Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

기본 인간 세포에서 Zika 바이러스의 항 체 의존 향상의 정량화

doi: 10.3791/58691 Published: January 18, 2019

Summary

우리는, 사용 하 여 인간의 혈 청 기본 인간 세포 감염 부 량 정량 실시간 중 합 효소 연쇄 반응에 의해 Zika 바이러스 감염에 뎅기열 바이러스에 대 한 기존의 면역의 효과 평가 하는 방법을 설명 합니다.

Abstract

Flavivirus Zika Guillain-바레 증후군 등 유아, microcephaly 신경 합병증의 최근 출현은 심각한 공공 안전 문제를 가져왔다. 위험 요인 중 항 체 의존 향상 (ADE) 포즈 가장 중요 한 위협을 Zika 바이러스 (ZIKV)의 최근 재 출현은 주로 지역 인구는 다른 밀접 하 게 관련을 사전 면제의 상태 flaviviruses, 특히 뎅기열 바이러스 (DENV) 여기, 우리 ZIKV 감염 기본 인간 세포 또는 세포에 DENV에 대 한 인간의 혈 청 항 체의 효과 측정에 대 한 프로토콜을 설명 합니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

모기 품 어진 바이러스 성 질병 가운데 Zika 감염1가장 임상적으로 중요 한 중 하나입니다. 감염은 flavivirus ZIKV는, 대부분의 경우에는 기본 벡터1,2 Aedes aegypti 사용에 의해 발생 합니다. 그러나, 일부 ZIKV 발생3주 벡터로 Aedes albopictus 보고 연구 있다. 많은 경우에서 무 증상 감염 이지만, 가장 일반적인 증상은 발열, 두통, 근육 통증2. 아무 치료 또는 백신 ZIKV 감염에 사용할 수 있는 이며 사용 가능한 치료는 주로 지원. 남아메리카에 있는 ZIKV의 최근 발발 microcephaly2라는 태아에 neurodevelopmental 장애에 약 20-fold 증가 질병의 심한 경우에 지도 했다. 남미 지역 여러 arboviruses DENV 및 웨스트 나 일 바이러스에 발병으로 조사 여부 다른 flavivirus(es)에 이전 면역 역할 ZIKV 감염 및 질병의 심각도에 결정적 이다.

연령대에 걸쳐 바이러스는 호스트 셀 기계를 정복 하 고 항 바이러스 반응 억제 infectivity의 그들의 기회를 증가 하는 다른 전략을 진화 했다. 모두의 가장 매혹적인 중 현상 에이드4그들의 복제를 향상 시키기 위해 바이러스에 의해 호스트 미리 면역 항 체의 사용 이다. DENV의 모든 4 개의 serotypes에 걸쳐 ADE 잘 공부 하 고 바이러스 titers 및 질병 결과5,,67증가 입증 되었습니다. 이전 체 외 연구에서 우리는 기존의 기본 인간의 면역 세포8DENV 면제 때문에 ZIKV 복제의 향상을 나타났습니다. 우리는 또한 관련 생체 외에서 메서드 기본 셀에 ZIKV 복제 향상 DENV 기존의 항 체의 기능을 정량화를 시연 했다.

우리가 개발한 프로토콜 DENV 중화 TCID 50에 대 한 테스트는 인간의 혈 청 샘플 사용 또는 플 라크 감소 중립화 시험 (PRNT) 분석 실험, 생물학으로 관련 된 셀 또는 셀 ZIKV 감염 시킬 수 있는 조직에서 파생 된 ZIKV 함께.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

이 연구에 사용 된 혈 청 샘플은 콜롬비아에서 코 호트의 인간 참가자에서 얻은 했다. 샘플 컬렉션 대학 데 팜 플로 나 (콜롬비아, 남 아메리카)와 로스 Potios 병원8내부 검토 위원회 (IRB)에 의해 승인 되었다. 샘플 제공 익명으로 하 고 조사 했다 환자 정보에 액세스할 수 없습니다. 혈 청 샘플 DENV serotype 확인 했다. 샘플 추가 DENV 감염을 중화 확인 되었다 생체 외에서. 컨트롤에 대 한 미국에서 건강 한 개인 (HC)에서 혈 청 샘플 사용 되었다.

참고: 이 프로토콜은 Fcγ 수용 체를 표현 하는 모든 인간 세포 종류에 에이드의 ZIKV 복제 검사를 사용할 수 있습니다. 프로토콜의 구성 부품 (그림 1).

1. 셀 시드 및 감염 설치

참고: 이 특별 한 연구, 인간의 기본 세포 또는 U937 myelomonocytic 셀 라인 (ATCC-CRL-1593.2)에 대 한 사용 되었다. 셀 5% 이산화탄소 (CO2)와 함께 37 ° C 배양 기에서 10% 태아 둔감 한 혈 청 (FBS)와 보충 RPMI 성장 매체에 유지 되었다. 단계는 biosafety에 실시 했다 모든 멸 균 조건에서 2 (BSL-2) biosafety 내각 수준.

  1. 시드 3 x 104 셀 당 매체의 100 µ L 함께 메 마른 플랫 바닥 96 잘 접시에 고 5% CO2와 37 ° C 배양 기에 넣어.
  2. 셀을 뿌리기, 후 혈 청 샘플 실 온에서 해 동 하 고 10 직렬 희석 (, 1/10, 1/100, 1/1000, 1/10000) 혈 청 자유로운 매체에 샘플을 혼합 하 여. Aliquot 살 균 96 잘 접시로 희석. 혈 청 하지 않고 바이러스를 사용 하 여 추가 제어로.
  3. ZIKV 재고 1-2 분 동안 물 목욕에서 37 ° C에서 녹여 하 고 신속 하 게 나중을 위해 얼음에 그들을 전송.
  4. 혈 청 aliquots를 ZIKV 변형 MR766의 감염 (MOI) 상응 하는 금액의 0.1 다양성을 추가 합니다.
    참고: 희석 비율 일정 하 게 유지 하 고 총 볼륨은 ~ 200 µ L; 다는 것을 확인합니다 그건 각 치료의 triplicates에 대 한 충분입니다. 다운스트림 분석에 대 한 부정적인 제어로 사용 하는 감염 되지 않은 3 개의 우물을 유지.
  5. 양식 단지 Zika virions (편의 위해,이 "면역성이 있는 복합물" 라고 합니다)와 함께 DENV 항 체를 허용 하기 위하여 5% CO2 1 h 37 ° C 배양 기에서 추가 된 바이러스 혈 청 희석을 품 어.
  6. 평면-바닥 96 잘 접시에 시드 된 셀에서 미디어 발음 워시 살 균 1 인산 염 버퍼 식 염 수 (1 x PBS) x 셀.
  7. 각 잘 하는 면역성이 있는 복합물의 50 µ L을 추가 하 고 2 시간에 대 한 5% CO2 37 ° C 배양 기에서 그들을 품 어.
  8. 외피의 2 h 발음 세포에서 면역 단지를 포함 하는 미디어, 후는 멀티 채널을 사용 하 여 플라스틱, 그리고 세척 셀 2 x 1 x PBS 완전히 면역 단지와 연결 되지 않은 모든 virions를 제거.
  9. 10 %FBS 각각을 잘 품 어 48 h에 대 한 5% CO2 와 37 ° C 배양 기에서 세포 보충 하는 신선한 완전 한 미디어의 100 µ L를 추가 합니다.

2. RNA 추출

  1. 인큐베이터에서 96 잘 접시를 제거 하 고 캐비닛 biosafety에 그것을 전송.
  2. 미디어 발음, 세척 셀 2 x 1 x PBS, RNA 추출을 진행.
    참고: RNA는 어떤 방법의 선택에 의해 추출 될 수 있다 ( 테이블의 자료를 참조).
  3. 잘 당 10% β-mercaptoethanol 세포 세포의 용 해 버퍼의 250 µ L를 추가 합니다. 피 펫 팁 속도 세포 절차를 가진 세포를 긁 적와 함께 적어도 5 배 아래로 버퍼 플라스틱
  4. 새로운, 레이블, 살 균 1.5 mL 튜브에 세포 lysates 전송.
  5. 70% 에탄올 (250 µ L)의 동일한 금액을 추가 합니다. 때까지 혼합물은 분명 4 배-5 배 아래로 플라스틱.
  6. 2 mL 컬렉션 튜브에 실리 카 기반 열 표시를 혼합물 (~ 500 µ L)를 전송 및 통해 흐름 30 s. 폐기를 위해 15000 x g 에서 원심 및 동일한 컬렉션 튜브에 열을 유지.
  7. 각 열에 워시 버퍼 1의 700 µ L을 추가 하 고 통해 흐름 30 s. 폐기를 위해 15000 x g 에서 원심 동일한 컬렉션 튜브에 열을 유지.
  8. 30 미 삭제는 상쾌한 15000 x g 에서 각 열을 원심 분리기 세척 버퍼 2의 500 µ L를 추가 합니다. 2 x이이 단계를 반복 합니다.
  9. 워시 버퍼 2에서에서 새로운 2 mL 컬렉션 튜브 및 15000 x g 에서 원심 분리기 2 분 확인 실리 카 기반 열 얻을 완전히 건조 그리고 아무 에탄올에 대 한 열 왼쪽으로 이동.
  10. 2 mL 튜브를 삭제 하 고 장소에 열 새로운, 살 균, 분류, 1.5 mL 복구 튜브.
  11. 각 열과 1 분 15000 x g 에서 원심 분리기의 센터에서 RNase 무료 물 prewarmed (42 ° C) 30 µ L를 추가 합니다.
  12. 복구 eluted RNA와 260 nm 파장에는 분 광 광도 계를 사용 하 여 샘플을 계량 합니다.
    참고: 이상적으로, 260에서 흡 광도 값 사이의 비율을 계산 하 여 RNA의 순도 결정 nm 및 280 nm. 순화 된 RNA의 260/280 비율이 1.8-2.0 사이 이상적으로 이다.

3. 정량 실시간 중 합 효소 연쇄 반응

참고: 정량 실시간 중 합 효소 연쇄 반응 (qRT-PCR) 보통 SYBR 녹색 나 염색, Taq DNA 중 합 효소, deoxynucleotide 된 (dNTPs), 및 수동 염료의 구성 되는 어떤 SYBR 녹색 믹스를 사용 하 여 수행할 수 있습니다. 모든 정량 Pcr 기계 SYBR 녹색의 검출 능력이 반응을 수행 하 고 데이터를 얻기 위해 사용할 수 있습니다. 이 실험에 대 한 1 단계 RT-PCR 키트 SYBR 녹색의 칵테일을 했다 사용 된 내가 이용한 염료, Taq DNA 중 합 효소, dNTPs, 역전사의 추가 혼합물 ( 테이블의 자료를 참조). 봉투 영역에 대 한 설계 및 ZIKV 게놈 수준의 척도를이 연구에 사용 된 뇌관 ZIKV-qF에 대 한 CCGCTGCCCAACACAAG 및 CCACTAACGTTCTTTTGCAGACAT ZIKV-qR에 대 한 있습니다. 컨트롤, 인간의 β-2-microglobulin (B2M) 측정 하 고 ZIKV (내부 관리 유전자)의 표현을 표준화 하는 데 사용 했다. B2M 유전자 발현이이 연구에 사용 된 척도를 뇌관 순서는 B2M qF에 대 한 CTCCGTGGCCTTAGCTGTG 및 TTTGGAGTACGCTGGATAGCCT B2M qR에 대 한 이다. 모두는 ZIKV와 B2M 유전자에 대 한 각 샘플에 대 한 3 개의 기술 복제를 넣어 확인 하십시오. RT-PCR의 설치는 아래 간략하게 설명 되어 있습니다.

  1. RT-PCR 설치
    1. 샘플 당 RNA의 사용 100 ng
    2. 각 반응에 대 한 특정 유전자의 앞으로 역 뇌관의 10 µ M 주식에서 1 µ L를 추가 합니다.
    3. 샘플 당 역전사 믹스의 0.25 µ L를 추가 합니다.
    4. 각 개별 반응 SYBR 녹색 믹스의 12.5 µ L를 추가 합니다.
    5. 최대 25 µ L의 물 추가 합니다. 마스터 그것은 96-잘 PCR 접시에서 RNA, aliquot를 제외한 모든 위에서 언급 한 시 약의 혼합 및 마지막 RNA를 추가 확인 합니다.
    6. 투명 접착 테이프를 가진 접시를 봉인.
    7. 1000 x g 는 시 약을 섞어 1 분 동안에 격판덮개 원심
    8. 정량 Pcr 기계에 접시를 넣어.
  2. RT-PCR 프로필
    참고: 표 1에 표시 된 RT-PCR 프로필을 사용 합니다.
    1. 보완 DNA (cDNA)의 합성을 위해 10 분 동안 50 ° C에서 샘플을 품 어.
    2. CDNA 합성 후 5 분 동안 95 ° C에서 Taq DNA 중 합 효소를 활성화 합니다.
    3. 10 s 뇌관 어 닐 링 및 확장 30 60 ° C에서 95 ° C에서 변성의 40 주기를 수행 s.
    4. 결국에서 추가 용융 곡선 단계 (65 ° C)를 넣어.
  3. 데이터 분석
    1. 이상적으로, 단일 피크 1.6 이상의 경우 하나만 amplicon와 증폭 값의 존재를 확인 하는 특정 유전자에 대 한 모든 샘플에서 보여줍니다 정량 Pcr 기계는 algori를 실행 하는 데 사용 하는 프로그램에서 용융 곡선 탭을 클릭 하 여 용융 곡선을 모니터링 thm (증폭 값 정량 Pcr 기계에 의해 사용 되는 알고리즘에 따라 다름) 100% 증폭 값으로 2를 고려 합니다. 단계 사이의 최소 10 시간을 잡고 0.5 ° C 온도 단위로 사용 해야 최적의 결과 대 한 용융 곡선 프로토콜에 s.
    2. 거기 다는 것을 확인 한 후 단일 amplicon 및 좋은 증폭 값을 먼저 클릭 각 샘플의 양적 주기 (Ct/Cq 값)을 Microsoft Excel로 내보내기 정량화 데이터 탭에서.
    3. 스프레드시트를 사용 하 여, Ct 값을 사용 하 여 각 샘플의 평균을 계산 합니다. 다음, 수식을 클릭 하 고 평균을 선택 합니다. 각 샘플 (복제)의 평균 CT 값 추가 분석을 위해 사용 됩니다.
    4. 다음, 계산 하는 수식 ΔCt을 사용 하 여 ΔCt = 평균 대상 유전자의 Ct-코네티컷 제어 유전자의 평균 (이 경우, ΔCt = 평균 ZIKV 유전자의 Ct-코네티컷 B2M 유전자의 평균).
    5. 계산 하는 데이터를 정규화 하는 ΔΔCt (이 경우, ΔΔCt = ΔCt ZIKV 샘플-B2M 샘플).
    6. 배 모든 정규화 단일 ΔΔCt 값에 대 한 수식 2^-(ΔΔCt)를 입력 하 여 유전자 발현을 증가 계산 합니다. 이전 연구9,10에 설명 된 대로 통계 테스트 배 증가의 결과 얻을 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

그림 1, 에이드 프로토콜 수행에 관련 된 모든 단계의 단계별 도표 그림이 이다. 그것은 DENV에 기존의 면역 인 에이드의 ZIKV의 전체 절차를 보여주는 회로도입니다. 그림 2 는 어떻게 인간의 혈 청 샘플 세 가지 그룹으로 분류 되었다: DENV 감염 확인 샘플 이라고 DENV에 감염 된 그룹, DENV 항 체 확인 샘플은 DENV 노출 그룹으로 하 고 건강 한 DENV 중화 항 체 또는 RNA 개인 세라 건강 한 제어 (HC) 그룹을 이라고 합니다. (그림 2)입니다.

모든 혈 청 샘플 ZIKV와 단지를 만들기 위해 허용 되었다 고 대 식 세포 세포를 감염 하는 데 사용 했다. 48 h 바람직합니다, 후 RNA 추출 하 고 qRT-PCR을 복종 되었다. 그림 3 에 대표적인 실험 DENV serotype 1 ~ 4 항 체를 포함 하는 세라의 대부분은 서로 다른 수준에서 ZIKV 복제를 향상 시킬 수 보여줍니다. ZIKV titers에 가장 높은 증가 1, 3, ZIKV의 비교적 적은 유도 보여준 serotype에 비해 DENV serotype 2, 4 항 체를 포함 하는 세라로 치료 하는 세포에서 발견 되었다.

Figure 1
그림 1 : 에이드 프로토콜의 도표 그림. 단계별 그림 전체 프로토콜에 관련 된 모든 단계를 보여 줍니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 : 실험 절차의 도식. 세 가지 유형의 세라 Zika 바이러스 incubated 했다. 그룹 DENV RNA 긍정적인 (DENV 감염) 샘플의 구성. DENV 항 체 양성 (DENV 노출) 샘플 그룹 II에 의하여 이루어져 있다. DENV RNA 또는 항 체 (건강 한 컨트롤) 샘플 그룹 III에 의하여 이루어져 있다. 바이러스-세라 혼합물 인간의 세포와 계량 감염에 추가 되었습니다. 이 그림은 Londono Renteria 외.8에서 수정 되었습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3 : DENV 면역 세라 향상 기본 인간의 세포에 ZIKV 감염. DENV 항 체를 포함 하는 인간의 세라 (DENV1-4 serotype 확인, Col serotype 알 수 없는) 또는 건강 한 컨트롤에서 1:10,000에 1:10 희석된 되었고 ZIKV와 알을 품을. 세라 표 1에 설명 되어 있습니다. 기본 절연 된 인간의 세포 혼자 ZIKV 또는 ZIKV-세라 혼합물으로 감염 되었다. () DENV1 항 체를 포함 하 세라. (b) DENV2 항 체를 포함 하 세라. (c) DENV3 항 체를 포함 하 세라. (d) DENV4 항 체를 포함 하 세라. (e) DENV 항 체 세라 콜롬비아 개별 1에서. (f) DENV 항 체 세라 콜롬비아 개별 2에서. 감염 48 h 바람직합니다에서 qRT-PCR 분석에 의해 측정 되었다. 기술 및 생물 복제는 3 중에서 수행 되었다. 데이터는 풀링된 및 오차 막대 표준 편차를 나타냅니다. 학생의 t-테스트와 ANOVA 통계 분석을 위해 사용 되었다. P < 0.001. 이 그림은 Londono Renteria 외.8에서 수정 되었습니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Table 1
표 1: qRT-PCR의 열 프로 파일.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

다른 DENV serotypes 에이드로 이어지는 DENV 항 체의 분11효과적인 백신 개발을 방해 했다. ZIKV 같은 가족 Flaviviridae에 속해 있으며 다른 flaviviruses, 특히 DENV12와 상당한 상 동. ZIKV와 DENV에 대 한 항 체를 중화의 주요 목표 두 바이러스13,,1415사이 매우 높은 구조 및 제 사기 순서 상 동을 공유 하는 봉투 단백질 이다. 그것은 DENV 또는 ZIKV를 사전 면제 다른 바이러스8,16의 감염을 향상 시킬 수 입증 되었습니다.

상 패 분석 실험17에서 이르기까지 에이드 실험에서 바이러스 infectivity 척도를 고용 하는 다른 방법의 수 있다, 형광 성 염료와 cytometry18 활용 된 세포내 바이러스 항 원 항 체를 사용 하 여 얼룩 ,19. 이 분석 실험 시간과 하지 쉽게 적응 여러 샘플의 높은 처리량에 대 한 동시에 있습니다. 중요 한 것은, 대부분 연구의 ZIKV에 그들의 효과 확인 하기 DENV 특정 단일 클론 항 체를 사용 하 고 셀 라인만20,21에이드를 검사. 이 프로토콜에서 우리는 우리 능력을가지고 있는 중화 DENV에 대 한 기본 인간의 면역 세포, 채용 하 여 ZIKV 복제에 환자 혈 청의 영향을 검사를 함께 인간의 미리 면역 혈 청 샘플을 사용 하는 간단 하면서도 효과적인 방법 설명 qRT-PCR입니다. 이 방법은 강력 하 고, 관련, 이며 3 일에 완료 될 수 있다. 이 원고에서 대표 결과 ZIKV에 대 한 응용 프로그램, 비록이 프로토콜 수 있습니다 쉽게 수정 되며 황열병 바이러스, 뎅기열 바이러스 및 웨스트 나 일 바이러스 같은 다른 flaviviruses에 대 한 사용. 고려해 야 할 한 가지 중요 한 요소는이 프로토콜 성숙 하 고 미 성숙한 바이러스 성 RNA 사이 구별에 한계가 있다.

프로토콜, 동안 그것은 환경 RNase 무료 보장 RNA 추출 수행할 때 신중에 게 중요 한 단계를 처리 하는 모든 RNA 동안. 또한, 바이러스 성 주식 1-2 분 동안 물 목욕에서 37 ° C에서 해 동 한다 고 즉시 얼음에 넣어. 그러나, 바이러스 하지 지켜져야 한다 얼음에 대 한 만큼, 다음, 그것은 그것의 infectivity 잃을 수 있다.

이전 결과이 프로토콜은 매우 편리 하 고 많은 수의 샘플을 처리할 수 있는 하 고 다른 방법 보다 상대적으로 짧은 시간에 완료할 수 있습니다 설명 했다. 이 프로토콜 미래 에이드 연구에 유용한 분석 결과로 사용할 가능성이 있다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 선언할 수 없다.

Acknowledgments

이 작품 (T.M.C.)에 1R21AI129881-01, 국가 신흥 전염 성 질환 연구소, 그리고 보스턴 대학 학부에서 시작 자금 아낌없이 지원 했다.

Materials

Name Company Catalog Number Comments
Fetal Bovine Serum  GEMINI 100-106
iCycler  BioRad 785BR02188 Model No. CFX96 Optics Module
Microfuge 18 Centrifuge Beckman Coulter  367160
Nanodrop-1000 Thermoscientific  1072
Quantifast SYBR-One step RT-PCR kit  Qiagen  204154 Used for 1 step RT-qPCR
RNeasy RNA Isolation Kit  Qiagen  74106 Used for RNA extraction
RPMI-medium  Gibco 11875093

DOWNLOAD MATERIALS LIST

References

  1. Hayes, E. B. Zika virus outside Africa. Emerging Infectious Diseases. 15, 1347-1350 (2009).
  2. Grard, G., et al. Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus. PLoS Neglected Tropical Diseases. 8, (2), 2681 (2014).
  3. Fauci, A. S., Morens, D. M. Zika Virus in the Americas--Yet Another Arbovirus Threat. New England Journal of Medicine. 374, (7), 601-604 (2016).
  4. Hawkes, R. A. Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls. Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).
  5. Musso, D., Gubler, D. J. Zika Virus. Clinical Microbiology Reviews. 29, (3), 487-524 (2016).
  6. Vaughn, D. W., et al. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. The Journal of Infectious Diseases. 181, (1), 2-9 (2000).
  7. Khandia, R., et al. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection. Frontiers of Immunology. 9, 597 (2018).
  8. Londono-Renteria, B., et al. A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement. Journal of General Virology. 98, (7), 1702-1712 (2017).
  9. Ganger, M. T., Dietz, G. D., Ewing, S. J. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments. BMC Bioinformatics. 18, (1), 534 (2017).
  10. Renn, L. A., et al. High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes. Journal of Visualized Experiments. (97), e52650 (2015).
  11. McArthur, M. A., et al. Dengue vaccines: recent developments, ongoing challenges and current candidates. Expert Review of Vaccines. 12, (8), 933-953 (2013).
  12. Priyamvada, L., et al. Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology. Emerging Microbes and Infections. 6, (5), 33 (2017).
  13. Dai, L., et al. Molecular basis of antibody-mediated neutralization and protection against flavivirus. IUBMB Life. 68, (10), 783-791 (2016).
  14. Dai, L., et al. Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody. Cell Host & Microbe. 19, (5), 696-704 (2016).
  15. Sirohi, D., et al. The 3.8 A resolution cryo-EM structure of Zika virus. Science. 352, (6284), 467-470 (2016).
  16. George, J., et al. Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques. Scientific Reports. 7, (1), 10498 (2017).
  17. Morens, D. M., Halstead, S. B. Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies. Journal of General Virology. 71, Pt 12 2909-2914 (1990).
  18. Dejnirattisai, W., et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science. 328, (5979), 745-748 (2010).
  19. Priyamvada, L., et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7852-7857 (2016).
  20. Charles, A. S., Christofferson, R. C. Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro. PLoS Currents. 8, (2016).
  21. Swanstrom, J. A., et al. Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus. MBio. 7, (4), (2016).
기본 인간 세포에서 Zika 바이러스의 항 체 의존 향상의 정량화
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).More

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter