Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Kwantificering van antilichaam-afhankelijke versterking van het Zika-Virus in primaire menselijke cellen

doi: 10.3791/58691 Published: January 18, 2019

Summary

Beschrijven we een methode om te evalueren van het effect van reeds bestaande immuniteit tegen dengue virus op de Zika-virus-infectie met behulp van menselijk serum, primaire menselijke cellen en kwantificering van de infectie door kwantitatieve real-time polymerasekettingreactie.

Abstract

De recente opkomst van de flavivirus Zika en neurologische complicaties, zoals Guillain-Barré syndroom en microcefalie bij zuigelingen, heeft geleid tot bezorgdheid over de ernstige openbare veiligheid. Onder de risicofactoren vormt antilichaam-afhankelijke versterking (ADE) de belangrijkste bedreiging, zoals de recente re-opkomst van de Zika-virus (ZIKV) is vooral in gebieden waar de bevolking is blootgesteld en is in een staat van pre immuniteit aan andere nauw verwante flavivirussen, vooral dengue virus (DENV). Hier beschrijven we een protocol voor het kwantificeren van het effect van menselijk serum antilichamen tegen DENV op ZIKV infectie in primaire menselijke cellen of cellijnen.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Onder de muggen overgebrachte virale ziekten is Zika infectie een van de meest klinisch belangrijk1. De infectie wordt veroorzaakt door de flavivirus ZIKV met, in de meeste gevallen, Aedes aegypti als zijn voornaamste vector1,2. Echter, er zijn studies die door Aedes albopictus worden gerapporteerd als een primaire vector in sommige ZIKV uitbraken3. Hoewel de infectie asymptomatisch in veel gevallen is zijn de meest voorkomende symptomen koorts, hoofdpijn en spier pijn2. Er is geen behandeling of vaccin beschikbaar voor ZIKV infectie en de beschikbare behandeling is meestal ondersteunende. Recente uitbarstingen van ZIKV in Zuid-Amerika leidde tot ernstige gevallen van de ziekte en een ongeveer 20-fold toename van de neurologische stoornis in foetussen microcefalie2genoemd. Omdat Zuid-Amerika een gebied is endemisch in verschillende arboviruses zoals DENV en West-Nijl virus, is het van cruciaal belang om te onderzoeken of voorafgaande immuniteit aan andere flavivirus(es) een rol in de ernst van de ZIKV infecties en ziekte speelt.

Door de eeuwen heen, zijn virussen geëvolueerd verschillende strategieën om te vergroten hun kans op besmettelijkheid overnemen van de ontvangende cel machines te onderdrukken de antivirale reactie. Een van de meest fascinerende van alles is het gebruik van host vooraf immune antilichamen door virussen ter verbetering van hun replicatie met het fenomeen ADE4. ADE in alle vier serotypen van DENV geweest goed bestudeerd en aangetoond om virale titers en ziekte resultaat5,6,7te verhogen. In een vorige in vitro onderzoek, hebben we significante verhoging van ZIKV replicatie toe te schrijven aan de reeds bestaande DENV immuniteit in primaire menselijke immune cellen8aangetoond. We toonden ook aan een relevante in vitro methode om de mogelijkheid van DENV bestaande antilichamen te verbeteren ZIKV replicatie in primaire cellen te kwantificeren.

Het protocol dat wij hebben ontwikkeld maakt gebruik van menselijk serummonsters die zijn getest voor DENV neutralisatie in TCID-50 of plaque vermindering neutralisatie test (PRNT) testen, samen met ZIKV in biologisch relevante cellen of cellen die verkregen uit weefsels die ZIKV kunnen infecteren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Serummonsters gebruikt in deze studie werden verkregen van de menselijke deelnemers van een cohort van Columbia. Sample collectie werd goedgekeurd door de interne review board (IRB) bij Universidad de Pamplona (Columbia, Zuid-Amerika) en Los Potios ziekenhuis8. De monsters werden anoniem verstrekt en onderzoekers hadden geen toegang tot informatie voor de patiënt. De serummonsters werden gecontroleerd voor het serotype DENV. De monsters werden verder bevestigd te neutraliseren DENV infectie in vitro. Voor controle, werden serummonsters van gezonde individuen (HC) uit de VS gebruikt.

Opmerking: Dit protocol kan worden gebruikt om te onderzoeken van de replicatie van ADE van ZIKV in elk type van de menselijke cel uiting geven aan de Fcγ receptor. Het protocol bestaat uit drie delen (Figuur 1).

1. cellen zaaien en infectie Setup

Opmerking: Voor dit specifieke studie, menselijke primaire macrofagen of U937 MyeloMonocytaire cellijn (ATCC-CRL-1593.2) werden gebruikt. De cellen werden onderhouden in RPMI groeimedium aangevuld met 10% foetale runderserum (FBS) bij een incubator 37 ° C met 5% kooldioxide (CO2). Alles wat de stappen zijn uitgevoerd in een biosafety level 2 (BSL-2) bioveiligheid kabinet onder steriele omstandigheden.

  1. Zaad 3 x 104 cellen per goed in een steriele flat-96-Wells bodemplaat samen met 100 µL van medium en plaats ze in de incubator van de 37 ° C met 5% CO2.
  2. Na het zaaien van de cellen, serummonsters bij kamertemperatuur ontdooien en 10-fold seriële verdunningen maken (dat wil zeggen, 1/10, 1/100, 1/1.000, 1/10.000) door het mengen van de monsters in serumvrij medium. Aliquot de verdunningen in een steriele 96-wells-plaat. Gebruik het virus zonder serum als een extra controle.
  3. Ontdooi de ZIKV voorraad bij 37 ° C in een waterbad voor 1-2 min en snel overbrengen aan ijs voor toekomstig gebruik.
  4. Een 0.1 multipliciteit infectie (MOI) gelijkwaardig bedrag van ZIKV stam MR766 aan de serum aliquots toevoegen.
    Opmerking: Zorg ervoor dat de verdunningsfactor constant blijft en het totale volume ~ 200 µL is; dat is genoeg voor de triplicates van elke behandeling. Houd drie putten niet-geïnfecteerde te gebruiken als negatieve controle voor downstream-analyse.
  5. Incubeer de verdunningen van het serum met het toegevoegde virus in de incubator van de 37 ° C met 5% CO2 voor 1 h zodat de DENV-antilichamen tegen formulier complexen met de Zika-virionen (voor gemak, hierna te noemen "immuuncomplexen").
  6. De media van de cellen die werden zaadjes in de bodemplaat die flat-96-Wells gecombineerd. Wassen van de cellen met steriele 1 x met fosfaat gebufferde zoutoplossing (1 x PBS).
  7. Voeg 50 µL van de immuuncomplexen aan elk putje en hen uit te broeden in de incubator van de 37 ° C met 5% CO2 gedurende 2 uur.
  8. Na 2 uur incubatie, gecombineerd het medium met de immuuncomplexen uit de cellen, met behulp van een multichannel Pipetteer, en wassen van de cellen 2 x met 1 x PBS om de immuuncomplexen en eventuele niet-vastgemaakte virionen volledig te verwijderen.
  9. Voeg 100 µL van verse volledige media, aangevuld met 10% FBS aan elk goed en Incubeer de cellen in de incubator van de 37 ° C met 5% CO2 gedurende 48 uur.

2. RNA extractie

  1. Verwijder de 96-wells-plaat uit de incubator en overbrengen naar het biosafety kabinet.
  2. De media gecombineerd, wassen van de cellen 2 x met 1 x PBS, en ga naar RNA extractie.
    Opmerking: RNA kan worden geëxtraheerd door een methode van keuze (Zie de Tabel van de materialen).
  3. Voeg 250 µL van lysis van de cel buffer met 10% β-mercaptoethanol per putje. Pipetteer de buffer op en neer ten minste 5 x samen met krabben van de cellen met het uiteinde van de pipet om de lysis van de procedure te versnellen.
  4. De cel lysates overbrengen in nieuwe, gelabelde, steriele 1,5 mL tubes.
  5. Voeg een gelijke hoeveelheid van 70% ethanol (250 µL). Pipetteer op en neer 4 x - 5 x totdat het mengsel duidelijk is.
  6. Overbrengen in het mengsel (~ 500 µL) label silica gebaseerde kolommen in 2 mL collectie buizen en centrifugeer bij 15.000 x g gedurende 30 s. negeren de stroom door en houden van de kolommen in de dezelfde collectie buizen.
  7. 700 µL van was buffer 1 toevoegen aan elke kolom en centrifugeer bij 15.000 x g gedurende 30 s. negeren de stroom door en houden van de kolommen in de dezelfde collectie buizen.
  8. Voeg 500 µL van was buffer 2 aan elke kolom en centrifuge bij 15.000 x g voor 30 s. negeren het supernatant. Herhaal deze stap 2 x.
  9. Overdracht van de kolommen naar de nieuwe 2 mL collectie buizen en centrifugeer bij 15.000 x g gedurende 2 min. Zorg ervoor dat de silica gebaseerde kolommen helemaal droog krijgen en er geen ethanol is vertrok uit was buffer 2.
  10. Negeren van de 2 mL tubes en plaats de kolommen in nieuwe, steriele, label, 1,5 mL herstel buizen.
  11. Voeg voorverwarmde (42 ° C) 30 µL RNase-vrij water in het midden van elke kolom en centrifugeer bij 15.000 x g gedurende 1 minuut.
  12. Herstellen van de eluted RNA en kwantificeren van de monsters, met behulp van een spectrofotometer bij een 260 nm golflengte.
    Opmerking: In het ideale geval bepalen de zuiverheid van het RNA door berekening van de verhouding tussen de waarden van de extinctie op 260 nm en 280 nm. Gezuiverde-RNA's 260/280 verhouding ligt ideaal tussen 1.8-2.0.

3. kwantitatieve Real-time polymerasekettingreactie

Opmerking: Kwantitatieve real-time polymerasekettingreactie (qRT-PCR) kan worden uitgevoerd met behulp van een SYBR groen mix die meestal bestaat uit SYBR groene ik kleurstof, polymerase van DNA Taq, deoxynucleotide trifosfaat (dNTPs) en een passieve kleurstof. Elke staat is het opsporen van SYBR groene qPCR-machine kan uitvoeren van de reactie en het verwerven van de gegevens worden gebruikt. Voor dit experiment, was een one-step RT-PCR kit gebruikt die een cocktail van SYBR groen had ik, ROX kleurstof, polymerase van DNA Taq, dNTPs en een extra mengsel van reverse-transcriptase (Zie Tabel van materialen). De inleidingen ontworpen tegen de envelop-regio en wordt gebruikt in deze studie te kwantificeren ZIKV genomic niveaus zijn CCGCTGCCCAACACAAG voor ZIKV-qF en CCACTAACGTTCTTTTGCAGACAT voor ZIKV-qR. Als een besturingselement, werd menselijke β-2-microglobulin (B2M) gemeten en gebruikt voor het normaliseren van de expressie van ZIKV (huishouding gene). De primer sequenties te kwantificeren van de B2M genexpressie gebruikt in deze studie zijn CTCCGTGGCCTTAGCTGTG voor B2M-qF en TTTGGAGTACGCTGGATAGCCT voor B2M-qR. Zorgen om drie technische replicatieonderzoeken voor elk monster voor zowel de ZIKV als de B2M-genen. De installatie van de RT-PCR wordt hieronder kort beschreven.

  1. Installatie van de RT-PCR
    1. Gebruik 100 ng van RNA per monster.
    2. Voeg 1 µL van 10 µM voorraden van zowel voorwaartse als terugwaartse primers van een bepaald gen voor elke reactie.
    3. Voeg 0,25 µL van reverse-transcriptase mix per monster.
    4. Voeg voor elke individuele reactie, 12,5 µL van SYBR groen mix.
    5. Voeg maximaal 25 µL van water. Maak een meester mengen van alle bovengenoemde reagentia behalve RNA, aliquoot in de 96-Wells PCR plaat, en RNA laatst toevoegen.
    6. Het zegel van de plaat met doorzichtig plakband.
    7. Centrifugeer de plaat bij 1.000 x g gedurende 1 minuut mengen van de reagentia.
    8. Zet de plaat in de qPCR-machine.
  2. RT-PCR profiel
    Opmerking: De RT-PCR-profiel weergegeven in tabel 1 gebruiken.
    1. Incubeer de monsters bij 50 ° C gedurende 10 minuten met het oog op de synthese van cDNA (cDNA).
    2. Na de cDNA synthese, activeren de polymerase van DNA Taq bij 95 ° C gedurende 5 min.
    3. Uitvoeren van 40 cycli van denaturatie bij 95 ° C voor 10 s en primer gloeien en uitbreiding bij 60 ° C gedurende 30 s.
    4. Zet de extra smelt kromme stap (65° C) in het einde.
  3. Data-analyse
    1. De smelt-curve te controleren door te klikken op het tabblad kromme smelt in het programma gebruikt voor het uitvoeren van de qPCR machine, waarin, in het ideale geval een één piek in alle monsters voor een bepaald gen ter bevestiging van de aanwezigheid van slechts één amplicon en een amplificatie waarde meer dan 1.6 als de algoritmefu thm beschouwt 2 als de waarde van de 100%-amplificatie (de versterking-waarde is afhankelijk van het algoritme gebruikt door de qPCR-machine). Zorg ervoor dat u stappen van 0,5 ° C temperatuur tussen stappen en een minimale tijd van 10 houden s in het smelt kromme protocol, voor optimale resultaten.
    2. Na het maken van zeker dat er een interne amplicon en goede versterking waarde, klikt u eerst op op het tabblad gegevens kwantificering te krijgen van een kwantitatieve cyclus (Ct/Cq waarde) van elk monster en exporteren naar Microsoft Excel.
    3. Met behulp van een werkblad, wordt het gemiddelde van elk monster met behulp van de Ct-waarde berekend. Vervolgens klikt u in de formules en selecteer het gemiddelde. Het gemiddelde CT-waarden van elk monster (repliceren) worden gebruikt voor verdere analyse.
    4. Vervolgens berekent de ΔCt met behulp van de formule ΔCt = gemiddelde Ct van de target-gen - gemiddelde Ct van de controle-gen (in dit geval, ΔCt = gemiddelde Ct van de ZIKV-gen - gemiddelde Ct van de B2M-gen).
    5. Berekenen van ΔΔCt om te normaliseren van de gegevens (in dit geval, ΔΔCt = ΔCt ZIKV monsters - B2M monsters).
    6. Bereken dat de vouw verhogen genexpressie door te typen van de formule 2^-(ΔΔCt) voor elke waarde één ΔΔCt genormaliseerd. De resultaten van de-voudige toename uit te voeren statistische tests kunnen worden verkregen, zoals beschreven in eerdere studies9,10.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In Figuur 1is er een stapsgewijze Schematische illustratie van de stappen voor het uitvoeren van het ADE-protocol. Het is een schematisch diagram toont de hele procedure van ADE van ZIKV als gevolg van reeds bestaande immuniteit aan DENV. Figuur 2 toont hoe menselijk serum monsters werden onderverdeeld in drie verschillende groepen: DENV besmetting-bevestigd monsters worden aangeduid als de groep DENV-geïnfecteerde, DENV antilichaam-bevestigd monsters zijn bedoeld als de groep DENV-blootgesteld, en gezond individuen sera zonder DENV-neutraliserende antilichamen of RNA heten de gezonde controlegroep (HC). (Figuur 2).

Alle serummonsters mochten maken van complexen met ZIKV en werden vervolgens gebruikt om de macrofaag cellen infecteren. Na 48u postinfection, werd RNA uitgepakt en onderworpen aan qRT-PCR. Het representatieve experiment in Figuur 3 laat zien dat de meeste van de sera met DENV serotype 1 tot en met 4 antilichamen konden verbeteren ZIKV replicatie op verschillende niveaus. De hoogste stijging van de ZIKV titers werd gevonden in de macrofagen behandeld met sera met DENV serotype 2 en 4 antilichamen in vergelijking met serotype 1 en 3, waaruit bleek een relatief minder inductie van ZIKV.

Figure 1
Figuur 1 : Schematische afbeelding van het protocol van ADE. Een stap voor stap illustratie toont alle stappen betrokken bij het hele protocol. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : Schematische van de experimentele procedure. Drie soorten sera werden geïncubeerd met Zika-virus. Groep die ik bestond uit DENV-RNA positieve (DENV-geïnfecteerde) monsters. Groep II bestond uit DENV-antilichaam positieve (DENV-blootgesteld) monsters. Groep III bestond uit monsters zonder DENV RNA of antilichaam (gezonde controles). Het virus-sera mengsel werd toegevoegd aan menselijke macrofagen en de infectie gekwantificeerd. Dit cijfer is gewijzigd van Londono-Renteria et al.8. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 : DENV immuunsera verbetert ZIKV infectie in primaire menselijke macrofagen. Menselijke sera met DENV antilichamen (DENV1-4 zijn serotype bevestigd, Col serotype onbekend) of van gezonde controles werden verdunde 1:10 tot 1:10,000 en geïncubeerd met ZIKV. De sera worden beschreven in tabel 1. Primaire geïsoleerde menselijke macrofagen waren besmet met ZIKV alleen of met de ZIKV-sera mengsels. (een) DENV1 antilichaam-bevattende sera. (b) DENV2 antilichaam-bevattende sera. (c) DENV3 antilichaam-bevattende sera. (d) DENV4 antilichaam-bevattende sera. (e) DENV-antilichaam sera van Colombiaanse individuele 1. (f) DENV-antilichaam sera van Colombiaanse individuele 2. De infectie werd gemeten door qRT-PCR analyse op 48 h postinfection. Technische en biologische replicatieonderzoeken werden gedaan in drievoud. De gegevens zijn samengevoegd en de foutbalken geven standaarddeviatie. Van de student t-test en ANOVA werden gebruikt voor de statistische analyse. P < 0,001. Dit cijfer is gewijzigd van Londono-Renteria et al.8. Klik hier voor een grotere versie van dit cijfer.

Table 1
Tabel 1: Thermische profiel van qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kruisallergie van DENV-antilichamen leidt tot het ADE van andere DENV-serotypes heeft de ontwikkeling van een doeltreffend vaccin11belemmerd. ZIKV behoort tot dezelfde familie, Flavivirus, en heeft een aanzienlijke homologie met andere flavivirussen, vooral DENV12. Het belangrijkste doel van neutraliserende antilichamen voor zowel ZIKV als DENV is de envelop eiwitten, die een zeer hoge structurele en quaternaire reeks homologie tussen de twee virussen13,14,15deelt. Het is aangetoond dat pre-immuniteit DENV of ZIKV de besmetting van de andere virus8,16kunt verbeteren.

Er zijn een aantal verschillende testmethoden te kwantificeren van de virale infectiviteit in ADE experimenten, variërend van plaque testen17, intracellulaire virusantigeen kleuring gebruikt antilichamen geconjugeerd met fluorescente kleurstoffen en stroom cytometry18 ,19. Deze testen zijn tijdrovend en niet gemakkelijk aan te passen voor de hoge-doorvoer van meerdere monsters tegelijk. Belangrijker is, zijn de meeste studies DENV-specifieke monoklonale antilichamen gebruikt om te controleren hun effect op de ZIKV en onderzocht de ADE in cel lijnen slechts20,21. In dit protocol beschrijven we een methode van het eenvoudige maar toch efficiënte waarin we menselijke vooraf immuun serummonsters die een neutraliserende capaciteit tegen DENV, samen met primaire menselijke immune cellen, te onderzoeken van het effect van patiënten serum op ZIKV replicatie door gebruik te maken hebben gebruikt qRT-PCR. Deze methode is robuust, relevante, en in drie dagen kan worden afgerond. Hoewel de representatieve resultaten in dit manuscript de toepassing ervan voor ZIKV blijkt, kan dit protocol gemakkelijk worden bewerkt en gebruikt voor andere flavivirussen zoals het gele koorts virus, dengue virus en West-Nijl virus. Een belangrijke factor die meespeelt is dat dit protocol een beperking heeft in het onderscheid te maken tussen rijpe en onrijpe virale RNA.

Tijdens het protocol, is het van cruciaal belang om zorgvuldige afweging bij het uitvoeren van het RNA extracties uit te voeren, om ervoor te zorgen dat het milieu RNase-vrije tijdens alle RNA verwerken stappen. Bovendien, virale voorraden moeten worden ontdooid bij 37 ° C in een waterbad voor 1-2 min en onmiddellijk op ijs. Het virus moet echter niet worden bewaard op het ijs voor zolang, dan deze zijn besmettelijkheid verliest mogelijk.

Vorige resultaten hebben aangetoond dat dit protocol is zeer handig en aan te passen aan het verwerken van een groot aantal monsters en kan worden afgerond in relatief minder tijd dan andere methoden. Dit protocol heeft het potentieel om te worden gebruikt als een nuttige assay voor toekomstige ADE studies.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te verklaren.

Acknowledgments

Dit werk werd genereus ondersteund door de 1R21AI129881-01 (tot T.M.C.), start-up middelen uit de nationale opkomende besmettelijke ziekten-laboratoria, en de Boston University School of Medicine.

Materials

Name Company Catalog Number Comments
Fetal Bovine Serum  GEMINI 100-106
iCycler  BioRad 785BR02188 Model No. CFX96 Optics Module
Microfuge 18 Centrifuge Beckman Coulter  367160
Nanodrop-1000 Thermoscientific  1072
Quantifast SYBR-One step RT-PCR kit  Qiagen  204154 Used for 1 step RT-qPCR
RNeasy RNA Isolation Kit  Qiagen  74106 Used for RNA extraction
RPMI-medium  Gibco 11875093

DOWNLOAD MATERIALS LIST

References

  1. Hayes, E. B. Zika virus outside Africa. Emerging Infectious Diseases. 15, 1347-1350 (2009).
  2. Grard, G., et al. Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus. PLoS Neglected Tropical Diseases. 8, (2), 2681 (2014).
  3. Fauci, A. S., Morens, D. M. Zika Virus in the Americas--Yet Another Arbovirus Threat. New England Journal of Medicine. 374, (7), 601-604 (2016).
  4. Hawkes, R. A. Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls. Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).
  5. Musso, D., Gubler, D. J. Zika Virus. Clinical Microbiology Reviews. 29, (3), 487-524 (2016).
  6. Vaughn, D. W., et al. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. The Journal of Infectious Diseases. 181, (1), 2-9 (2000).
  7. Khandia, R., et al. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection. Frontiers of Immunology. 9, 597 (2018).
  8. Londono-Renteria, B., et al. A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement. Journal of General Virology. 98, (7), 1702-1712 (2017).
  9. Ganger, M. T., Dietz, G. D., Ewing, S. J. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments. BMC Bioinformatics. 18, (1), 534 (2017).
  10. Renn, L. A., et al. High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes. Journal of Visualized Experiments. (97), e52650 (2015).
  11. McArthur, M. A., et al. Dengue vaccines: recent developments, ongoing challenges and current candidates. Expert Review of Vaccines. 12, (8), 933-953 (2013).
  12. Priyamvada, L., et al. Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology. Emerging Microbes and Infections. 6, (5), 33 (2017).
  13. Dai, L., et al. Molecular basis of antibody-mediated neutralization and protection against flavivirus. IUBMB Life. 68, (10), 783-791 (2016).
  14. Dai, L., et al. Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody. Cell Host & Microbe. 19, (5), 696-704 (2016).
  15. Sirohi, D., et al. The 3.8 A resolution cryo-EM structure of Zika virus. Science. 352, (6284), 467-470 (2016).
  16. George, J., et al. Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques. Scientific Reports. 7, (1), 10498 (2017).
  17. Morens, D. M., Halstead, S. B. Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies. Journal of General Virology. 71, Pt 12 2909-2914 (1990).
  18. Dejnirattisai, W., et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science. 328, (5979), 745-748 (2010).
  19. Priyamvada, L., et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7852-7857 (2016).
  20. Charles, A. S., Christofferson, R. C. Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro. PLoS Currents. 8, (2016).
  21. Swanstrom, J. A., et al. Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus. MBio. 7, (4), (2016).
Kwantificering van antilichaam-afhankelijke versterking van het Zika-Virus in primaire menselijke cellen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).More

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter