de SINEUPs faz-lhes uma ferramenta adequada para controle de translação de gene-específico.

Introduction

Na era pós-genómica, muitos insights tem sido adquiridos nas funções reguladoras de gene de não-codificantes transcritos antisentidos devido ao desenvolvimento de tecnologias de sequenciamento de nova geração a1,2,3 e ferramentas de edição de Gene. Esta categoria de transcrições, que anteriormente era considerada como "lixo transcriptional", agora é estabelecida como um jogador-chave do Regulamento genético. Antisentido transcrições são relatadas para modular a cromatina e controle de estabilidade e expressão de seus cognatos codificantes de proteínas sentido mRNA4,5. Na maioria dos casos, este modo de regulamento é negativo e transcrições antisentidas silenciar suas contrapartes de sentido através de interações de RNA-RNA6,7. Este traço de transcritos antisentidos naturais tem sido utilizado para genes downregulate desejado na forma de RNA de interferência sintético pequeno (siRNA), microRNA (miRNA) e antisentido oligos (ASO)8,9,10 ,11 , deixando um vazio tecnológico para alvo de regulação genética.

Um estudo intrigante mudou a perspectiva do campo de RNA antisenso demonstrando que antisentido tempo não-codificantes RNAs (como lncRNAs) dos genes Uchl1 (ubiquitin C-terminal hidrolase L1) e Uxt (transcrição ubiquitously-expresso) regular positivamente a tradução de seu cognato sentido mRNA a nível pós-transcricional em ratos12. 5ʹ final destes como lncRNAs sobrepõe-se com diversas bases da região 5ʹ untranslated (UTR 5ʹ) dos seus transcritos de sentido correspondente, e não-sobreposição 3ʹ final contém uma repetição invertida de um retrotransposon pertencentes a curto intercaladas nuclear família de elemento (SINE). Curiosamente, encontramos que a principal força motriz por trás desta regulação traducional é repetir o seno incorporado e não é limitado ao rato que seno repete apenas. Humano Alu repetição contendo como lncRNAs reforçada também tradução de mRNAs de sentido do alvo, reforçando a ideia de uma classe de romance de seno-driven antisentido reguladora não-codificantes RNAs, apropriadamente chamado SINEUPs13. Estudos recentes mostraram que o potencial de SINEUPs naturais é preservado em SINEUPs sintéticos projetados especificamente alvo vários genes endógenos e exógenos14,15. SINEUPs tem duas características importantes: primeiro o "domínio de ligação" (BD) que geralmente é uma região de fim de 5ʹ complementar à sequência de englobando o principal começar codão de um mRNA codificantes de proteínas e segundo o "domínio efetor" (ED.) como incorpora um invertido a repetição do seno que é um pré-requisito para a função SINEUP14 (Figura 1). SINEUPs podem ser personalizados para projetar um BD direcionamento especificamente um gene de escolha. Então, isso pode ser aproveitado para dissecar a função de um determinado gene envolvido em um caminho biológico, como uma alternativa melhor para uma estratégia de superexpressão de mRNA convencional. Além disso, esta ferramenta versátil pode ser aplicada para aumentar a produção de anticorpos e como uma droga para tratar as doenças causadas por insuficientes dosagens de proteínas funcionais16,17,18, haploinsufficient 19,20,21.

As vantagens da tecnologia SINEUP são múltiplas. Isto não muda a expressão do destino a nível transcricional. BDs mais fornecem especificidade mais a SINEUPs, enquanto não induzindo um dependente do dsRNA stress resposta15. A indução de proteínas é mantida dentro dos limites fisiológicos normais da célula, impedindo qualquer efeito deletério devido a expressão de proteínas aberrantes ou excessivo. SINEUPs são compatíveis com uma grande variedade de rato, humano, e hamster cultivadas linhas celulares, por exemplo, HEK293T/17, HepG2, HeLa, CHO, MN9D e muitos mais12,13,14,15,18 ,19. SINEUPs pode eficientemente alvo genes endógenos, transitoriamente Blumental genes e bandeira-tag ou luciferase-fusão de genes, eliminando a necessidade de anticorpos gene-específico14,18. A análise básica de SINEUP requer cultura celular de rotina, transfecção, eletroforese em gel polyacrylamide do sulfato dodecyl de sódio (SDS-PAGE), instrumentos de reação em cadeia (qRT-PCR) em tempo real quantitativa da transcrição reversa-polymerase e configurações, e experiência pode ser adquirida em um curto espaço de tempo.

Aqui, descrevemos um método para o direcionamento de genes com SINEUPs sintéticos para cima-regular a tradução, um efeito ao contrário de outras tecnologias como RNA de interferência9 e ASO gapmers11,22,23. Um método amplamente utilizado para a ativação do gene do RNA-interativa é clusterizada regularmente intercalada curta palíndromo repetições ativação baseada em (CRISPRa), onde a expressão do gene é disparada no nível transcricional24. Este método, apesar de simples e rápido, requer múltiplos guia único RNAs (sgRNAs) visando o mesmo gene para uma eficiência mais elevada, aumentando assim as chances de ligação o alvo25. Além disso, a enzima chave do sistema de CRISPRa, a proteína cataliticamente morto associado CRISPR 9 (dCas9) tem especificidade de ligação de baixa e sgRNAs como alvo regiões bi-direcional promotor não especìfica podem até-regular nas proximidades de genes25. Por outro lado, SINEUPs ligar para o alvo do mRNA em uma região de ligação única com alta especificidade e não afetam a expressão de genes nas proximidades. Discutimos as etapas básicas envolvidas na concepção SINEUP, transfecção, proteína e análises de expressão de RNA. Além disso, apresentamos um semi-automático, elevado-throughput sistema de imagem para vários SINEUPs de tela de uma vez, que é útil para a deteção de SINEUPs ideais.

Protocol

1. projeto de BDs de SINEUP constrói para alvo mRNAs

  1. Verifica o local de partida de transcrição (TSS) e local de partida tradução de mRNAs alvo nas células de interesse. Adquirir dados de TSS de projetos o ENCODE e o FANTOM (cap análise de expressão gênica, gaiola) (ZENBU: http://fantom.gsc.riken.jp/zenbu/).
  2. Abra o navegador, busca de genes de interesse e verificar TSS por picos de gaiola.
  3. Consulte o exemplo de análise de células e tecidos específicos TSS de Parkinson doença proteína 7 (PARK7) mRNA, mostrado na Figura 2.
  4. Projeto sequências BD de vários comprimentos diferentes, correspondente a 40 bases bases upstream e 32 a jusante da primeira metionina (agosto), 72 nt no total.
  5. Costume encomendar os BDs projetados em vetor de expressão SINEUP (ver Tabela de materiais).
    Nota: Verificar a especificidade de sequência por ferramenta de busca de alinhamento local básico (explosão) para evitar efeitos fora do alvo26.

2. cultura e SINEUP Transfection da pilha

  1. Células de sementes de interesse em uma placa-6 ou 24-placa para 24h antes de Transfeccao de SINEUPs. No caso da linhagem de células de rim humano embrionário (HEK293T/17) (ver Tabela de materiais), sementes de 0,5 x 106 células por alvéolo de um 6-placa ou 1,5 x 105 células por poço de um poli-D-lisina revestido 24-placa (ver Tabela de materiais). Torna-se 70% de confluencia após 24 h.
  2. Após 24h, altere o meio para 1,5 mL de meio fresco para um 6-placa ou 0,4 mL de meio fresco para um 24-placa. Em caso de SINEUP-GFP, transfect 0,6 µ g de pEGFP-C2 (ver Tabela de materiais) e 3,4 µ g de SINEUP-GFP em um poço de um ng-placa ou 130 6 de pEGFP-C2 e 670 ng de SINEUP-GFP em um poço de um 24-placa com reagente de transfeccao (10 µ l em 6 µ-placa e 3 L em 24-placa), seguindo as instruções do fabricante (ver Tabela de materiais) e incubar a 37 ° C numa incubadora de 5% de CO2 por 24 h.
  3. Lavam-se células com 2 mL de solução salina de tampão de fosfato (PBS) (37 mM NaCl, 8mm Na2HPO4, 2,6 mM KCl e 1,5 mM KH2PO4) em cada poço de um 6-placa ou 0,5 mL de PBS em cada poço de uma 24-placa. Somente para poli-D-lisina revestido 24-placa, adicione 25 µ l de 0.05% peso por volume tripsina, incubar numa incubadora 5% CO2 por 5 min e adicione 275 µ l de meio celular por bem. No caso de placa de-6, adicione 2 mL de PBS em cada poço. Pipeta de cima e para baixo para a colheita de células (1,5 mL para um 6-placa) ou 225 µ l para um 24-placa de 1 bem para extração de proteínas (ir para 3 de protocolo para a extração da proteína) de 3/4 e 1/4 das células (0,5 mL para um 6-placa) ou 75 µ l para um 24-placa para Extração do RNA e centrifugar 6.000 x g por 5 min a 4 ° C (vá para a etapa 5 para extração de RNA).
    Nota: Analise o efeito da SINEUP-GFP em um poli-D-lisina revestido 24-placa por imagem. Vá para a etapa 7 (análise de imagem).

3. extração de proteínas

  1. Cuidadosamente Aspire 1,5 mL de PBS e adicionar 140 µ l de solução de lise (20 mM Tris-HCl (pH 7,5), 150 mM de NaCl, 1 mM EDTA de at2, 1mm EGTA, 1% (p/v) Triton, pirofosfato de sódio 2,5 mM, β-glicerofosfato de 1 mM, 1 mM at3VO4 1 μg/mL leupeptin e fluoreto de phenylmethylsulfonyl de 0,005% (p/v) (PMSF)) (ver Tabela de materiais) para um 6-placa ou 60 µ l para um 24-placa para as pelotas de célula.
  2. Misture por pipetagem e homogeneiza girando a velocidade lenta durante 1 h a 4 ° C. Recolher o sobrenadante por centrifugação a 14.000 x g durante 10 minutos a 4 ° C.
  3. Verificar a concentração de proteína por ensaio colorimétrico (ver tabela de materiais). Prepare todas as reações à temperatura ambiente.
    1. Preparar a diluição de 5 - 6 vezes de proteína albumina de soro bovino (BSA) padrão em água ultrapura com concentrações variando de 0,2-1,5 mg/proteína mL. Prepare normas frescas cada vez.
    2. Prepare o reagente de trabalho ά misturando-se 1 mL do reagente (uma solução de tartarato de cobre alcalino) com 20 µ l de reagente S (solução de surfactante).
    3. Carrega 5 µ l de água (controle negativo), padrão de BSA (controle de proteína padrão e positivo) ou amostra de proteína em cada poço de 96-bem-placa.
    4. Adicione 25 µ l de reagente ά em cada poço. Cuidadosamente, adicione 200 µ l de Reagente B (Reagente de Folin) por bem, evitando qualquer formação de bolhas. Cubra o prato com papel alumínio e espere por 5-10 min.
    5. Medir a absorvância de proteína em 750 nm com um espectrofotômetro. A absorvância é estável pelo menos 1 h.
    6. Prepare a curva padrão, plotagem concentrações de proteína padrão de BSA (mg/mL) no eixo x e seu respectiva absorvância no eixo y. Calcule a concentração de proteína de amostra, aplicando a equação da curva padrão.
      Nota: Pausar o protocolo a este passo, se necessário, ou vá para a etapa 4. Para armazenamento a longo prazo, snap congelar amostras da proteína em nitrogênio líquido e loja a-80 ° C.

4. proteína separação por SDS-PAGE e detecção de proteínas alvo com anticorpos (análise de Western-blot)

  1. Adicionar um volume de 2 x tintura de carregamento (0.1 M Tris-HCl (pH 6,8), SDS de 4%, 20% de glicerol, 1,42% 2-mercaptethanol e bromofenol 0,2%) para cada volume da amostra de proteína da etapa 3.3. Aqueça a 90 ° C por 5 min e arrefecer imediatamente no gelo por 1 min.
  2. Carga de 10-20 µ g de amostras de proteína a 10% gel de poli-acrilamida SDS e separar em 100-150 V) (ver Tabela de materiais).
  3. Proteína de transferência de gel para membrana de nitrocelulose de 0,45 µm (ver Tabela de materiais) por instrumento de transferência semi-seco com buffer de transferência (25 mM Tris, 192mm glicina e 20% metanol) a 25 V por 30 min.
  4. Adicionar a solução de bloqueio (5% leite desnatado no 1 x TBST buffer (137 mM NaCl, 20 mM Tris-HCl (pH 7,6), 0.1% Tween-20)) (ver Tabela de materiais) para o recipiente até a membrana está completamente encharcada e incube-lo em temperatura ambiente por 30 min.
  5. No caso de SINEUP-GFP, cruzar a proteína com anticorpo anti-GFP (diluído 1: 2000 em solução de bloqueio) (ver Tabela de materiais) incubando a membrana por 30 min com agitação à temperatura ambiente. Como uma proteína de controle interno, detectar a proteína β-actina por cruzamento com anticorpo Anti-β-actina (diluído 1: 2000 em solução de bloqueio) (ver Tabela de materiais) por 30 min com agitação à temperatura ambiente.
  6. Adicione 1 buffer de x TBST para o recipiente até que a membrana está completamente encharcada e lave por 5 min à temperatura ambiente. Repita a etapa de lavagem duas mais vezes (um total de três lavagens).
  7. Cruzar a proteína GFP diluído 1 (: 1000 em solução de bloqueio) anticoelho anticorpo conjugado com peroxidase de rábano (HRP) e cruzar a proteína β-actina para diluído (1: 1000 em solução de bloqueio) Anticorpo de anti-rato conjugado com HRP na membrana por 30 min com agitação à temperatura ambiente.
  8. Lave a membrana com 1 buffer de x TBST por 5 min à temperatura ambiente. Repita a etapa de lavagem duas mais vezes (um total de três lavagens).
  9. Misturar com igual volume de reagente de detecção de quimioluminescência HRP-avançado (ECL) 1 e 2 (ver Tabela de materiais). Transferir a membrana para mistura de Reagente 2 mL ECL, cubra a caixa com papel alumínio e deixe incubar durante 1-2 min à temperatura ambiente. Cuidadosamente retire a membrana da mistura de reagente ECL e expor usando uma instrumento de imagem de luminescência.

5. RNA extração e tratamento de DNase

  1. Extrato total do RNA a seguir o padrão de protocolo para a extração de RNA de células cultivadas em uma monocamada27 ou alternativamente, usar uma extração de RNA comercialmente disponível kit (veja a Tabela de materiais). Para o estado, em breve, adicionar qualquer reagente de Lise monofásico (MLR) de isotiocianato de guanidina e fenol para as células colhidas na etapa 2.3 (1ml MLR por 5 milhões de células)27.
    Nota: Luvas mudam com frequência. Usar reagentes RNase-livre e diethylpyrocarbonate (DEPC)-Tratado de utensílios de plástico e copos para prevenir a degradação de RNA. Pause o protocolo a este passo, se necessário. Loja extraído do RNA a-80 ° C.
  2. Adicione 0,1 volume de 10x buffer de DNase e 2 U de DNase para o RNA purificado da etapa 5.1 (ver Tabela de materiais).
  3. Definir o volume de reação de 50 µ l com água livre de nuclease e misture delicadamente. Incube a 37 ° C por 30 min.
  4. Adicione 0,1 volume de reagente de inactivação de DNase re-suspensa e misture bem (ver Tabela de materiais). Incube durante 5 min à temperatura ambiente com agitação suave.
  5. Centrifugar a 10.000 x g durante 90 s. transferência do sobrenadante (livre de DNA RNA) para um tubo de 1,5 mL RNase-livre fresco. Tenha cuidado para não tocar a pelota, pois isso pode causar ao reporte de DNase que é incômodo para as etapas a jusante.
  6. Dosar o RNA medindo260 e um rácio de280 260/A (para o RNA puro, o intervalo é de 1.8-2.0) em um espectrofotômetro UV.

6. primeira cDNA da costa síntese e análise de qRT-PCR

  1. Realize a primeira síntese de cDNA de costa, seguindo um protocolo de síntese de cDNA padrão como abaixo (veja tabela de materiais).
    1. Mistura da primeira demão dT de oligo de 0,75 µM, 4,3 cartilha aleatório µM, dNTPs (10 mM cada) com 200-500 ng RNA total (das etapas 5-8) em 10 µ l de volume total de reação. Incubar a 65 ° C por 5 min e em seguida, colocar imediatamente no gelo.
    2. Misture 1 buffer de transcriptase reversa de x, 1 inibidor de U de RNase, 10 U de transcriptase reversa e adicionar 10 µ l de mistura de RNA-primer de 6.1.1.
    3. Defina o volume de reação total a 20 µ l com água livre de nuclease, se necessário. Misture delicadamente e incubar a mistura de reação, a 30 ° C por 10 min, em seguida, a 42 ° C por 60 min e finalmente a 95 ° C por 5 min inativar a enzima. Legal os tubos em gelo.
      Nota: Descongelação de amostras do RNA e todos os reagentes no gelo e preparar a mistura de reação no gelo. Se alvo RNAs são apenas polyA RNAs, use oligo dT primeira demão apenas (2,5 µM). Pause o protocolo se necessário. Armazenar o cDNA sintetizado a-20 ° C.
  2. Executar qRT-PCR em técnica triplica (n = 3, Cт desvio padrão > 0.2) e dentro de réplicas biológicas (n ≥ 3) usando 1 µ l de 10 ng de cDNA, 0,4 µ l de primer reverso (10 µM), 0,4 µ l de primer para a frente (10 µM), 10 µ l de solução de mistura de DNA polimerase , 0,4 µ l de DNA dobro-costa coloração tintura, 10 µ l de água livre de nuclease (volume de reação foi de 20 µ l) para detectar os produtos de PCR usando a seguir condições; Segure o palco (1 ciclo) por 30 s a 95 ° C, ciclismo palco (40 ciclos) para 5 s a 95 ° C e 30 s a 60 ° C, derreter o estágio da curva. São exemplos de cartilha para humano Gapdh_Fw: TCTCTGCTCCTCCTGTTC, Gapdh_Rv humano: GCCCAATACGACCAAATCC, EGFP_Fw: GCCCGACAACCACTACCTGAG, EGFP_Rv: CGGCGGTCACGAACTCCAG, SINEUP-GFP_Fw: CTGGTGTGTATTATCTCTTATG e SINEUP-GFP_Rv: CTCCCGAGTCTCTGTAGC. Consulte tabela de materiais. Analise a expressão de RNA quantitativo com 2- ∆∆Ct ± SD método28.

7. análise de SINEUPs pelo método de detecção semi automática de imagem

  1. Lavam-se células com 0,5 mL de PBS para um poço de um 24-placa.
  2. Adicionar 2.0 μg de Hoechst 33342 (ver Tabela de materiais) (dissolução em 500 µ l de PBS) para cada um bem da 24-bem-placa e incubar as células a 37 ° C por 20 min manchar o núcleo.
  3. Medida Hoechst manchado células para contar o número total de células em um máximo de emissão azul de 461 nm e intensidade de fluorescência verde, para contar o número de células positivas de GFP em um máximo de emissão verde de 510 nm, usando uma imagem de micropoço de alta produtividade (de citômetro consulte Tabela de materiais). Analise o efeito acima-regulamentar proteína as SINEUPs, calculando a intensidade GFP integrado, que é a soma de todas as intensidades de pixel exibir sinal em objetos segmentados, calculados para cada canal, usando o software de imagem29.
  4. Colheita de células para verificar a expressão de RNA (volta para as etapas 5 e 6).

Representative Results

SINEUP-GFP é um SINEUP sintético contendo ambos uma óptima BD (-28 / + 4 se sobrepõem a GFP mRNA) e um ED (invertido seno B2 das -Uchl1) que pode até-regular tradução mRNA GFP (Figura 3A e 3B) sem alterar a expressão de GFP mRNA (Figura 3 e 3D). Para tela ideal BDs e EDs para SINEUPs, nós desenvolvemos um protocolo de análise de imagem semi-automático que melhorou o tempo de detecção e aumentou o número de amostras, sendo exibido simultaneamente em comparação com um convencional de análise de Western-blot15. Como mostrado na Figura 4, este sistema da imagem latente de alta produtividade levou 3 dias (Western-blot análise levou 2 semanas para 48 SINEUPs). Tendo demonstrado que SINEUP-GFP aumenta a tradução de GFP, detectamos intensidade GFP integrado pelo citômetro de imagem. A melhor BD de SINEUP-GFP induzido um 1.4-fold aumento na expressão de proteína GFP. Embora observamos compressão de sinais de 2.6-fold (análise de Western-blot, ver Figura 3A) para 1.4-fold (Imaging análise, ver Figura 5), a diferença pode ser devido a calibragem do software da imagem latente do instrumento. No entanto, detectamos níveis significativamente mais elevados de fluorescência de GFP, comparado com o controle (Figura 5A e 5B).

Figure 1
Figura 1: desenho básico dos sintéticos SINEUPs. BD = domínio de ligação para o destino do mRNA, ED = domínio efetor que contem uma sequência de seno invertida. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2: Transcrição iniciando sites (TSSs) da proteína de doença de Parkinson humana 7 (PARK7) mRNA em tecidos específicos e células detectadas por análise gaiola. (A) A instantâneo mostrando um resultado de pesquisa de TSS para humano PARK7 mRNA usando um omics integração de dados e visualização interativa sistema30. O Arqueiro Verde horizontal na faixa de hg19 do gene de Entrez indica a posição de genômica da referência humana PARK7 de mRNA e as barras verticais verdes no FANTOM5 CAGE 1 e 2 faixas indicam a soma de TSSs (medido como transcrições por milhão (tpm)) de 1.829 tipos de tecidos e células. (B) Zoom na região marcado no painel A TSS (escala 1/354: 35,4 kb-100 bp). Cinza sombreado área na fase FANTOM5 gaiola faixas 1 e 2 indica o TSS de 6 células específicas fora o total 1.829, que são listados na parte inferior da figura. Os números (11.369, 4.998, 4.304, 3.509, 3.477 e 3.055) correspondente a estas células listadas indicam transcrições por milhão para cada célula específica em cinza sombreado posições de TSS. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: análise de Western-blot, confirmando a regulação de tradução por SINEUP-GFP. (A) SINEUP-GFP foi examinado por Western-blot com anticorpo anti-GFP. (B) resultados foram normalizados para a intensidade da banda proteína β-actina. (C) mRNA GFP e expressão de RNAs de SINEUP (D) foram detectados por qRT-PCR. p < 0,0005, n = 3, teste t de student bicaudal, barras de erro são o desvio-padrão. Esta figura foi modificada de Takahashi et al.15. Clique aqui para ver uma versão maior desta figura.

Figure 4
Figura 4: esquemático da análise de imagem semi-automático de SINEUP. Dia 1: Sementes de células de interesse em uma placa-24. Dia 2: Transfect GFP e SINEUP-GFP. Dia 3: Analise o efeito da SINEUPs medindo intensidade GFP integrado. Clique aqui para ver uma versão maior desta figura.

Figure 5
Figura 5: análise do elevado-throughput de regulação Tradução por SINEUP-GFP. (A) comparação da fluorescência de GFP entre controle e SINEUP-GFP transfectada células15. Barra de escala = 2 mm. (B) GFP intensidade integrada foi normalizada para o número total de células contado pela coloração nuclear com Hoechst 33342. p < 0,0005, n = 3, teste t de student bicaudal, barras de erro são o desvio-padrão. FOV: campo de visão. Esta figura foi modificada de Takahashi et al.15. Clique aqui para ver uma versão maior desta figura.

Discussion

Descrevemos aqui um protocolo para especificamente aumentar a produção de proteína de um alvo do mRNA, por meio de um seno contendo não-codificantes do RNA, chamado SINEUPs. Como um exemplo representativo, ideal SINEUP sintético-GFP é mostrado acima-a tradução de mRNA GFP 2.6-fold medida pelo Western-blot análise regular.

Projetar um BD ideal é crucial para assegurar a especificidade SINEUP e potência (medida de regulação da proteína). Anteriormente, nós selecionados BDs 17 de SINEUP-GFP por Western-blot análise15 e encontrou que o BD ideal sobrepõe-se a sequência de KOZAK-AUG do RNAm GFP, embora ele pode não ser o caso com outros mRNAs e deve ser verificado para cada caso. Outro grupo independente também projectado a BD usando um método diferente de31. Como muitos BDs de triagem pode ser bastante demorado e complicado, apresentamos aqui um método de deteção da elevado-produção SINEUP. Este método mede relativas mudanças na densidade GFP integrado em SINEUP transfectadas-células em comparação com as controle vetorial transfectadas-células. Para garantir que as células em um bem particular de uma placa de cultura são transfectadas igualmente e sinal GFP não está concentrado apenas uma determinada região do poço, é muito importante distribuir as células igualmente nos poços no passo 2.1. Para essa finalidade, homogeneizar a placa 10 vezes para frente e para trás (↑↓) após a semeadura as células dentro de uma bancada limpa e repita na incubadora 5% CO2 antes de iniciar a incubação.

Outro passo crítico é o cálculo da concentração de proteína na etapa 3.3. O carregamento de uma quantidade errônea de proteína durante a análise de Western-blot, consequentemente impedindo a deteção de pequenas mudanças na expressão da proteína por alguns dos SINEUPs fracos ou gerar falsos positivos de sobrecarga podem causar erros de cálculo aqui. Recomenda-se recentemente preparar a curva padrão de proteínas todas as vezes, certificando-se que quantidades iguais de padrões e amostras da proteína são medidas na etapa 3.3.3. O protocolo descrito aqui centra-se na SINEUP-GFP, mas análise de Western-blot pode ser usado para qualquer alvo mRNA do interesse. O tempo de incubação e a concentração de anticorpos devem ser otimizadas para cada alvo obter o melhor resultado.

Uma das características únicas do SINEUPs é que o nível de expressão do mRNA do alvo permanece inalterado. É importante tratar de RNA com DNase para evitar a detecção de SINEUPs transfectadas e DNA genômico por qRT-PCR. RNAs SINEUP e expressão de RNAm de destino devem ser medidos por qRT-PCR para confirmar o sucesso de transfecção e atividade SINEUP. SINEUPs contém uma sequência de seno, que é abundante ao longo de ambos os humanos e genomas de rato. Para evitar específico detecção de sequências de seno, não é recomendável para projetar primers de qRT-PCR para a sequência de seno.

Neste protocolo usamos linhas de células humanas, mas SINEUPs são eficazes em um número de linhas celulares de várias espécies diferentes de12,13,14,18,19. As condições de cultura e transfecção de células podem ser modificadas conforme linhas celulares diferentes, desde que estes mantêm a transfeccao eficiência dos vetores SINEUP. Além disso, os métodos alternativos de extração do RNA, síntese do cDNA e verificação da concentração de proteína podem ser empregados, dado que preservam a qualidade do RNA e proteína requerida por qRT-PCR e análise de Western-blot. Enquanto nós usamos um citômetro de microbem alto rendimento específico, que permitiu a deteção da fluorescência de GFP em todo o poço inteiro, outros cytometers com uma escala da deteção similar pode ser usado31. É de notar que se a distribuição das células e do transfection é igual ao longo de um poço, então isso não é necessário digitalizar o poço inteiro para fluorescência de GFP: metade ou um quarto da área do poço pode ser suficiente para discernir o efeito SINEUP, dependendo da experiência habilidades de Al.

Estabelecer um protocolo de deteção de SINEUP de alto rendimento permite a seleção simultânea de múltiplos BDs como alvo um determinado mRNA em pilhas cultivadas. Isto é importante porque as regras que regem a ótima definião do BD não são ainda claras. Tal sistema de triagem um multiplex permite para testes em larga escala de muitos SINEUPs contra diferentes genes, útil para o direcionamento de múltiplos genes envolvidos em uma via de sinalização específica, por exemplo. Além disso, pode ser utilizada para expandir a busca por SINEUPs eficazes direcionamento de vários mRNAs, projetar diferentes BDs SINEUP AUG-Kozak região (ver Figura 1), co transfecting comprimento total alvo mRNAs (5ʹ 3ʹ-UTR-CDS UTR) fundidos com GFP mRNA em culturas de células para encontrar o SINEUPs ideais e posteriormente testes candidatos BD contra mRNA endógeno em pilhas cultivadas e modelo vivo em animais, de humanos e ratos para outras espécies animais e vegetais.

Este protocolo de triagem é muito rápido. Não precisamos corrigir e recolher pilhas, mas só precisa colocar o vivo celular placa de cultura no instrumento de imagem. Propomos a usar este protocolo de triagem de alto rendimento para selecionar BDs ideal de SINEUPs e avaliar potenciais candidatos pela análise do Western-blot. Assim, os candidatos seleccionados com BDs ideais podem ser aplicados para aumentar a produção de anticorpos a18,19,21. Atualmente, o campo terapêutico RNA dramaticamente está crescendo. Por exemplo, siRNA, ASO, mRNA e terapias CRISPR RNA, são amplamente empregadas para controlar a expressão de RNAm de seus respectivos alvos9,32. Neste contexto, SINEUPs está em sua infância, mas até agora nenhum dos SINEUPs estudados alterado expressão de mRNAs de alvo. Além disso, SINEUPs não edite mRNA como alvo, mas só até-regular tradução do mRNA. Além disso, perda--função de doenças resultantes de haploinsuficiência podem ser alvo de terapia SINEUP, alcançar uma indução 2 vezes do proteína deficiente17,33. Embora o alvo efeitos precisam ser mais estudados, SINEUPs potencialmente e especificamente alvo um mRNA única, expressa com uma sequência complementar para o BD.

Uma limitação do presente protocolo de alto rendimento é que não é apropriado para tela BDs de SINEUPs em modelos in vivo de rato porque as medidas de protocolo a GFP integrado intensidade somente. Como SINEUPs lncRNAs antisentido natural que atuam post-transcriptionally, eles não podem ser aplicados quando o alvo mRNA está ausente nas células ou amostras de tecido.

No entanto, SINEUPs podem ser aplicados aos estudos de ganho-de-função, aumentar a produção de anticorpos e como uma terapia de RNA para cima-regulam a expressão de proteínas deficientes dentro do intervalo de 1.5-3.0-fold. Os métodos descritos aqui apresentam um guia útil para alvejar e detectar realce induzida por SINEUP tradução do mRNA desejado e fornecer uma nova ferramenta para regulação gênica pós-transcricional.

Disclosures

O autor correspondente Piero Carninci é um dos fundadores da TransSINE Technologies Co. Ltd. que detém a propriedade intelectual na patente arquivado (EP2691522A4 e JP2017169573A) e concedida patente (US9353370B2) para a tecnologia SINEUP.

Acknowledgments

Este estudo foi parcialmente suportado pelo programa de plataforma de tecnologia e ciência básica para medicina biológica inovadora, n º 17 sou 0301014, da Agência de investigação médica e desenvolvimento (AMED), bolsa de pesquisa do MEXT do centro RIKEN para vida de Japão Tecnologias da ciência e uma bolsa de investigação do MEXT para o IMS RIKEN. Agradecemos a membros do laboratório de PC e da rede SINEUP (SISSA, Universidade de Piemonte Oriental e RIKEN) para discussões instigantes. Agradecemos o Dr. Matthew Valentine para revisão.

Materials

Name Company Catalog Number Comments
Synthetic SINEUP Cell Guidance Systems Ltd. in UK and K.K.DNAFORM in Japan https://www.cellgs.com/items/sineupand8482.html and https://www.dnaform.jp/en/information/20130320 Step 1.5
HEK293T/17 ATCC ATCC CRL-11268 Step 2.1
Falcon Multiwell Plate For Cell Culture 6 well plate Corning 6902A01 Step 2.1
Corning BioCoat Poly-D-Lysine 24 well Plate Corning 08-774-124 Step 2.1
Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific 11668027 Step 2.2
pEGFP-C2 Clontech #6083-1 Step 2.2
Cell Lysis Buffer (10x) Cell Signaling Technology #9803S Step 3.1 This is pre-mixed cell lysis solution.
PMSF Cell Signaling Technology #8553S Step 3.1 To complete cell lysis buffer, add 0.005% (w/v) PMSF to 1x cell lysis buffer.
DC protein assay kit II BIO RAD #5000112JA Step 3.3
10% Mini-PROTEAN TGX Precast Protein Gels, 12-well, 20 µL BIO RAD #4561035 Step 4.2
Amersham Protran Premium NC 0.45 (150 mm×4 m) Amasham 10600013 Step 4.3, This is a 0.45 µm nitrocellulose membrane.
Nonfat Dry Milk Cell Signaling Technology #9999S Step 4.4 A component of the blocking solution.
GFP Tag Antibody Thermo Fisher Scientific A-6455 Step 4.5 Lot number: 1495850, RRID: AB_221570
Monoclonal Anti-β-Actin antibody produced in mouse SIGMA A5441 Step 4.5 Lot number: 026M4780V, RRID: AB_476744
Polyclonal Goat Anti Rabbit Immunoglobulins Dako P0448 Step 4.5 This is secondary antibody conjugating with HRP for anti GFP antibody. Lot number: 20017525, RRID:AB_2617138
Polyclonal Goat Anti mouse Immunoglobulins Dako P0447 Step 4.5 This is secondary antibody conjugating with HRP for anti β-Actin antibody. Lot number: 20019698, RRID:AB_2617137
ECL Western Blotting Detection Reagents Amersham RPN2109 Step 4.9
Maxwell Rapid Sample Concentrator (RSC) Instrument Promega AS4500 Step 5.1 This is commercially available RNA exreaction instrument.
Maxwell RSC simplyRNA Cells Kit Promega AS1390 Step 5.1 This is commercially available RNA exreaction kit.
TURBO DNA-free Kit ambion AM1907 Step 5.2 and 5.4 The kit contains DNase, DNase buffer and inactivation reagent.
PrimeScrip 1st strand cDNA Synthesis Kit TaKaRa 6110A Step 6.1 The kit contains reagents of first strand cDNA synthesis.
TB Green Premix Ex Taq II TaKaRa RR820A Step 6.2
Hoechst3342 Thermo Fisher Scientific H3570 Step 7.2
Celigo S Nexcelom Bioscience 200-BFFL-S Step 7.3 This is a high throughput micro-well image cytometer.

DOWNLOAD MATERIALS LIST

References

  1. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, (5740), 1564-1566 (2005).
  2. Carninci, P., et al. The transcriptional landscape of the mammalian genome. Science. 309, (5740), 1559-1563 (2005).
  3. Hon, C. C., et al. An atlas of human long non-coding RNAs with accurate 5' ends. Nature. 543, (7644), 199-204 (2017).
  4. Tufarelli, C., et al. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nature Genetics. 34, (2), 157-165 (2003).
  5. Yu, W., et al. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature. 451, (7175), 202-206 (2008).
  6. Carninci, P., Hayashizaki, Y. Noncoding RNA transcription beyond annotated genes. Current Opinion in Genetics & Development. 17, (2), 139-144 (2007).
  7. Chu, Y., Yue, X., Younger, S. T., Janowski, B. A., Corey, D. R. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 38, (21), 7736-7748 (2010).
  8. Ha, M., Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology. 15, (8), 509-524 (2014).
  9. Takahashi, H., Carninci, P. Widespread genome transcription: new possibilities for RNA therapies. Biochemical and Biophysical Research Communications. 452, (2), 294-301 (2014).
  10. Lam, J. K. W., Chow, M. Y. T., Zhang, Y., Leung, S. W. S. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy-Nucleic Acids. 4, e252 (2015).
  11. Nishina, K., et al. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nature communications. 6, 7969 (2015).
  12. Carrieri, C., et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 491, (7424), 454-457 (2012).
  13. Schein, A., Zucchelli, S., Kauppinen, S., Gustincich, S., Carninci, P. Identification of antisense long noncoding RNAs that function as SINEUPs in human cells. Scientific Reports. 6, 33605 (2016).
  14. Zucchelli, S., et al. SINEUPs are modular antisense long non-coding RNAs that increase synthesis of target proteins in cells. Frontiers in Cellular Neuroscience. 9, 174 (2015).
  15. Takahashi, H., et al. Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation. PLOS ONE. 13, (2), e0183229 (2018).
  16. Deutschbauer, A. M., et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 169, (4), 1915-1925 (2005).
  17. Indrieri, A., et al. Synthetic long non-coding RNAs [SINEUPs] rescue defective gene expression in vivo. Scientific Reports. 6, 27315 (2016).
  18. Patrucco, L., et al. Engineering mammalian cell factories with SINEUP noncoding RNAs to improve translation of secreted proteins. Gene. (2015).
  19. Sasso, E., et al. A long non-coding SINEUP RNA boosts semi-stable production of fully human monoclonal antibodies in HEK293E cells. MAbs. 1-8 (2018).
  20. Dang, V. T., Kassahn, K. S., Marcos, A. E., Ragan, M. A. Identification of human haploinsufficient genes and their genomic proximity to segmental duplications. European Journal of Human Genetics. 16, (11), 1350-1357 (2008).
  21. Zucchelli, S., Patrucco, L., Persichetti, F., Gustincich, S., Cotella, D. Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs. Computational and Struct Biotechnology Journal. 14, 404-410 (2016).
  22. Hua, Y., et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes & Development. 24, (15), 1634-1644 (2010).
  23. Watts, J. K., Corey, D. R. Silencing disease genes in the laboratory and the clinic. Journal of Pathology. 226, (2), 365-379 (2012).
  24. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  25. Wu, X., et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nature Biotechnology. 32, (7), 670-676 (2014).
  26. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  27. Liu, X., Harada, S. RNA isolation from mammalian samples. Current Protocols in Molecular Biology. Chapter 4 Unit 4.16 (2013).
  28. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  29. Schneider, C. A., Rasband, W. S., Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 9, (7), 671-675 (2012).
  30. Severin, J., et al. Interactive visualization and analysis of large-scale sequencing datasets using ZENBU. Nature Biotechnology. 32, (3), 217-219 (2014).
  31. Yao, Y., et al. RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat. Nucleic Acids Research. 43, (9), e58 (2015).
  32. Savić, N., Schwank, G. Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research. 168, 15-21 (2016).
  33. Long, H., et al. RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy. Biotechnology Letters. (2016).
Célula com base em ensaios de SINEUP não-codificante RNAs que especificamente podem melhorar a tradução de mRNA
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).More

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter