Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Özellikle mRNA çeviri geliştirebilirsiniz RNA'ların kodlamayan SINEUP deneyleri bağlı hücre

doi: 10.3791/58627 Published: February 1, 2019
* These authors contributed equally

Summary

SINEUPs çoğu sentetik antianlamlı kodlamayan RNA'ların bir bağlayıcı etki (BD) ve bir efektör etki alanı (ED) içerir ve yukarı düzenleyen-çeviri hedef mRNA. Burada, biz algılama yöntemleri için SINEUPs kültürlü hücre hatları, çeviri teşvik faaliyetlerini Western-blot ve görüntüleme sistemi yarı otomatik yüksek üretilen iş analizini açıklanmaktadır.

Abstract

Hedef-protein geliştirme sadece biyolojik süreçlerin çalışma için aynı zamanda tedavi ve biyoteknolojik uygulamaları için önem taşımaktadır. Burada, seçmeli olarak up-protein ifade kültürlü hücrelerdeki istenen genlerin sentetik antisens RNA'ların SINEUPs bilinen kodlamayan aracılığıyla düzenlemek için bir yöntem mevcut. Gen ifadesinin olumlu bu kontrolünü çoğu düzeyde ve bir ters kısa serpiştirilmiş nükleer öğe (sinüs) SINEUPs 3ʹ sonunda tekrar sarf efektör etki (ED) oluşur. SINEUPs özel olarak herhangi bir protein kodlayıcı mRNA tercih onun bağlayıcı etki (BD), sıra 5ʹ çevrilmeyen bölgesi (5ʹ UTR) içinde ve çevresinde mRNA başlama kodonu tamamlamak üzere tasarlanmış bir bölge üzerinden bağlayabilirsiniz. Bu şekilde tasarlanmış hedef özgü SINEUPs kültürlü hücrelere transfected ve protein ve RNA aşağı akım analizleri için genellikle 24-48 h sonrası transfection ayıklanır. SINEUP kaynaklı protein up-yönetmelik Western-blot Analizi tarafından algılanır ve RNA ifade gerçek zamanlı nicel Ters transkripsiyon PCR ölçülür. BD tasarımı optimum SINEUP etkinlik ve test farklı BD boyut ve başlama kodonu ile ilgili konumlarını mRNA önerilir hedef ulaşmak için kritik olduğunu gözlemledim. Bu nedenle, biz burada mRNA yeşil flüoresan protein (GFP) ile erimiş hedef için uygulanabilir floresans algılama esas alarak yarı otomatik yüksek üretilen iş görüntüleme yöntemini açıklar. SINEUPs özellikle hedef transkript düzeyini değiştirmeden hücrenin normal fizyolojik sınırlarda çeviri geliştirmek. Bu yöntem başarıyla endojen ve eksojen hedefleri, çok çeşitli insan, fare ve böcek hücre hatları ile birlikte içinde vivo sistemleri bir dizi karşı istihdam edilmiştir. Ayrıca, SINEUPs antikor üretimi artırmak ve bir RNA haploinsufficient genler karşı tedavi edici olarak bildirilmiştir. SINEUPs çok yönlü ve modüler yapısı onları gene özgü translasyonel denetim için uygun bir araç yapar.

Introduction

Sonrası genomik dönemde birçok anlayışlar kodlamayan antianlamlı transkript yeni nesil sıralama teknolojileri1,2,3 gelişimi sayesinde gen düzenleyici rolleri içine elde edilmiştir ve gen düzenleme araçları. Daha önce "transkripsiyon çöp" olarak kabul edildi, transkript, bu kategorideki Şimdi genetik düzenleme önemli bir oyuncu kurulur. Antianlamlı transkript kromatin ve denetim istikrar ve ifade onların soydaş protein kodlayıcı anlamda mRNA4,5modüle bildirilmiştir. Çoğu durumda, bu Yönetmeliğin negatif modudur ve antianlamlı transkript anlamda karşılıkları ile RNA, RNA-RNA etkileşimleri6,7sessizlik. Doğal antianlamlı transkript bu özelliği istenen tümleyici genlerle sentetik küçük müdahale RNA (siRNA), mikroRNA (miRNA) ve antianlamlı oligos (ASO)8,9,10 şeklinde kullanıldığında vardır ,11 için teknolojik bir boşluk bırakarak hedef gen up-düzenlemesi.

Bir ilgi çekici çalışma uzun RNA'ların kodlamayan o antisens göstererek antianlamlı RNA alan bakış değişti (lncRNAs) olarak Uchl1 (C-terminal Ubikuitin hidrolaz L1) ve Uxt (ubiquitously ifade transkript) gen olumlu onların konağımız tercümesi düzenleyen mRNA fareler12çoğu aşamalarda hissediyorum. Bunlar 5ʹ sonu lncRNAs 5ʹ çevrilmeyen bölgesi (5ʹ UTR) karşılık gelen kendi anlamda transkript birçok üsleri ile çakışıyor ve üst üste 3ʹ sonu için kısa ait bir retrotransposon ters bir tekrarı içerir gibi nükleer serpiştirilmiş öğe (sinüs) aile. İlginçtir, bu translasyonel up-yönetmelik arkasındaki ana itici güç katıştırılmış sinüs tekrarlayın ve sinüs yalnızca yinelenen denetim fare için sınırlı değildir olduğunu fark ettik. LncRNAs da hedef anlamda mRNA'ların, çeviri gelişmiş insan Alu tekrar-içeren Düzenleyici antisens sinüs temelli olmayan kodlama-RNA'ların, yeni bir sınıf fikir takviye uygun şekilde SINEUPs13adli aynı derecede. Son yıllarda yapılan çalışmalarda gösterdi çeşitli endojen ve eksojen genler doğal SINEUPs potansiyelini sentetik SINEUPs hedef için özel olarak tasarlanmış içinde korunmuş14,15. SINEUPs iki önemli özelliği var: ilk "bağlayıcı etki" (BD) genellikle 5ʹ sonunda bölgenin birincil kapsayan sıra tamamlayıcı olduğu kodon protein kodlayıcı mRNA başlatın ve "efektör etki alanı" ikinci (ED) o birleştirmek gibi bir SINEUP işlevi14 (Şekil 1) için bir önkoşuldur sinüs tekrarı ters. SINEUPs özellikle hedef seçtikleri bir gen bir BD tasarlamak için özelleştirilebilir. Bu o zaman geleneksel bir mRNA overexpression strateji için daha iyi bir alternatif olarak biyolojik bir yol içinde yer alan belirli bir gen işlevini incelemek için harnessed olabilir. Buna ek olarak, bu çok yönlü araç antikor üretimi artırmak için uygulanabilir ve fonksiyonel proteinler16,17,18, yeterli dozlarda tarafından neden haploinsufficient hastalıkları tedavi etmek için bir ilaç olarak 19,20,21.

SINEUP teknoloji avantajları manifold. Transkripsiyon düzeyinde hedef ifade değiştirmez. Daha uzun BDs daha fazla özgüllük bir dsRNA bağlı stres yanıt15inducing değil iken SINEUPs için sağlar. Protein indüksiyon herhangi bir zararlı etkisi nedeniyle anormal veya aşırı protein ifade önlenmesi hücrenin normal fizyolojik sınırlarda tutulur. SINEUPs fare, insan, çok çeşitli ile uyumludur ve hamster hücre satırları, örneğin, HEK293T/17, HepG2, HeLa, CHO, MN9D ve çok daha fazla12,13,14,15,18 kültürlü ,19. SINEUPs verimli bir şekilde endojen genler, geçici overexpressed genler ve bayrak öğesini veya luciferase-füzyon genlerin, eleme belgili tanımlık lüzum gene özgü antikor14,18hedefleyebilirsiniz. Rutin hücre kültürü, transfection, Sodyum Lauryl Sülfat-polyacrylamide jel elektroforez (SDS-sayfa), gerçek zamanlı nicel Ters transkripsiyon-polimeraz zincir reaksiyonu (qRT-PCR) araçları ve ayarları, temel SINEUP analiz gerektirir ve uzmanlık kısa sürede elde edilebilir.

Burada, sentetik SINEUPs yukarı düzenleyen-çeviri, RNA müdahale9 ve ASO gapmers11,22,23gibi diğer teknolojileri aksine bir etkisi ile gen hedefleme için bir yöntem açıklanmaktadır. Yaygın olarak kullanılan RNA güdümlü gen harekete geçirmek için kümelenmiş düzenli olarak interspaced kısa palindromik tekrarlar tabanlı etkinleştirme (CRISPRa), gen ekspresyonu transkripsiyon düzeyi24nerede tetiklenir yöntemidir. Bu yöntem, yine de basit ve hızlı, böylece hedef kapalı bağlama25olasılığını artırarak daha yüksek verim için aynı gen hedefleme birden çok tek Kılavuzu RNA'ların (sgRNAs) gerektirir. Ayrıca, anahtar enzim CRISPRa sisteminin düşük bağlama özgüllük ve sgRNAs hedefleme çift yönlü organizatörü bölgeleri özel olarak sigara up-gen25düzenleyen catalytically ölü CRISPR ilişkili protein 9 (dCas9) vardır. Tersine, SINEUPs bir tek bağlama bölgesi, mRNA yüksek özgüllük ile hedef bağlanmak ve yakındaki genlerin ifade etkilemez. SINEUP tasarım, transfection, protein ve RNA ifade analizleri ilgili temel adımları tartışmak. Ayrıca, biz en iyi SINEUPs tespiti için yararlı olan bir kerede birden çok SINEUPs ekrana bir yarı otomatik, yüksek üretilen iş görüntüleme sistemi mevcut.

Protocol

1. tasarım BDs SINEUP yapıları hedef mRNA'ların için

  1. Transkripsiyon başlangıç sitesi (TDH) ve hedef mRNA'ların ilgi hücrelerdeki çeviri başlangıç sitenin kontrol edin. TSS verisini kodla ve FANTOM projeleri (cap Analizi gen ekspresyonu, kafes) almak (ZENBU: http://fantom.gsc.riken.jp/zenbu/).
  2. Açık belgili tanımlık kaş, genler ilgi arama ve TSS kafes doruklarına tarafından kontrol.
  3. Örnek analiz proteinin hücre ve doku belirli TSS Parkinson hastalığı 7 (PARK7) başvurun Şekil 2' de gösterilen mRNA.
  4. BD dizileri, 40'a karşılık gelen birkaç farklı uzunlukta üsleri ters yönde ve 32 üsleri akıntı yönünde ilk metiyonin (Ağustos), 72 tasarım nt toplam.
  5. Özel sipariş tasarlanmış BDs SINEUP ifade vektörde ( Tablo malzemelerigörmek).
    Not: Sıra özgüllük hedef kapalı etkileri26önlemek için temel yerel hizalama arama aracı tarafından (patlama) denetleyin.

2. hücre kültür ve SINEUP Transfection

  1. Tohum hücrelerinin 6 şey plaka 24 iyi-plaka SINEUPs transfection önce 24 h içinde ilgisini kaybedecektir. İnsan embriyonik böbrek hücre kültürünü (HEK293T/17) söz konusu olduğunda iyi bir poli-D-lizin kaplamalı 24 iyi-plaka başına 6 bir şey-tabak ya da 1.5 x 105 hücre kuyu başına (bakınız Tablo malzemeler), tohum 0.5 x 106 hücre ( Tablo malzemelerigörmek). 24 saat sonra % 70 birleşmesi olur.
  2. 24 saat sonra 1,5 mL 6 bir şey tabak taze orta veya 0.4 mL 24 bir şey tabak taze orta orta değiştirin. SINEUP-GFP durumunda pEGFP-C2 0.6 µg transfect ( Tablo malzemelerigörmek) ve SINEUP-GFP bir iyi pEGFP-C2 6 bir şey-plaka veya 130 ng ve 670 3,4 µg ng SINEUP-GFP 24 iyi-plaka transfection reaktifi (10 µL 6 iyi-plaka ve 3 µ ile bir iyi L 24 iyi-plaka) üreticinin yönergelerini izleyerek (bkz. Tablo reçetesi) ve 24 saat için %5 CO2 kuluçka 37 ° C'de kuluçkaya.
  3. Hücreleri fosfat tampon salin (PBS) (37 mM NaCl, 8 mM Na2HPO4, 2.6 mM KCl ve 1.5 mM KH2PO4) her şey 6 iyi-plaka 2 mL veya PBS her iyi şey 24 plaka 0.5 mL ile yıkayın. Poli-D-lizin kaplamalı 24 iyi-plaka, için sadece 25 µL % 0.05 ağırlık birim tripsin başına ekleyin, 5 min için % 5 CO2 kuluçka kuluçkaya ve hücre orta iyi başına 275 µL ekleyin. 6 şey plaka halinde, PBS 2 mL her kuyuya ekleyin. Yukarı ve aşağı hücreleri (6 bir şey plaka için 1,5 mL) veya 24 bir şey plaka için 225 µL 1 de protein çıkarılması (Protokolü 3 protein çıkarılması için gitmek) için 3/4 ve 1/4 hücre (6 bir şey plaka için 0.5 mL) veya 75 µL 24 iyi-tabağı için hasat damlalıklı RNA çıkarma ve 6.000 x g, santrifüj 4 ° c (adım 5 RNA çıkarılması için gitmek) 5 min için.
    Not: SINEUP-GFP etkisini bir poli-D-lizin kaplamalı 24 iyi-plaka görüntüleme tarafından analiz. Adım 7 (görüntüleme analizi) gidin.

3. protein çıkarma

  1. Dikkatle PBS 1,5 mL Aspire edin ve 140 µL lizis çözüm (20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, %1 (w/v) Triton, 2.5 mM Sodyum pirofosfat, 1 mM β-gliserofosfat, 1 mM Na3VO4 Ekle 1 μg/mL leupeptin ve %0,005 (w/v) phenylmethylsulfonyl florür (PMSF)) ( Tablo malzemelerigörmek) 6 iyi-tabak ya da 60 µL 24 iyi-tabağı hücre topakları için için.
  2. Pipetting tarafından mix ve 4 ° C'de 1 h için yavaş hızda çevirerek iyice karıştırın Santrifüjü 14.000 x g 4 ° C'de 10 dakika için de tarafından süpernatant toplamak
  3. Protein konsantrasyonu Renkölçer tahlil tarafından kontrol edin (bkz. tablo malzeme). Oda sıcaklığında bütün tepkiler hazırlayın.
    1. 0,2-1.5 ile değişen konsantrasyonları ile 5 - 6 kez seyreltme Sığır serum albumin (BSA) protein Ultrasaf Su standart hazırlamak mg/mL protein. Taze standartları her zaman hazır olun.
    2. Çalışma reaktif Aʹ 1 mL reaktif (alkali bakır tartarat çözüm) karıştırarak 20 µL (yüzey aktif çözüm) reaktif S ile hazırlayın.
    3. Su (negatif kontrol), BSA standart (protein standart ve pozitif kontrol) veya protein örnek her iyi bir 96-iyi-plaka 5 µL yükleyin.
    4. Reaktif Aʹ 25 µL her kuyuya ekleyin. Dikkatle reaktif B (Folin reaktif) 200 µL de herhangi bir kabarcık oluşumu kaçınarak başına ekleyin. Alüminyum folyo ile plaka kapak ve 5-10dk için bekleyin.
    5. 750 protein absorbans ölçmek nm bir Spektrofotometre ile. En az 1 h absorbans stabil.
    6. Standart eğri çizdirme BSA standart protein konsantrasyonları (mg/mL) x ekseni ve y ekseni üzerinde onların anılan sıraya göre absorbans hazırlayın. Standart eğri denklem uygulayarak örnek protein konsantrasyonu hesaplayın.
      Not: Gerekirse bu adımda Protokolü duraklatmak veya adım 4'e gidin. Uzun süreli depolama için ek sıvı azot ve-80 ° C'de store protein örnekleri dondurma

4. protein ayrımı SDS-sayfa ve ile antikor (Western-blot Analizi) hedef proteinlerin algılama tarafından

  1. Boya yükleme x 2 bir birim eklemek (0,1 M Tris-HCl (pH 6.8), % 4 SDS, % 20 gliserol, %1,42 2-mercaptethanol ve % 0.2 bromophenol mavi) protein örnek her birime adım 3.3. 5 min için 90 ° C'de ısı ve hemen buz 1 dk. için serin.
  2. 10-20 µg % 10 SDS poli-akrilamid jel için protein örneklerinin yük ve 100-150 V adlı ayrı) ( Tablo malzemelerigörmek).
  3. Transfer protein jel 0.45 µm nitroselüloz membran için (bkz. Tablo reçetesi) tarafından aktarım arabellek (25 mM Tris, 192 mM glisin ve % 20 metanol) 25 V yarı kuru transfer aletle 30 dk için.
  4. Engelleme çözüm ekleyin (%5 yağsız Kuru süt 1 x TBST tampon (137 mM NaCl, 20 mM Tris-HCl (pH 7,6), % 0,1 ara-20)) ( Tablo malzemelerigörmek) membran kadar kapsayıcıya tamamen ıslatılır ve 30 dk için oda sıcaklığında kuluçkaya.
  5. Protein anti-GFP antikor (çözüm kapatmaktır seyreltilmiş 1:2000) ile SINEUP-GFP durumunda melezlemek ( Tablo malzemelerigörmek) Oda sıcaklığında sallayarak ile 30 dk için membran kuluçka tarafından. Anti-β-aktin antikor (çözüm kapatmaktır seyreltilmiş 1:2000) ile hybridizing tarafından bir iç kontrol protein β-aktin proteini tespit ( Tablo malzemelerigörmek) Oda sıcaklığında sallayarak ile 30 dk için.
  6. Membran tamamen sırılsıklam ve yıkama için oda sıcaklığında 5 dk kadar 1 x TBST arabellek kapsayıcıya Ekle. Yıkama iki (üç yıkama toplam) kez daha yineleyin.
  7. (Çözüm kapatmaktır seyreltilmiş 1: 1000) GFP protein melezlemek antikor horseradish peroksidaz (HRP) ile Birleşik ve β-aktin proteini melezlemek Anti-tavşan seyreltilmiş HRP ile membran üzerinde Birleşik (çözüm kapatmaktır 1: 1000) Anti-fare antikor 30 dk için oda sıcaklığında sallayarak ile.
  8. Membran ile 1 x TBST arabellek 5 min için oda sıcaklığında yıkayın. Yıkama iki (üç yıkama toplam) kez daha yineleyin.
  9. Kemiluminesan (ECL) HRP-geliştirilmiş algılama reaktif 1 ve 2 ( Tablo malzemelerigörmek) eşit birim karıştırın. Membran 2 mL ECL reaktif karışıma aktarın, alüminyum folyo ile kutu örtmek ve oda sıcaklığında 1-2 min için kuluçkaya izin verin. Dikkatle membran ECL reaktif karışımından kaldırmak ve bir ışıldama enstrüman Imaging kullanarak bulaşmasına neden.

5. RNA çıkarma ve DNaz tedavi

  1. Standart bir monolayer27 yetiştirilen hücrelerin RNA çıkarılması için protokol veya alternatif olarak piyasada bulunan bir RNA ayıklama kullanın özü toplam RNA aşağıda ( Tablo malzemelerigörmek) kit. Kısacası devlet için guanidin isothiocyanate, herhangi bir monophasic lizis reaktif (MLR) ekleyin ve fenol hasat hücrelerde adım 2.3 (1 mL MLR ~ 5 milyon hücre başına)27.
    Not: Eldiven sık sık değiştirin. RNase free reaktifler ve diethylpyrocarbonate (DEPC) kullanın-plastik eşya ve Züccaciye RNA yıkımı önlemek için tedavi. Bu adımda protokol gerekirse duraklatın. Mağaza RNA-80 ° C'de ayıklanır.
  2. DNaz arabellek x 10 ve 2 U DNaz 0.1 hacmi arıtılmış RNA--dan adım 5.1 ( Tablo malzemelerigörmek) ekleyin.
  3. Nükleaz ücretsiz su ile 50 µL için tepki ses düzeyini ayarlamak ve karışımı yavaşça. 30 dk 37 ° C'de kuluçkaya.
  4. 0.1 yeniden askıya alınmış DNaz inactivation reaktif hacmi ekleyin ve iyice karıştırın ( Tablo malzemelerigörmek). Nazik sallayarak ile Oda sıcaklığında 5 min için kuluçkaya.
  5. 10.000 x g de 90 s. Transfer için süpernatant (RNA DNA içermeyen) bir taze RNase free 1,5 mL tüp için santrifüj kapasitesi. Bu akış yönündeki adımlar için zahmetli olan DNaz etkilenmişimdir neden olabilir çünkü Pelet dokunmamaya dikkat et.
  6. Bir260 ve260/A280 oranı ölçerek RNA quantitate (saf RNA için 1.8-2.0 aralıktır) UV spektrofotometre içinde.

6. ilk Strand cDNA sentezi ve qRT-PCR analizleri

  1. (Bkz: malzemeler tablo) olarak standart cDNA sentez protokol sonrası ilk strand cDNA sentezi gerçekleştirir.
    1. 0,75 µM oligo dT astar, 4.3 µM rasgele astar, dNTPs (10 mM her) 200-500 ng toplam RNA (Kimden adım 5-8) Toplam reaksiyon Cilt 10 µL içinde karıştırın. 65 ° c 5 min için kuluçkaya ve sonra hemen buza koy.
    2. Mix 1 x transkriptaz tampon, 1 U RNase inhibitörü, 10 U transkriptaz ve 10 µL 6.1.1 RNA-astar karışımı ekleyin.
    3. Toplam reaksiyon birim nükleaz ücretsiz su ile 20 µL gerekirse ayarlayın. Karışımı yavaşça ve reaksiyon mix 10 dk 30 ° C'de, sonra 60 dk, 42 ° C'de kuluçkaya ve sonunda 95 ° c 5 dk enzim devre dışı bırakabilirsiniz. Tüpler buz üstünde ne yapıyorsun?
      Not: RNA örnekleri ve buz üzerinde tüm kimyasalları çözülme ve buz reaksiyon karışımına hazır olun. Hedef RNA'ların sadece polyA RNA'ların oligo dT astar sadece (2.5 µM) kullanın. Protokol gerekirse duraklatın. -20 ° C'de sentezlenmiş cDNA depolamak
  2. Teknik triplicates qRT-PCR gerçekleştirmek (n = 3, Cт standart sapma > 0,2) ve biyolojik çoğaltır (n ≥ 3) içinde kullanarak 10 ng cDNA 1 µL, ters astar (10 µM), ileri astar (10 µM), DNA polimeraz karışım çözüm 10 µL 0.4 µL 0.4 µL , Boya, su nükleaz ücretsiz 10 µL boyama iki iplikçikli DNA 0.4 µL (tepki birim oldu 20 µL) koşullar; kullanarak PCR ürünleri algılamak için Sahne (1 dönüşü) 30 tutun sahne (40 döngüleri) 5 için Bisiklete binme 95 ° C'de s s 95 ° c ve 30 s 60 ° C'de eritmek eğrisi sahne. Astar örnekler için insan Gapdh_Fw: TCTCTGCTCCTCCTGTTC, insan Gapdh_Rv: GCCCAATACGACCAAATCC, EGFP_Fw: GCCCGACAACCACTACCTGAG, EGFP_Rv: CGGCGGTCACGAACTCCAG, SINEUP-GFP_Fw: CTGGTGTGTATTATCTCTTATG ve SINEUP-GFP_Rv: CTCCCGAGTCTCTGTAGC. Malzemelerin tabloyabakın. 2- ∆∆Ct ± SD yöntemi28ile kantitatif RNA ifade analiz.

7. SINEUPs yarı otomatik algılama yöntemi tarafından analiz görüntüleme

  1. Hücreleri PBS 0.5 mL 24 iyi-plaka bir kuyu ile yıkayın.
  2. Höchst 33342 (bkz: Malzemeler tablo) 2.0 μg ekleyin (PBS 500 μL içinde eriterek) her şey 24-iyi-tabak ve hücre çekirdeği leke için 20 dakika için 37 ° C'de kuluçkaya.
  3. Ölçü Höchst lekeli hücreleri 461 nm mavi emisyon maksimum ve 510 yeşil emisyon maksimumda GFP pozitif hücrelerinin sayısını saymak için yeşil floresan yoğunluğu toplam sayısını saymak için hücreleri kullanarak bir yüksek işlem hacmi mikro-iyi görüntü sitometresi (nm Malzemeler tablobkz.). SINEUPs protein yukarı düzenleyici etkisini bölümlenmiş nesneleri görüntüleme yazılımı29kullanarak her kanal için hesaplanan sinyal görüntüleme tüm piksel yoğunluklarda toplamıdır GFP entegre yoğunluk hesaplayarak analiz.
  4. RNA ifade (geri için adım 5 ve 6) kontrol etmek için hücre hasat.

Representative Results

SINEUP-GFP olduğunu her iki optimum bir BD içeren bir sentetik SINEUP (-28 / 4 üst üste GFP mRNA için) ve bir ED (ters sinüs B2 AS -Uchl1gelen) bu up-düzenleyen GFP mRNA çeviri (Şekil 3A ve 3B) GFP ifade değiştirmeden mRNA (Şekil 3 c ve 3D). Optimum BDs ve EDs SINEUPs için ekran için algılama zaman geliştirilmiş ve aynı anda ekranlı bir geleneksel Western-blot Analizi15ile karşılaştırıldığında örnekleri sayısı artan yarı otomatik görüntü analizi bir protokol geliştirdi. Şekil 4' te gösterildiği gibi bu yüksek üretilen iş görüntüleme sistemi (Western-blot Analizi 2 hafta için 48 SINEUPs aldı) 3 gün sürdü. SINEUP-GFP GFP çeviri arttığını göstermiştir, entegre GFP yoğunluğu görüntü sitometresi tarafından tespit ettik. Optimum BD, SINEUP-GFP GFP protein ifade 1.4-fold bir artış indüklenen. Her ne kadar biz 2.6-fold gelen sinyalleri basısına gözlenen (Western-blot analizi, Şekil 3Agörmek) için 1.4-fold (analiz, görüntüleme bkz. Şekil 5) fark düşsel alet bilgisayar yazılımı kalibrasyon nedeniyle olabilir. Yine de, GFP Floresan (Şekil 5A ve 5B) denetim ile karşılaştırıldığında önemli ölçüde yüksek düzeyde tespit ettik.

Figure 1
Şekil 1: temel tasarım sentetik SINEUPs. BD mRNA, ED hedeflemek için bağlayıcı etki = ters sinüs dizisi içeren efektör etki =. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2: insan Parkinson hastalığı protein 7 (PARK7) (TSSs) sitelerini başlatma transkripsiyon mRNA belirli doku ve kafes analizi ile tespit gibi hücre içinde. (A) A TSS arama sonucu bir omics veri entegrasyonu ve etkileşimli görselleştirme sistem30kullanarak insan PARK7 mRNA için gösterilen anlık görüntü. Yatay yeşil ok Entrez gen hg19 parça genomik konumu gösterir başvurusu insan PARK7 mRNA ve dikey yeşil çubuklar FANTOM5 kafes 1 ve 2 parça TSSs toplamını gösterir (tutanaklar olarak ölçülen milyon (tpm)) dan doku ve hücreleri 1,829 türleri. (B) yakınlaştırma TSS panelinde A işaretli bölgesinin (1/354 ölçek: 100 35,4 kb bp). Gri alan 1 ve 2 parça gösterir şekilde alt kısmında listelenen toplam 1,829 6 belirli hücreleri TSS FANTOM5 kafes aşamasında gölgeli. (11.369, 4.998, 4.304, 3.509, 3.477 3.055) karşılık gelen ve bu listedeki hücreleri gösteren transkript başına sayıları milyon gri, belirli her hücre için gölgeli TSS konumları. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: up-SINEUP-GFP tarafından çeviri Yönetmeliği teyit Western-blot analizi. (A)SINEUP-GFP anti-GFP antikor ile Western-blot tarafından muayene. (B) sonuçları β-aktin proteini grup yoğunluğu için normalleştirilmiş. (C) GFP mRNA ve (D) SINEUP RNA'ların ifade qRT-PCR tarafından tespit edildi. p < 0.0005, n = 3, iki kuyruklu öğrenci t-testi, hata çubukları standart sapma vardır. Bu rakam Takahashi değiştirildi vd15. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4: SINEUP yarı otomatik görüntü analiz şematik. 1. gün: Tohum hücreleri 24 iyi tabakta ilgi. 2. gün: GFP ve SINEUP-GFP Transfect. 3. gün: entegre GFP yoğunluğu ölçerek SINEUPs etkisini analiz. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5: çeviri up-yönetmelik SINEUP-GFP tarafından yüksek üretilen iş analizi. (A)GFP floresans denetim ve SINEUP-GFP transfected hücreleri15arasında karşılaştırılması. Ölçek çubuğu 2 mm. (B) GFP = entegre yoğunluk nükleer Höchst 33342 ile boyama tarafından sayılır toplam cep numarası için normalleştirilmiş. p < 0.0005, n = 3, iki kuyruklu öğrenci t-testi, hata çubukları standart sapma vardır. FOV: alanı elde edersiniz. Bu rakam Takahashi değiştirildi vd15. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Discussion

Burada özellikle protein üretimini artırmak için bir protokol açıklanan mRNA tarafından anlamına gelir bir sinüs-içeren bir hedef RNA, kodlamayan denilen SINEUPs. Temsil edici bir örnek olarak, en uygun sentetik SINEUP-GFP yukarı 2.6-fold Western-blot analizi ile ölçülen GFP mRNA çeviri düzenlemek için gösterilir.

Optimum bir BD tasarlama SINEUP özgüllük ve kudret (protein up-yönetmelik kapsamı) sağlamak çok önemlidir. Daha önce biz 17 BDs SINEUP-GFP Western-blot Analizi15 tarafından ekranlı ve diğer mRNA'ların çalışmasıyla olmayabilir ve her durum için doğrulanması gerekir rağmen optimum BD GFP mRNA, AUG-KOZAK dizisi çakışıyor bulundu. Başka bir bağımsız Grup ayrıca31farklı bir yöntem kullanarak BD tarandı. Gibi birçok BDs eleme oldukça zaman alıcı ve hantal olabilir, bir yüksek-den geçerek SINEUP algılama yöntemi burada tanıttı. Bu yöntem entegre GFP yoğunluğundaki hücrelerdeki SINEUP transfected-denetim vektör transfected-hücrelere kıyasla göreceli değişiklik ölçer. Bir kültür plaka belirli bir kuyu hücrelerde aynı derecede transfected ve GFP sinyal yalnızca bir belirli bölgesine iyi konsantre değil emin olmak için bu adım 2.1 wells eşit hücrelerde dağıtmak çok önemlidir. Bu amaçla, yavaşça hücrelerin içinde temiz bir Bank tohum sonra plaka 10 kez ileri geri (↑↓) sallamak ve % 5 CO2 kuluçka makinesine kuluçka başlamadan önce tekrarlayın.

Başka bir önemli adım adım 3.3 protein konsantrasyonu hesaplamasıdır. Burada miscalculations protein hatalı bir miktarda yükleme Western-blot analizi, sonuç olarak küçük değişiklikler protein ifade tespiti bazı zayıf SINEUPs tarafından önlenmesi veya yanlış pozitif aşırı yüklemesini oluşturma sırasında yol açabilir. Bu standartlar ve protein örnekleri eşit miktarda adım 3.3.3 ölçülür emin taze her zaman protein standart eğri hazırlamak için önerilir. Protokol tanımlamak burada odaklanır SINEUP-GFP üzerinde ama Western-blot Analizi-ebilmek var olmak kullanılmış için mRNA ilgi hedef. Kuluçka süresi ve konsantrasyon antikorların en iyi sonucu elde etmek her hedef için optimize edilmelidir.

Yegane şekil-in SINEUPs hedef-mRNA ifade düzey etkilenmemiş kalır biridir. RNA, transfected SINEUPs ve genomik DNA qRT-PCR tarafından önlemek için DNaz ile tedavi etmek önemlidir. SINEUP RNA'ların ve hedef mRNA ifade qRT-PCR tarafından transfection ve SINEUP etkinlik başarısı onaylamak için ölçülmelidir. SINEUPs içeren her iki insan bol olduğu bir sinüs sıra ve fare genleri. SİNÜS sıralarının non-spesifik algılama önlemek için bu qRT-PCR astar sinüs sıra tasarlamak için tavsiye edilmez.

Bu iletişim kuralı insan hücre hatları kullandık ama SINEUPs etkili bir dizi hücre satırlarını birkaç farklı türler12,13,14,18,19. Bunlar transfection SINEUP vektörler verimliliğini korumak sürece hücre kültür ve transfection koşulları farklı hücre satırlarını göre değiştirilebilir. Onlar qRT-PCR ve Western-blot analizi için gerekli RNA ve protein kalitesini koruma verilen bu Ayrıca, RNA ayıklama, cDNA sentezi ve protein konsantrasyonu kontrol alternatif yöntemler, istihdam edilebilir. GFP floresans tespiti tüm iyi etkin, belirli bir yüksek işlem hacmi mikro-şey sitometresi kullanılan diğer cytometers benzer bir algılama mesafesi ile kullanılan31olabilir. Hücreleri ve transfection bir kuyu eşit ise, o zaman bu GFP floresan için tüm iyi taramak gerekli olmadığını kaydetti için olduğunu: yarım veya çeyrek bölgesinin kalbinde bir kuyu SINEUP etkisi deneme bağlı olarak ayırt için yeterli olabilir El becerileri.

Aynı anda birden fazla BDs kültürlü hücrelerdeki belirli bir mRNA hedefleme taranması için yüksek üretilen iş SINEUP Algılama Protokolü oluşturma sağlar. Bu optimum BD tarafından hedefleme yöneten kurallar hala belirsiz olduğundan önemlidir. Eleme sistemi böyle bir multiplex karşı farklı genler, örneğin belirli bir sinyal yol dahil birden çok gen hedefleme için yararlı birçok SINEUPs büyük ölçekli test için sağlar. Ayrıca, etkili SINEUPs çeşitli mRNA'ların, hedef farklı SINEUP BDs AUG-Kozak bölgenin etrafında tasarımı için Aramayı genişletmek için kullanılabilir GFP mRNA ile erimiş (bkz. Şekil 1), ortak transfecting tam uzunlukta hedef mRNA'ların (5ʹ UTR'nin-CD-3ʹ UTR) kültürlü hücreleri en iyi SINEUPs ve daha sonra test BD adayları endojen mRNA karşı kültürlü hücreleri ve içinde vivo modeli hayvanlar, insanlar ve fareler diğer hayvan ve bitki türleri için bulmak için.

Bu tarama iletişim kuralı çok hızlıdır. Saptamak ve hücreleri toplamak ama sadece yaşayan yerleştirmeniz gerekir gerekir değil hücre kültür plaka düşsel alet. SINEUPs optimum BDs seçin ve potansiyel adaylar Western-blot analizi ile değerlendirmek için bu yüksek üretilen iş tarama protokolünü kullanmak üzere teklif ediyorum. Böylece, seçilen adaylar optimum BDs ile antikor üretimi18,19,21artırmak için uygulanabilir. Şu anda, RNA tedavi alan önemli ölçüde artıyor. Örneğin, siRNA, ASO, mRNA ve CRISPR RNA terapiler, yaygın olarak onların anılan sıraya göre hedefler9,32mRNA ifade denetlemek için istihdam edilmektedir. Bu bağlamda SINEUPs onların bebeklik döneminde vardır ama defa okudu SINEUPs hiçbiri hedef mRNA'ların ifade değiştirdi. Buna ek olarak, SINEUPs düzenleme yapmayın mRNA hedef, ama sadece çeviri mRNA yukarı düzenleyen. Ayrıca, haploinsufficiency kaynaklanan işlev kaybı hastalıkları eksik protein17,33logosuna 2 kat bir indüksiyon ulaşmak SINEUP tedavisi ile yönlendirilebilir. Hedef kapalı etkileri daha da incelenecektir gerek rağmen SINEUPs potansiyel ve özellikle bir tek, ifade mRNA BD için tamamlayıcı bir sıra ile hedef.

Bir bu yüksek üretilen iş iletişim protokolü önlemler GFP şiddeti sadece entegre çünkü bu ekran BDs SINEUPs içinde vivo fare modelleri için uygun değildir kısıtlamadır. SINEUPs post-transcriptionally hareket doğal antianlamlı lncRNAs olduğu için onlar hedef mRNA hücreleri ya da doku örneği eksik olduğunda uygulanamaz.

Yine de, SINEUPs antikor üretimini artırmak için işlev kazanç çalışmalar ve ifade 1,5-3,0-kat aralığında eksik proteinlerin yukarı düzenleyen bir RNA tedavi olarak uygulanabilir. Yöntem tanımlamak burada hedef ve SINEUP kaynaklı çeviri geliştirme istenen mRNA algılamak ve çoğu gen düzenlemesi için yeni bir araç sağlamak için yararlı bir rehber mevcut.

Disclosures

Yazarın Piero Carninci fikri mülkiyet dosyalanmış patent (EP2691522A4 ve JP2017169573A) ve SINEUP teknoloji için verilen patent (US9353370B2) üzerinde tutan TransSINE teknolojileri Co Ltd kurucularından biridir.

Acknowledgments

Bu çalışmada kısmen yenilikçi biyolojik tıp için temel bilim ve Platform teknolojisi programı tarafından desteklenen, No 17 yaşındayım 0301014, tıbbi araştırma ve geliştirme (AMED), ömür boyu RIKEN merkezine MEXT araştırma hibe Japonya Ajansı Bilim teknoloji ve MEXT RIKEN IMS için bir araştırma hibe. Üyeler PC laboratuvar ve SINEUP ağ (SISSA, Doğu Piedmont Üniversitesi ve RIKEN) düşündürücü tartışma için teşekkür ederiz. Dr. Matthew Valentine proofreading için teşekkür ediyoruz.

Materials

Name Company Catalog Number Comments
Synthetic SINEUP Cell Guidance Systems Ltd. in UK and K.K.DNAFORM in Japan https://www.cellgs.com/items/sineupand8482.html and https://www.dnaform.jp/en/information/20130320 Step 1.5
HEK293T/17 ATCC ATCC CRL-11268 Step 2.1
Falcon Multiwell Plate For Cell Culture 6 well plate Corning 6902A01 Step 2.1
Corning BioCoat Poly-D-Lysine 24 well Plate Corning 08-774-124 Step 2.1
Lipofectamine 2000 Transfection Reagent Thermo Fisher Scientific 11668027 Step 2.2
pEGFP-C2 Clontech #6083-1 Step 2.2
Cell Lysis Buffer (10x) Cell Signaling Technology #9803S Step 3.1 This is pre-mixed cell lysis solution.
PMSF Cell Signaling Technology #8553S Step 3.1 To complete cell lysis buffer, add 0.005% (w/v) PMSF to 1x cell lysis buffer.
DC protein assay kit II BIO RAD #5000112JA Step 3.3
10% Mini-PROTEAN TGX Precast Protein Gels, 12-well, 20 µL BIO RAD #4561035 Step 4.2
Amersham Protran Premium NC 0.45 (150 mm×4 m) Amasham 10600013 Step 4.3, This is a 0.45 µm nitrocellulose membrane.
Nonfat Dry Milk Cell Signaling Technology #9999S Step 4.4 A component of the blocking solution.
GFP Tag Antibody Thermo Fisher Scientific A-6455 Step 4.5 Lot number: 1495850, RRID: AB_221570
Monoclonal Anti-β-Actin antibody produced in mouse SIGMA A5441 Step 4.5 Lot number: 026M4780V, RRID: AB_476744
Polyclonal Goat Anti Rabbit Immunoglobulins Dako P0448 Step 4.5 This is secondary antibody conjugating with HRP for anti GFP antibody. Lot number: 20017525, RRID:AB_2617138
Polyclonal Goat Anti mouse Immunoglobulins Dako P0447 Step 4.5 This is secondary antibody conjugating with HRP for anti β-Actin antibody. Lot number: 20019698, RRID:AB_2617137
ECL Western Blotting Detection Reagents Amersham RPN2109 Step 4.9
Maxwell Rapid Sample Concentrator (RSC) Instrument Promega AS4500 Step 5.1 This is commercially available RNA exreaction instrument.
Maxwell RSC simplyRNA Cells Kit Promega AS1390 Step 5.1 This is commercially available RNA exreaction kit.
TURBO DNA-free Kit ambion AM1907 Step 5.2 and 5.4 The kit contains DNase, DNase buffer and inactivation reagent.
PrimeScrip 1st strand cDNA Synthesis Kit TaKaRa 6110A Step 6.1 The kit contains reagents of first strand cDNA synthesis.
TB Green Premix Ex Taq II TaKaRa RR820A Step 6.2
Hoechst3342 Thermo Fisher Scientific H3570 Step 7.2
Celigo S Nexcelom Bioscience 200-BFFL-S Step 7.3 This is a high throughput micro-well image cytometer.

DOWNLOAD MATERIALS LIST

References

  1. Katayama, S., et al. Antisense transcription in the mammalian transcriptome. Science. 309, (5740), 1564-1566 (2005).
  2. Carninci, P., et al. The transcriptional landscape of the mammalian genome. Science. 309, (5740), 1559-1563 (2005).
  3. Hon, C. C., et al. An atlas of human long non-coding RNAs with accurate 5' ends. Nature. 543, (7644), 199-204 (2017).
  4. Tufarelli, C., et al. Transcription of antisense RNA leading to gene silencing and methylation as a novel cause of human genetic disease. Nature Genetics. 34, (2), 157-165 (2003).
  5. Yu, W., et al. Epigenetic silencing of tumour suppressor gene p15 by its antisense RNA. Nature. 451, (7175), 202-206 (2008).
  6. Carninci, P., Hayashizaki, Y. Noncoding RNA transcription beyond annotated genes. Current Opinion in Genetics & Development. 17, (2), 139-144 (2007).
  7. Chu, Y., Yue, X., Younger, S. T., Janowski, B. A., Corey, D. R. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 38, (21), 7736-7748 (2010).
  8. Ha, M., Kim, V. N. Regulation of microRNA biogenesis. Nature Reviews Molecular Cell Biology. 15, (8), 509-524 (2014).
  9. Takahashi, H., Carninci, P. Widespread genome transcription: new possibilities for RNA therapies. Biochemical and Biophysical Research Communications. 452, (2), 294-301 (2014).
  10. Lam, J. K. W., Chow, M. Y. T., Zhang, Y., Leung, S. W. S. siRNA Versus miRNA as Therapeutics for Gene Silencing. Molecular Therapy-Nucleic Acids. 4, e252 (2015).
  11. Nishina, K., et al. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing. Nature communications. 6, 7969 (2015).
  12. Carrieri, C., et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature. 491, (7424), 454-457 (2012).
  13. Schein, A., Zucchelli, S., Kauppinen, S., Gustincich, S., Carninci, P. Identification of antisense long noncoding RNAs that function as SINEUPs in human cells. Scientific Reports. 6, 33605 (2016).
  14. Zucchelli, S., et al. SINEUPs are modular antisense long non-coding RNAs that increase synthesis of target proteins in cells. Frontiers in Cellular Neuroscience. 9, 174 (2015).
  15. Takahashi, H., et al. Identification of functional features of synthetic SINEUPs, antisense lncRNAs that specifically enhance protein translation. PLOS ONE. 13, (2), e0183229 (2018).
  16. Deutschbauer, A. M., et al. Mechanisms of haploinsufficiency revealed by genome-wide profiling in yeast. Genetics. 169, (4), 1915-1925 (2005).
  17. Indrieri, A., et al. Synthetic long non-coding RNAs [SINEUPs] rescue defective gene expression in vivo. Scientific Reports. 6, 27315 (2016).
  18. Patrucco, L., et al. Engineering mammalian cell factories with SINEUP noncoding RNAs to improve translation of secreted proteins. Gene. (2015).
  19. Sasso, E., et al. A long non-coding SINEUP RNA boosts semi-stable production of fully human monoclonal antibodies in HEK293E cells. MAbs. 1-8 (2018).
  20. Dang, V. T., Kassahn, K. S., Marcos, A. E., Ragan, M. A. Identification of human haploinsufficient genes and their genomic proximity to segmental duplications. European Journal of Human Genetics. 16, (11), 1350-1357 (2008).
  21. Zucchelli, S., Patrucco, L., Persichetti, F., Gustincich, S., Cotella, D. Engineering Translation in Mammalian Cell Factories to Increase Protein Yield: The Unexpected Use of Long Non-Coding SINEUP RNAs. Computational and Struct Biotechnology Journal. 14, 404-410 (2016).
  22. Hua, Y., et al. Antisense correction of SMN2 splicing in the CNS rescues necrosis in a type III SMA mouse model. Genes & Development. 24, (15), 1634-1644 (2010).
  23. Watts, J. K., Corey, D. R. Silencing disease genes in the laboratory and the clinic. Journal of Pathology. 226, (2), 365-379 (2012).
  24. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  25. Wu, X., et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nature Biotechnology. 32, (7), 670-676 (2014).
  26. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. Basic local alignment search tool. Journal of Molecular Biology. 215, (3), 403-410 (1990).
  27. Liu, X., Harada, S. RNA isolation from mammalian samples. Current Protocols in Molecular Biology. Chapter 4 Unit 4.16 (2013).
  28. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  29. Schneider, C. A., Rasband, W. S., Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nature Methods. 9, (7), 671-675 (2012).
  30. Severin, J., et al. Interactive visualization and analysis of large-scale sequencing datasets using ZENBU. Nature Biotechnology. 32, (3), 217-219 (2014).
  31. Yao, Y., et al. RNAe: an effective method for targeted protein translation enhancement by artificial non-coding RNA with SINEB2 repeat. Nucleic Acids Research. 43, (9), e58 (2015).
  32. Savić, N., Schwank, G. Advances in therapeutic CRISPR/Cas9 genome editing. Translational Research. 168, 15-21 (2016).
  33. Long, H., et al. RNAe in a transgenic growth hormone mouse model shows potential for use in gene therapy. Biotechnology Letters. (2016).
Özellikle mRNA çeviri geliştirebilirsiniz RNA'ların kodlamayan SINEUP deneyleri bağlı hücre
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).More

Takahashi, H., Sharma, H., Carninci, P. Cell Based Assays of SINEUP Non-coding RNAs That Can Specifically Enhance mRNA Translation. J. Vis. Exp. (144), e58627, doi:10.3791/58627 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter