Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Antikor-bağımlı donanýmýn birincil insan hücrelerinde Zika şunun miktar

doi: 10.3791/58691 Published: January 18, 2019

Summary

Biz insan serumu, birincil insan hücreleri ve enfeksiyon miktar nicel gerçek zamanlı polimeraz zincir reaksiyonu tarafından kullanarak Zika virüs enfeksiyonu önceden varolan bağışıklık dang virüs karşı etkisini değerlendirmek için bir yöntem açıklanmaktadır.

Abstract

Flavivirus Zika ve Guillain-Barré sendromu ve bebeklerde, microcephaly gibi nörolojik komplikasyonlara son ortaya çıkması ciddi genel güvenlik endişeleri getirdi. Son yeniden doğuş Zika virüs (ZIKV) öncelikle alanlarda nerede nüfus maruz kalmış ve öncesi dokunulmazlık için diğer yakından ilgili bir durumda olduğu gibi risk faktörleri arasında en ciddi tehdit, antikor bağımlı geliştirme (ADE) teşkil etmektedir flaviviruses, özellikle dang virüs (DENV). Burada, DENV karşı insan serum antikor ZIKV enfeksiyon birincil insan hücreleri veya hücre hatları üzerinde etkisini miktarının bir protokol açıklayın.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Sivrisinekler yoluyla bulaşan viral hastalıklar arasında Zika enfeksiyon en klinik olarak önemli1biridir. Enfeksiyon flavivirus kullandığı, çoğu durumda, Aedes aegypti onun birincil vektör1,2ZIKV neden olur. Ancak, Aedes albopictus bazı ZIKV salgınlar3birincil bir vektör olarak bildirdin çalışma vardır. Enfeksiyon birçok durumda asemptomatik olmakla birlikte, hastalığın en yaygın belirtileri ateş, baş ağrısı ve kas ağrı2vardır. Herhangi bir tedavi veya aşı ZIKV enfeksiyonu için kullanılabilir ve mevcut tedavi çoğunlukla destek oluyor. ZIKV Güney Amerika'da son salgınları şiddetli vakalarda hastalık ve yaklaşık 20-fold microcephaly2adlı fetusa nörogelişimsel bozuklukta artışa yol açtı. Güney Amerika DENV ve Batı Nil virüsü gibi birkaç arboviruses endemik bir alan olduğu için diğer flavivirus(es) için önceden dokunulmazlık, ZIKV enfeksiyonlar ve hastalık şiddetinde bir rol oynar olup olmadığını araştırmak çok önemlidir.

Çağlar boyunca, virüs infektivite konak hücre makine almak ve antiviral yanıt bastırmak için onların şansını artırmak için farklı stratejiler geliştirmişlerdir. Biri en büyüleyici tüm ana bilgisayar önceden bağışıklık antikorlar yanında onların çoğaltma fenomen ADE4ile geliştirmek için virüs kullanımıdır. ADE DENV tüm dört serotipleri arasında iyi okudu ve viral titreleri ve hastalık sonucu5,6,7artırmak için kanıtlanmış oldu. Bir önceki tüp bebek çalışmada, önceden var olan birincil insan bağışıklık hücreleri8DENV bağışıklık nedeniyle ZIKV çoğaltma önemli enhancement göstermiştir. Biz de ZIKV çoğaltma primer hücre içinde geliştirmek için DENV önceden varolan antikor kapasitesini ölçmek için ilgili bir tüp bebek yöntemi gösterdi.

TCID-50 DENV nötralize için test edilir insan serum numuneleri geliştirdiğimiz protokolünü kullanan veya plak azaltma nötralizasyon testi (PRNT), ZIKV biyolojik ilgili hücre veya hücreleri ZIKV bulaşabilir dokulardan türetilmiş birlikte deneyleri.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu çalışmada kullanılan serum numuneleri bir kohort Columbia insan katılımcılardan elde edilmiştir. Örnek koleksiyon Universidad de Pamplona (Columbia, Güney Amerika) ve Los Potios hastane8iç gözden geçirme Kurulu (IRB) tarafından kabul edildi. Örnekleri anonim olarak verilmiştir ve müfettişler hasta bilgi erişim vardı. Serum numuneleri için DENV serotip kontrol edildi. Örnekleri daha fazla DENV enfeksiyon nötralize etmek için teyit edildi tüp bebek. Kumanda pilleri, serum numuneleri ABD sağlıklı bireylerden (HC) kullanılmıştır.

Not: Bu iletişim kuralı, Fcγ reseptör ifade herhangi bir insan hücre tipi ZIKV ADE çoğaltmasında incelemek için kullanılabilir. Protokol üç oluşur parçaları (Şekil 1).

1. hücre tohum ve enfeksiyon Kurulum

Not: Bu belirli çalışma, insan birincil makrofajlar veya U937 myelomonocytic hücre satırı (ATCC-CRL-1593.2) için kullanılmıştır. Hücreleri RPMI büyüme orta % 10 fetal Sığır serum ile (FBS) takıma 37 ° C kuluçka %5 karbondioksit (CO2) ile muhafaza. Tüm adımları bir Biyogüvenlik yapılmıştır 2 (BSL-2) Biyogüvenlik kabini steril koşullarda seviye.

  1. Tohum 3 x 104 hücre başına bir steril düz-alt 96-şey plaka ile birlikte orta 100 µL iyi ve 37 ° C kuluçka %5 CO2koyun.
  2. Hücreleri tohum sonra serum numuneleri, oda sıcaklığında erimek ve 10 kat seri dilutions yapmak (yani, 1/10, 1/100, 1/1000, 1/10.000) serum-Alerjik orta örneklerinde karıştırma tarafından. Aliquot steril bir 96-şey plaka içine dilutions. Serum olmadan virüs ek bir denetim kullanın.
  3. ZIKV hisse senedi 1-2 min için bir su banyosunda 37 ° C'de erimek ve hızlı bir şekilde gelecekte kullanılmak üzere buz aktarabilirsiniz.
  4. ZIKV gerilme MR766 enfeksiyonu (MOI) eşit miktarda 0.1 çokluğu serum aliquots ekleyin.
    Not: Seyreltme faktörü sabit kalır ve toplam hacim ~ 200 µL olduğundan emin olun; triplicates her tedavi için yeterli olduğunu. Üç kuyular için aşağı akım analizi negatif kontrol kullanmak için bulaşmamış tutun.
  5. Serum dilutions % 5 CO2 için 1 h 37 ° C kuluçka eklenen virüs ile DENV karşı antikorlar formu kompleksleri Zika virions (için kullanışlı, bundan sonra "bağışıklık kompleksleri" anılacaktır) ile için izin vermek için kuluçkaya.
  6. Düz-alt 96-şey plaka numaralı seribaşı hücreleri medyadan Aspire edin. Steril 1 fosfat tamponlu tuz (1 x PBS) x hücrelerle yıkayın.
  7. Her şey için bağışıklık kompleksleri 50 µL ekleyin ve onları %5 CO2 37 ° C kuluçka 2s için kuluçkaya.
  8. 2 h, kuluçka, Aspire edin hücrelerden bağışıklık kompleksleri içeren medyayı kullanarak bir çok kanallı pipet sonra hücre 2 yıkama x 1 x PBS tamamen bağışıklık kompleksleri ve herhangi bir bekâr virions kaldırmak için ile.
  9. 100 µL FBS her şey ve hücrelerin % 5 CO2 37 ° C kuluçka 48 h için kuluçkaya % 10 ile takıma taze tam medya ekleyin.

2. RNA çıkarma

  1. 96-şey plaka kuluçka makinesi kaldırmak ve Biyogüvenlik kabini aktarın.
  2. Medya Aspire edin, hücreleri 2 yıkama x 1 x PBS ile ve RNA ayıklama için devam edin.
    Not: RNA çıkarılan seçim herhangi bir yöntemle ( Malzemeler tabloiçin bakınız).
  3. Hücre lizis arabelleği ile % 10 β-mercaptoethanol şey başına 250 µL ekleyin. Pipet ucu kadar lizis prosedürü hızlandırmak için hücrelerle tırmalamak ile birlikte en az 5 x yukarı ve aşağı arabellek pipette.
  4. Hücre lysates yeni, etiketli, steril 1,5 mL tüpler için transfer.
  5. % 70 etanol (250 µL) eşit miktarda ekleyin. Karışım temizlenene kadar x - 5 x 4 yukarı ve aşağı pipet.
  6. 15.000 x g 30 s. atma için santrifüj kapasitesi ile akışı ve karışımı (~ 500 µL) silis tabanlı sütunlar 2 mL koleksiyonu tüpler transfer ve sütunları aynı koleksiyon tüplerde tutmak.
  7. Yıkama arabelleği 1 700 µL her sütununu ekleyin ve 15.000 x g 30 s. atma için aracılığıyla akış santrifüj kapasitesi ve sütunları aynı koleksiyon tüplerde tutmak.
  8. Her sütun ve santrifüj yıkama arabelleğinin 2 500 µL 15.000 x g 30 s. atma süpernatant için ekleyin. 2 x bu adımı yineleyin.
  9. Transfer sütunları yeni 2 mL koleksiyonu tüpler ve 2 dk. silis tabanlı sütunlar tamamen kuru olsun ve orada hiçbir etanol sağlamak için 15.000 x g , santrifüj yıkama arabelleğinden 2 yaptı.
  10. 2 mL tüpler atın ve sütunlarda yeni, steril, etiketli, 1,5 mL kurtarma tüpler yerleştirin.
  11. Her sütun ve 1 dak için 15.000 x g , santrifüj ortasındaki prewarmed (42 ° C) 30 µL RNase free su ekleyin.
  12. Eluted RNA yeniden elde etmek ve bir spektrofotometre bir 260 nm dalga boyu kullanarak örnekleri, ölçmek.
    Not: İdeal olarak, RNA saflığı 260 absorbans değerleri arasındaki oran hesaplayarak belirlemek nm ve 280 nm. Arıtılmış RNA'ın 260/280 ideal 1.8-2.0 orandır.

3. kantitatif gerçek zamanlı polimeraz zincir reaksiyonu

Not: Nicel gerçek zamanlı polimeraz zincir tepkimesi (PCR qRT) genellikle SYBR ben boya yeşil, Taq DNA polimeraz, deoxynucleotide trifosfatlardan (dNTPs) ve pasif bir boya oluşan herhangi bir SYBR yeşil karışımı kullanılarak yapılabilir. Herhangi bir qPCR makine SYBR yeşil tespiti kabil reaksiyonu gerçekleştirmek ve verileri elde etmek için kullanılabilir. Bu deneme için bir tek adımlı RT-PCR kiti SYBR yeşil kokteyl aldım kullanıldığı ben, ROX boya, Taq DNA polimeraz, dNTPs ve transkriptaz ek bir karışımı ( Tablo malzemeleriçin başvurmak). Zarf bölge karşı tasarlanmış ve ZIKV genomik düzeylerini ölçmek için bu çalışmada kullanılan astar ZIKV-qF için CCGCTGCCCAACACAAG ve CCACTAACGTTCTTTTGCAGACAT ZIKV-qR için vardır. İnsan β-2-mikroglobulin (b2a) ölçülen ve ZIKV (kat hizmetleri gen) ifade normalleştirmek için kullanılan bir denetim. Bu çalışmada kullanılan b2a gen ekspresyonu ölçmek için astar dizileri b2a-qF için CTCCGTGGCCTTAGCTGTG ve TTTGGAGTACGCTGGATAGCCT b2a-qR için vardır. Her örnek için üç teknik çoğaltır ZIKV ve b2a genler için koymak için emin olun. RT-PCR Kur aşağıda kısaca açıklanmıştır.

  1. RT-PCR Kur
    1. Örnek başına kullanım 100 ng RNA'ın.
    2. 1 µL ileriye ve geriye doğru astar her reaksiyon için belirli bir gen 10 µM stokları ekleyin.
    3. Ters transkriptaz Mix örnek başına 0,25 µL ekleyin.
    4. Her bireysel tepki için 12.5 µL SYBR yeşil karışımı ekleyin.
    5. En çok 25 µL su ekleyin. RNA, aliquot dışında tüm yukarıda belirtilen reaktifler, 96-şey PCR tabak içinde karıştırın ve RNA son eklemek bir şablonu alın.
    6. Şeffaf Yapışkan bant ile plaka mühür.
    7. 1000 x g reaktifleri karıştırmak 1 dk için plaka santrifüj kapasitesi.
    8. Plaka qPCR alete koyayım.
  2. RT-PCR profili
    Not: Tablo 1gösterilen RT-PCR profili kullanın.
    1. Örnekleri için 10 min 50 ° c tamamlayıcı DNA (cDNA) sentezi sağlamak için kuluçkaya.
    2. CDNA sentez sonra Taq DNA polimeraz 95 ° c 5 min için aktif hale getirin.
    3. 10 s ve astar tavlama ve uzantısı için 30 60 ° C'de denatürasyon 95 ° C'de 40 döngüleri gerçekleştirmek s.
    4. Ek eritebilir eğrisi adım (65 ° C) sonunda koyun.
  3. Veri Analizi
    1. Algori gösteren, ideal olarak, tek bir tepe tek bir amplicon ve bir amplifikasyon değeri varlığını doğrulamak belirli bir gen için tüm örneklerde fazla 1,6 Eğer qPCR makine çalıştırmak için kullanılan programın içinde erime eğrisi sekmesini tıklayarak eritebilir eğrisi izlemek THM 2 (amplifikasyon değeri qPCR makine tarafından kullanılan algoritmaya göre değişir) % 100 amplifikasyon değer olarak düşünür. 0.5 ° C sıcaklık artışları merdivenleri ve en az 10 saat holding arasında kullandığınızdan emin olun en iyi sonuçlar için erime eğrisi protokolündeki s.
    2. Emin yaptıktan sonra bir tek amplicon ve iyi amplifikasyon değer, ilk tıklayın bir nicel döngüsü (Ct/Cq değer) her örnek alın ve Microsoft Excel'e aktarmak için miktar veri sekmesinde.
    3. Bir elektronik tablo kullanarak, Ct değeri kullanarak her örnek ortalamasını hesaplamak. Ardından, formüller'i tıklatın ve ortalama seçin. Her örneği (çoğaltma) ortalama CT değerler daha ayrıntılı bir çözümleme için kullanılır.
    4. Daha sonra formül ΔCt kullanarak ΔCt hesaplamak = Ct hedef gen ortalama - Ct denetim gen ortalama (Bu durumda, ΔCt = ZIKV gen Ct ortalama - Ct b2a gen Ortalama).
    5. ΔΔCt verileri normalleştirmek için hesaplamak (Bu durumda, ΔΔCt ΔCt ZIKV örnekleri - b2a örnekleri =).
    6. Her tek ΔΔCt normalleştirilmiş değeri için formül 2^-(ΔΔCt) yazarak gen ekspresyonu kat artırmak hesaplayın. İstatistiksel testler gerçekleştirmek için kat artış sonuçlarını daha önceki çalışmalar9,10' açıklandığı gibi elde edilebilir.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Şekil 1' de, ADE Protokolü taşımak için ilgili tüm adımları adım adım grafiksel gösterimi var. Bu DENV için ZIKV ADE tüm prosedürü önceden varolan dokunulmazlık nedeniyle gösteren bir Şematik diyagramı. Şekil 2 gösterir nasıl insan serum örnekleri üç farklı gruplar halinde kategorize: DENV enfeksiyon doğruladı örnekleri DENV enfekte grup olarak bilinir, DENV antikor-teyit örnekleri DENV maruz kalan grup olarak da adlandırılır ve sağlıklı bireylerin sera DENV nötralize antikorlar veya RNA sağlıklı kontrol (HC) Grup adı verilir. (Şekil 2).

Serum numuneleri kompleksleri ile ZIKV yapmak için izin verildi ve daha sonra makrofaj hücre bulaştırmak için kullanılmıştır. 48 saat postinfection sonra RNA çıkarılan ve qRT-PCR için tabi. Şekil 3 temsilcisi deneyde çoğu sera DENV serotip 1-4 antikor içeren ZIKV çoğaltma farklı düzeylerde geliştirmek mümkün olduğunu gösterir. ZIKV titreleri en yüksek artış DENV serotip 2 ve 4 antikor serotip 1 ve ZIKV nispeten daha az bir indüksiyon gösterdi 3 ile karşılaştırıldığında içeren sera ile tedavi makrofajlar bulundu.

Figure 1
Resim 1 : Grafiksel gösterimi ADE protokolü. Bir adım adım tüm adımları dahil tüm iletişim kuralı gösterilmiştir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 : Deneysel yordam şematik. Sera üç tür Zika virüs ile inkübe. Grup DENV-RNA pozitif (DENV-enfekte) örnekleri oluşuyordu. Grup II DENV-antikor pozitif (DENV-maruz) örnekleri oluşuyordu. Grup III örnekleri DENV RNA veya antikor (sağlıklı kontrol) oluşuyordu. Virüs-sera karışımı insan makrofajlar ve sayısal enfeksiyon için eklendi. Bu rakam Londono Renteria vd.8' den değiştirildi. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3 : DENV bağışıklık sera geliştirir birincil insan makrofajlar enfeksiyonunda ZIKV. İnsan sera DENV antikorlar içeren (DENV1-4 serotip doğruladı, Col serotip bilinmeyen) veya sulandırılmış 1:10 1:10,000 için sağlıklı kontrol edildi ve ZIKV ile inkübe. Sera Tablo 1' de açıklanmıştır. Birincil izole insan makrofajlar ZIKV tek başına veya ZIKV-sera karışımları ile bulaşmış. (bir) DENV1 antikor içeren sera. (b) DENV2 sera antikor içeren. (c) DENV3 sera antikor içeren. (d) DENV4 sera antikor içeren. (e) DENV-antikor sera dan Kolombiya bireysel 1. (f) DENV-antikor sera Kolombiya bireysel 2 üzerinden. Enfeksiyon qRT-PCR analizi, 48 h postinfection tarafından ölçüldü. Teknik ve biyolojik çoğaltır nüsha yapıldı. Verileri havuza ve hata çubukları standart sapma gösterir. Öğrenci t-testi ve ANOVA istatistiksel analiz için kullanılmıştır. P < 0,001. Bu rakam Londono Renteria vd.8' den değiştirildi. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Table 1
Tablo 1: QRT-PCR termal profili.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Olan diğer DENV serotipi ADE için önde gelen DENV antikorların bir etkili aşı11gelişimine engel. ZIKV Flaviviridae, aynı ailesine ait ve diğer flaviviruses, özellikle DENV12ile önemli bir Homoloji vardır. Hem ZIKV hem de DENV için antikorları nötralize ana hedef çok yüksek yapısal ve Kuvaterner sırası Homoloji arasında iki virüs13,14,15hisse zarf proteindir. Ya DENV ya da ZIKV öncesi dokunulmazlık diğer virüs8,16enfeksiyonu artırabilir kanıtlanmıştır.

Orada birkaç farklı yöntem viral infektivite ADE deneylerde, plak deneyleri17arasında değişen ölçmek için istihdam, hücre içi viral antijen antikorları kullanarak boyama floresan boyalar ve akış sitometresi18 ile Birleşik ,19. Bu deneyleri aynı anda zaman alıcı ve kolayca yüksek-den geçerek birden çok örnekleri için uyarlanabilir. Önemlisi, çalışmaların en DENV özgü monoklonal antikorlar ZIKV üzerindeki etkileri kontrol etmek için kullanılan ve hücre hatları sadece20,21ADE inceledi. Bu protokol için biz hangi biz birincil insan bağışıklık hücreleri, hastanın serum etkisi ZIKV çoğaltma istihdam ederek incelemek için birlikte DENV karşı bir nötralize yeteneğine sahip insan önceden bağışık serum numuneleri kullanılan basit ama etkili bir yöntem tarif qRT-PCR. Bu yöntem sağlam, ilgili ve üç gün içinde tamamlanabilir. Bu el yazması temsilcisi sonuçlarında ZIKV için uygulama göstermesine rağmen bu iletişim kuralı kolayca değiştirilebilir ve sarı humma virüsü, Dang virüs ve Batı Nil virüsü gibi diğer flaviviruses için kullanılır. Bir önemli faktör dikkate bu protokol olgun ve olgunlaşmamış viral RNA ayrım bir sınırlama olmasıdır.

İletişim kuralı sırasında çevre RNase free olduğunu kontrol ettikten RNA çekimi yaparken dikkatli bir değerlendirme vermek için kritik adımlar işleme RNA sırasında. Ayrıca, viral hisse senetleri 1-2 min için bir su banyosunda 37 ° C'de çözdürülen ve hemen buza koymak gerekir. Sürece, o zaman, onun infektivite kaybedebilir için ancak, virüs buz üstünde tutulmalıdır değil.

Önceki sonuçları bu iletişim kuralı son derece uygun ve çok sayıda örnekleri işlemek için uyarlanabilir ve diğer yöntemlere göre nispeten daha az zamanda tamamlanabilir gösterdi. Bu iletişim kuralı yararlı bir tahlil gelecekteki ADE çalışmaları için kullanılan potansiyeline sahiptir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar bildirmek için bir şey yok.

Acknowledgments

Bu eser cömertçe 1R21AI129881-01 (T.M.C. için) başlangıç fonlar Ulusal ortaya çıkan bulaşıcı hastalıklar laboratuvarları ve Boston Üniversitesi Tıp Fakültesi tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
Fetal Bovine Serum  GEMINI 100-106
iCycler  BioRad 785BR02188 Model No. CFX96 Optics Module
Microfuge 18 Centrifuge Beckman Coulter  367160
Nanodrop-1000 Thermoscientific  1072
Quantifast SYBR-One step RT-PCR kit  Qiagen  204154 Used for 1 step RT-qPCR
RNeasy RNA Isolation Kit  Qiagen  74106 Used for RNA extraction
RPMI-medium  Gibco 11875093

DOWNLOAD MATERIALS LIST

References

  1. Hayes, E. B. Zika virus outside Africa. Emerging Infectious Diseases. 15, 1347-1350 (2009).
  2. Grard, G., et al. Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus. PLoS Neglected Tropical Diseases. 8, (2), 2681 (2014).
  3. Fauci, A. S., Morens, D. M. Zika Virus in the Americas--Yet Another Arbovirus Threat. New England Journal of Medicine. 374, (7), 601-604 (2016).
  4. Hawkes, R. A. Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls. Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).
  5. Musso, D., Gubler, D. J. Zika Virus. Clinical Microbiology Reviews. 29, (3), 487-524 (2016).
  6. Vaughn, D. W., et al. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. The Journal of Infectious Diseases. 181, (1), 2-9 (2000).
  7. Khandia, R., et al. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection. Frontiers of Immunology. 9, 597 (2018).
  8. Londono-Renteria, B., et al. A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement. Journal of General Virology. 98, (7), 1702-1712 (2017).
  9. Ganger, M. T., Dietz, G. D., Ewing, S. J. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments. BMC Bioinformatics. 18, (1), 534 (2017).
  10. Renn, L. A., et al. High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes. Journal of Visualized Experiments. (97), e52650 (2015).
  11. McArthur, M. A., et al. Dengue vaccines: recent developments, ongoing challenges and current candidates. Expert Review of Vaccines. 12, (8), 933-953 (2013).
  12. Priyamvada, L., et al. Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology. Emerging Microbes and Infections. 6, (5), 33 (2017).
  13. Dai, L., et al. Molecular basis of antibody-mediated neutralization and protection against flavivirus. IUBMB Life. 68, (10), 783-791 (2016).
  14. Dai, L., et al. Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody. Cell Host & Microbe. 19, (5), 696-704 (2016).
  15. Sirohi, D., et al. The 3.8 A resolution cryo-EM structure of Zika virus. Science. 352, (6284), 467-470 (2016).
  16. George, J., et al. Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques. Scientific Reports. 7, (1), 10498 (2017).
  17. Morens, D. M., Halstead, S. B. Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies. Journal of General Virology. 71, Pt 12 2909-2914 (1990).
  18. Dejnirattisai, W., et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science. 328, (5979), 745-748 (2010).
  19. Priyamvada, L., et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7852-7857 (2016).
  20. Charles, A. S., Christofferson, R. C. Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro. PLoS Currents. 8, (2016).
  21. Swanstrom, J. A., et al. Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus. MBio. 7, (4), (2016).
Antikor-bağımlı donanýmýn birincil insan hücrelerinde Zika şunun miktar
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).More

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter