Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Quantifizierung der Antikörper-abhängige Verstärkung der Zika-Virus in primären humanen Zellen

doi: 10.3791/58691 Published: January 18, 2019

Summary

Wir beschreiben eine Methode zur Bewertung der Wirkung der vorbestehenden Immunität gegen Dengue-Virus auf der Zika-Virus-Infektion mit humanem Serum, primären humanen Zellen und Infektion Quantifizierung durch quantitative Real-Time Polymerase-Kettenreaktion.

Abstract

Die jüngste Entstehung der Flavivirus Zika und neurologischen Komplikationen, wie z. B. Guillain-Barré-Syndrom und Mikrozephalie bei Säuglingen, brachte schwere öffentliche Sicherheitsbedenken. Unter den Risikofaktoren ist Antikörper-abhängige Verstärkung (ADE) die bedeutendste Gefahr wie der jüngsten Wiederauftauchen der Zika-Virus (ZIKV) vor allem in Bereichen, ist wo die Bevölkerung ausgesetzt war und ist in einem Zustand der Pre-Immunität gegen andere nahestehende Flaviviren, vor allem Dengue-Virus (DENV). Hier beschreiben wir ein Protokoll zur Quantifizierung der Wirkung von humanem Serum Antikörper gegen DENV auf ZIKV Infektion in primären humanen Zellen oder Zell-Linien.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Unter den Mücken übertragenen Viruserkrankungen gehört Zika Infektion klinisch wichtig1. Die Infektion wird durch die Flavivirus ZIKV verursacht, die in den meisten Fällen, Aedes Aegypti als seine primäre Vektor1,2nutzt. Allerdings gibt es Studien, die als primäre Vektor in einigen ZIKV Ausbrüche3 Aedes Albopictus gemeldet haben. Obwohl die Infektion in vielen Fällen symptomlos, sind die häufigsten Symptome Fieber, Kopfschmerzen und Muskel-Schmerz-2. Es gibt keine Behandlung oder Impfung zur ZIKV Infektion und die Behandlung ist meist unterstützend. Den jüngsten Ausbrüchen von ZIKV in Südamerika führte zu schweren Fällen der Krankheit und ca. 20-fold Zunahme der Neurodevelopmental Störung bei Feten Mikrozephalie2benannt. Da Südamerika eine Fläche in mehrere Arboviren wie DENV und West-Nil-Virus endemisch ist, ist es wichtig zu untersuchen, ob vorherige Immunität gegen andere flavivirus(es) eine Rolle in der Schwere der ZIKV Infektionen und Krankheiten spielt.

Im Laufe der Jahrhunderte haben Viren entwickelt verschiedene Strategien um ihre Chance auf Infektiosität um Host Cell Maschinen übernehmen und unterdrücken die antivirale Reaktion zu erhöhen. Eines der faszinierendsten von allen ist die Verwendung der Host vor Immunsystem Antikörper durch Viren, die Replikation mit dem Phänomen ADE4zu verbessern. ADE über alle vier Serotypen DENV wurde auch untersucht und nachgewiesen, virale Titer und Krankheit Ergebnis5,6,7zu erhöhen. In einer früheren in-vitro-Studie haben wir erhebliche Verbesserung der ZIKV Replikation durch Vorerkrankungen DENV Immunität in primären menschlichen Immunzellen8gezeigt. Wir haben auch gezeigt, dass eine entsprechende in-vitro-Methode um die Fähigkeit der DENV bereits vorhandene Antikörper, ZIKV Replikation in Primärzellen verbessern zu quantifizieren.

Das Protokoll, das wir entwickelt haben verwendet menschliches Serum-Proben, die geprüft werden DENV Neutralisation TCID / 50 oder Plaque Reduktion Neutralisation Test (PRNT) assays, zusammen mit ZIKV in biologisch relevanten Zellen oder Zellen aus Geweben, die ZIKV zu infizieren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Serumproben, die in dieser Studie verwendet wurden von menschlichen Teilnehmern einer Kohorte von Columbia erhalten. Sample-Sammlung wurde von der internen Review Board (IRB) Universidad de Pamplona (Kolumbien, Südamerika) und Los Potios Hospital8genehmigt. Die Proben wurden anonym und Ermittler hatten keinen Zugang zu Patientendaten. Die Serumproben wurden für die DENV Serotyp überprüft. Die Proben wurden weitere DENV Infektion neutralisieren bestätigt in-vitro-. Zur Kontrolle wurden Serumproben von gesunden Personen (HC) aus den USA verwendet.

Hinweis: Dieses Protokoll kann verwendet werden, zu prüfen, die ADE ZIKV Replikation in jeder menschlichen Zelle Art mit dem Ausdruck des Fcγ-Rezeptors. Das Protokoll besteht aus drei Teilen (Abbildung 1).

(1) Zell-Aussaat und Setup-Infektion

Hinweis: Für diese Studie, menschliche primären Makrophagen oder U937 Myelomonocytic Zelllinie (ATCC-CRL-1593.2) wurden verwendet. Die Zellen wurden in RPMI Wachstumsmedium ergänzt mit 10 % fetalen bovine Serum (FBS) in einem Inkubator 37 ° C mit 5 % Kohlendioxid (CO2) beibehalten. Alles, was die Schritte in eine biologische Sicherheit durchgeführt wurden Stufe 2 (BSL-2) biologische Kabinett unter sterilen Bedingungen.

  1. 3 x 104 Samenzellen pro auch in eine sterile flach-Boden-96-Well-Platte zusammen mit 100 µL Medium und legen Sie sie in das 37 ° C Inkubator mit 5 % CO2.
  2. Nach der Aussaat der Zellen, Serumproben bei Raumtemperatur auftauen und machen 10-divisibel Verdünnungsreihen (d.h.1/10, 1/100, 1/1000, 1/10.000) durch Mischen der Proben in serumfreien Medium. Aliquoten die Verdünnungen in eine sterile 96-Well-Platte. Verwenden Sie das Virus ohne Serum als eine zusätzliche Kontrolle.
  3. Tauen Sie die ZIKV-Aktie bei 37 ° C in einem Wasserbad für ca. 1-2 min. auf und übertragen Sie schnell, Eis für die zukünftige Verwendung.
  4. Die Serum-Aliquote 0,1 Multiplizität der Infektion (MOI) äquivalente Menge an ZIKV Stamm MR766 hinzufügen.
    Hinweis: Stellen Sie sicher, dass der Verdünnungsfaktor konstant bleibt und das Gesamtvolumen ca. 200 µL beträgt; Das ist genug für Triplicates einer jeden Behandlung. Halten Sie drei Brunnen nicht infizierten als Negativkontrolle für nachgelagerte Analyse verwenden.
  5. Inkubieren Sie die Serum-Verdünnungen mit dem zusätzlichen Virus im Inkubator 37 ° C mit 5 % CO2 für 1 h um die DENV Antikörper Form komplexe mit der Zika-Virionen (für Bequemlichkeit, nachstehend "Immunkomplexe") zu ermöglichen.
  6. Aspirieren Sie die Medien aus den Zellen, die in der 96-Well-Platte flach-Boden ausgesät wurden. Waschen Sie die Zellen mit sterilen 1 x Phosphat-gepufferte Kochsalzlösung (1 X PBS).
  7. Jede Vertiefung 50 µL der Immunkomplexe hinzu und inkubieren sie im Inkubator 37 ° C mit 5 % CO2 für 2 h.
  8. Nach 2 h Inkubation, aspirieren Sie das Medium mit der Immunkomplexe aus den Zellen, mit einer Mehrkanal pipette, und waschen Sie die Zellen 2 X mit 1 X PBS die Immunkomplexe und jede ungebunden Virionen vollständig zu entfernen.
  9. Fügen Sie 100 µL frische komplette Medien mit 10 % FBS zu jedem gut und inkubieren Sie die Zellen in den Inkubator 37 ° C mit 5 % CO2 für 48 h ergänzt.

2. RNA-Extraktion

  1. Entfernen Sie die 96-Well-Platte aus dem Inkubator und überträgt es auf die biologische Kabinett.
  2. Aspirieren Sie die Medien, waschen Sie die Zellen 2 X mit 1 X PBS, und fahren Sie mit RNA-Extraktion.
    Hinweis: RNA durch irgendeine Methode der Wahl extrahiert werden kann (siehe die Tabelle der Materialien).
  3. Fügen Sie 250 µL Zelle Lysis Puffer mit 10 % β-Mercaptoethanol pro Bohrloch. Pipette des Puffers nach oben und unten mindestens 5 X zusammen mit kratzen die Zellen mit der Pipettenspitze Lyse-Verfahren zu beschleunigen.
  4. Übertragen Sie die Zelle Lysates auf neue, beschriftet, sterile 1,5 mL Röhrchen.
  5. Hinzufügen einer gleichen Menge von 70 % Ethanol (250 µL). Pipette auf und ab 4 - 5 x, bis die Mischung klar ist.
  6. Übertragen Sie die Mischung (~ 500 µL) auf Silizium basierenden Spalten in 2 mL Röhrchen beschriftet und Zentrifugieren bei 15.000 X g 30 S. verwerfen der Durchströmung und halten Sie die Spalten in der gleichen Röhrchen.
  7. Jede Spalte 700 µL Waschpuffer 1 hinzu und Zentrifugieren bei 15.000 X g 30 S. verwerfen der Durchströmung und halten Sie die Spalten in der gleichen Röhrchen.
  8. Fügen Sie 500 µL Waschpuffer 2, jede Spalte und Zentrifuge bei 15.000 X g , 30 S. verwerfen der Überstand. Wiederholen Sie diesen Schritt 2 X.
  9. Übertragung der Spalten, die neue 2 mL Röhrchen und Zentrifuge bei 15.000 X g für 2 min. Stellen Sie sicher, dass Silizium basierenden Spalten vollständig trocken und es keine Ethanol gibt von Waschpuffer 2 links.
  10. Verwerfen Sie 2 mL Röhrchen zu und legen Sie die Spalten in neue, steril, beschriftet, 1,5 mL Erholung Röhren.
  11. Fügen Sie in der Mitte der einzelnen Spalte und Zentrifuge bei 15.000 X g für 1 min vorgewärmte (42 ° C) 30 µL RNase-freies Wasser.
  12. Wiederherstellen der eluierten RNS und die Proben mit einem Spektralphotometer bei einer 260 nm Wellenlänge zu quantifizieren.
    Hinweis: Im Idealfall bestimmen die Reinheit der RNA durch die Berechnung des Verhältnis zwischen den Werten der Absorption bei 260 nm und 280 nm. Gereinigte RNA 260/280 Verhältnis ist ideal zwischen 1,8-2,0.

3. quantitative Real-Time Polymerase-Kettenreaktion

Hinweis: Quantitative Real-Time Polymerase-Kettenreaktion (qRT-PCR) kann erfolgen, indem mit jeder SYBR grün Mix besteht in der Regel SYBR Green ich färben, Taq-DNA-Polymerase, Deoxynucleotide Triphosphate (dNTPs) und einem passiven Farbstoff. Jede qPCR-Maschine in der Lage, über den Nachweis von SYBR Grün lässt sich die Reaktion durchführen und die Daten zu erwerben. Für dieses Experiment war eine One-Step RT-PCR-Kit verwendet, die einen Cocktail von SYBR Green hatte ich, ROX Farbstoff Taq-DNA-Polymerase, dNTPs und eine zusätzliche Mischung aus Reverse Transkriptase (siehe Tabelle der Materialien). Die Primer entwickelt gegen die Umschlag-Region und in dieser Studie verwendet, um ZIKV genomische Ebenen zu quantifizieren sind CCGCTGCCCAACACAAG für ZIKV-qF und CCACTAACGTTCTTTTGCAGACAT für ZIKV-qR. Als Kontrolle wurde menschliche β-2-Mikroglobulin (B2M) gemessen und verwendet, um die Expression von ZIKV (Housekeeping-Gene) zu normalisieren. Die Primer-Sequenzen, B2M Genexpression in dieser Studie verwendeten zu quantifizieren sind CTCCGTGGCCTTAGCTGTG für B2M-qF und TTTGGAGTACGCTGGATAGCCT für B2M-qR. Sicherstellen Sie, dass die drei technischen Wiederholungen für jede Probe für die ZIKV und die B2M Gene setzen. Das Setup von der RT-PCR wird nachfolgend kurz beschrieben.

  1. RT-PCR setup
    1. Einsatz 100 ng RNA pro Probe.
    2. Fügen Sie 1 µL 10 µM Bestände von forward und reverse Primer eines bestimmten Gens für jede Reaktion.
    3. Fügen Sie 0,25 µL Reverse Transkriptase-Mix pro Probe.
    4. Fügen Sie für jede einzelne Reaktion 12,5 µL SYBR Green Mix.
    5. Bis zu 25 µL Wasser hinzufügen. Machen Sie einen Master mix aus allen oben genannten Reagenzien außer RNA, aliquoten es in 96-Well-PCR-Platte, und fügen Sie RNA zuletzt.
    6. Dichtplatte mit transparentem Klebeband.
    7. Zentrifugieren Sie die Platte bei 1.000 X g für 1 min um die Reagenzien zu mischen.
    8. Setzen Sie die Platte in die qPCR-Maschine.
  2. RT-PCR-Profil
    Hinweis: Verwenden Sie das RT-PCR-Profil in Tabelle 1dargestellt.
    1. Inkubieren Sie die Proben bei 50 ° C für 10 min um die Synthese des komplementären DNA (cDNA) zu gewährleisten.
    2. Aktivieren Sie nachdem die cDNA-Synthese die Taq-DNA-Polymerase bei 95 ° C für 5 min.
    3. Führen Sie 40 Zyklen der Denaturierung bei 95 ° C für 10 s und Grundierung Glühen und Erweiterung bei 60 ° C für 30 s.
    4. Setzen Sie die zusätzliche Schmelze Kurve Schritt (65° C) am Ende.
  3. Datenanalyse
    1. Überwachen der Schmelze Kurve durch Klicken auf die Registerkarte Schmelze Kurve in das Programm zum Ausführen der qPCR-Maschine, die im Idealfall einer einzelnen Spitze in den Proben für ein bestimmtes Gen, das Vorhandensein von nur einem Amplifikate und eine Verstärkung Wert bestätigen mehr als 1,6 If zeigt die Algori verwendet THM hält 2 als 100 % Verstärkung Wert (der Verstärkung-Wert variiert je nach Algorithmus, der von der qPCR-Maschine verwendet). Achten Sie darauf, 0,5 ° C Temperatur Schritten zwischen Treppe und ein Minimum Haltezeit von 10 s in die Schmelze Kurve Protokoll, um optimale Ergebnisse zu erzielen.
    2. Nach sicher, es gibt einen einzigen Amplifikate und gute Verstärkung Wert zuerst klicken Sie auf der Registerkarte Quantifizierung Daten um einen quantitativen Zyklus (Ct/Cq-Wert) von jeder Probe und nach Microsoft Excel exportieren.
    3. Mit einer Tabellenkalkulation, berechnen Sie den Mittelwert jeder Probe mit dem Ct-Wert. Als nächstes klicken Sie in den Formeln und wählen Sie den Durchschnitt. Die durchschnittliche CT-Werte jeder einzelnen Probe (replizieren) dienen zur weiteren Analyse.
    4. Als Nächstes berechnen die ΔCt mit der Formel ΔCt = durchschnittliche Ct des Zielgens - durchschnittliche Ct des Gens Kontrolle (in diesem Fall, ΔCt = durchschnittliche Ct des ZIKV-Gens - durchschnittliche Ct des Gens B2M).
    5. Berechnen Sie ΔΔCt um die Daten zu normieren (in diesem Fall, ΔΔCt = ΔCt ZIKV Proben - B2M-Samples).
    6. Berechnen Sie die Falte Genexpression erhöhen durch Eingabe der Formel 2^-(ΔΔCt) für jeden einzelnen ΔΔCt normalisiert. Erhalten Sie die Ergebnisse der Falte Zunahme statistische Tests durchführen, wie in früheren Studien9,10beschrieben.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In Abbildung 1gibt es eine Schritt für Schritt schematische Darstellung der alle Schritte zur Durchführung der ADE-Protokoll. Es ist eine schematische Darstellung zeigt die ganze Prozedur von ADE ZIKV durch bereits vorhandene Immunität zu DENV. Abbildung 2 zeigt, wie menschliches Serum Proben wurden in drei verschiedene Gruppen kategorisiert: DENV-Infektion bestätigt Proben werden als die DENV-infizierten Gruppe bezeichnet, DENV Antikörper-bestätigt Proben sind als die DENV-exponierten Gruppe bezeichnet, und gesund einzelnen Seren ohne DENV-neutralisierende Antikörper oder RNA nennt der gesunden Kontrollgruppe (HC). (Abbildung 2).

Die Serumproben komplexe mit ZIKV machen durften und wurden dann verwendet, um Makrophagen Zellen zu infizieren. Nach 48 h Postinfection wurde RNA gewonnen und qRT-PCR unterworfen. Das repräsentative Experiment in Abbildung 3 zeigt, dass die meisten der Sera, DENV Serotyp 1 bis 4 Antikörper enthält ZIKV Replikation auf verschiedenen Ebenen verbessern konnten. Der höchste Anstieg in ZIKV Titer wurde gefunden in den Makrophagen mit Seren, DENV Serotyp 2 und 4 Antikörper gegenüber Serotyp 1 und 3, die eine relativ weniger Induktion von ZIKV zeigte enthält behandelt.

Figure 1
Abbildung 1 : Schematische Darstellung des Protokolls ADE. Eine detaillierte Abbildung zeigt alle Schritte des gesamten Protokolls beteiligt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 : Schaltplan des experimentellen Verfahrens. Drei Arten von Seren wurden mit Zika-Virus inkubiert. Gruppe, die ich aus DENV-RNA positiv (DENV-infizierten) Proben bestand. Gruppe II bestand aus DENV-Antikörper (DENV-exponierten) Proben. Gruppe III bestand aus Proben ohne DENV RNA oder Antikörper (gesunden Kontrollpersonen). Die Virus-Sera-Mischung wurde menschliche Makrophagen und die Infektion quantifiziert hinzugefügt. Diese Zahl wurde von Londono Renteria Et Al.8geändert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3 : DENV immun Sera verbessert ZIKV Infektion in primären menschlichen Makrophagen. Menschliche Seren, DENV Antikörper enthält (DENV1-4 sind Serotyp bestätigt, Col Serotyp unbekannt) oder von gesunden Kontrollpersonen waren verwässerter 01:10 bis 1: 10.000 und mit ZIKV inkubiert. Die Seren sind in Tabelle 1beschrieben. Primäre isolierte menschliche Makrophagen infiziert wurden mit ZIKV allein oder mit der ZIKV-Sera-Mischungen. (ein) DENV1 Antikörper enthaltende Seren. (b) DENV2 Antikörper enthaltende Seren. (c) DENV3 Antikörper enthaltende Seren. (d) DENV4 Antikörper enthaltende Seren. (e) DENV-Antikörper Seren von kolumbianischen individuelle 1. (f) DENV-Antikörper Seren von kolumbianischen individuelle 2. Die Infektion wurde durch qRT-PCR-Analyse auf 48 h Postinfection gemessen. Technischen und biologische Wiederholungen erfolgten in dreifacher Ausfertigung. Die Daten werden gebündelt und die Fehlerbalken zeigen die Standardabweichung. Der Student t-Test und ANOVA wurden für die statistische Auswertung verwendet. P < 0,001. Diese Zahl wurde von Londono Renteria Et Al.8geändert. Bitte klicken Sie hier für eine größere Version dieser Figur.

Table 1
Tabelle 1: Temperaturprofil der qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kreuzreaktivität von DENV Antikörpern führt zu ADE von anderen Serotypen DENV hat die Entwicklung eines wirksamen Impfstoff11behindert. ZIKV gehört zu der gleichen Familie Flaviviridae, und hat eine beträchtliche Homologie mit anderen Flaviviren, vor allem DENV12. Das Hauptziel von neutralisierenden Antikörpern für ZIKV und DENV ist das Hüllprotein, das eine sehr hohe strukturelle und quartären Sequenzhomologie zwischen den zwei Viren13,14,15teilt. Es wurde nachgewiesen, dass Pre-Immunität gegen DENV oder ZIKV die Infektion von anderen Virus8,16verbessern kann.

Es gibt eine Reihe von verschiedenen Methoden eingesetzt, um die virale Infektiosität in ADE Experimente, Plaque-Assays17bis hin zu quantifizieren, intrazelluläre virale Antigen Färbung mit Antikörper konjugiert mit Fluoreszenzfarbstoffen und Durchflusszytometrie18 ,19. Diese Tests sind zeitaufwändig und nicht leicht anpassbar für die Hochdurchsatz-mehrere Proben gleichzeitig. Wichtig ist, die meisten Studien DENV-spezifische monoklonale Antikörper verwendet, um ihre Wirkung auf ZIKV überprüfen und untersucht die ADE in Zelle Linien nur20,21. In diesem Protokoll beschreiben wir eine einfache aber effektive Methode, in der wir Menschen bereits immun Serumproben, die eine neutralisierende Fähigkeit gegen DENV, zusammen mit primären menschlichen Immunzellen verwendet, die Wirkung von Patientenserum auf ZIKV Replikation durch den Einsatz zu prüfen haben qRT-PCR. Diese Methode ist robust, relevant und kann in drei Tagen abgeschlossen sein. Obwohl die repräsentativen Ergebnisse in dieser Handschrift ihres Antrags auf ZIKV zeigen, kann dieses Protokoll leicht modifiziert und für andere Flaviviren, wie Gelbfieber-Virus, Dengue-Virus und West-Nil-Virus verwendet. Ein wichtiger Faktor zu berücksichtigen ist, dass dieses Protokoll eine Einschränkung bei der Unterscheidung zwischen Reifen und unreifen virale RNA.

Während des Protokolls ist es wichtig, sorgfältig überlegen, bei der Durchführung der RNA-Extraktionen, um sicherzustellen, dass die Umwelt RNase-freie ist während aller Schritte Umgang mit RNA. Darüber hinaus sollten virale Bestände bei 37 ° C in einem Wasserbad für ca. 1-2 min. aufgetaut und sofort auf Eis gelegt. Das Virus sollte jedoch nicht auf Eis gehalten werden, für lange wie damals, es seine Infektiösität verlieren kann.

Bisherigen Ergebnisse haben gezeigt, dass dieses Protokoll ist sehr bequem und anpassungsfähig an eine große Anzahl von Proben zu behandeln und kann in relativ weniger Zeit als andere Methoden erfolgen. Dieses Protokoll hat das Potenzial für zukünftige ADE Studien als eine nützliche Assay verwendet werden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu verzollen.

Acknowledgments

Diese Arbeit wurde großzügig unterstützt von 1R21AI129881-01 (bis T.M.C), Start-up-Mittel aus den nationalen Emerging ansteckende Krankheiten Laboratorien und der Boston University School of Medicine.

Materials

Name Company Catalog Number Comments
Fetal Bovine Serum  GEMINI 100-106
iCycler  BioRad 785BR02188 Model No. CFX96 Optics Module
Microfuge 18 Centrifuge Beckman Coulter  367160
Nanodrop-1000 Thermoscientific  1072
Quantifast SYBR-One step RT-PCR kit  Qiagen  204154 Used for 1 step RT-qPCR
RNeasy RNA Isolation Kit  Qiagen  74106 Used for RNA extraction
RPMI-medium  Gibco 11875093

DOWNLOAD MATERIALS LIST

References

  1. Hayes, E. B. Zika virus outside Africa. Emerging Infectious Diseases. 15, 1347-1350 (2009).
  2. Grard, G., et al. Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus. PLoS Neglected Tropical Diseases. 8, (2), 2681 (2014).
  3. Fauci, A. S., Morens, D. M. Zika Virus in the Americas--Yet Another Arbovirus Threat. New England Journal of Medicine. 374, (7), 601-604 (2016).
  4. Hawkes, R. A. Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls. Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).
  5. Musso, D., Gubler, D. J. Zika Virus. Clinical Microbiology Reviews. 29, (3), 487-524 (2016).
  6. Vaughn, D. W., et al. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. The Journal of Infectious Diseases. 181, (1), 2-9 (2000).
  7. Khandia, R., et al. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection. Frontiers of Immunology. 9, 597 (2018).
  8. Londono-Renteria, B., et al. A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement. Journal of General Virology. 98, (7), 1702-1712 (2017).
  9. Ganger, M. T., Dietz, G. D., Ewing, S. J. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments. BMC Bioinformatics. 18, (1), 534 (2017).
  10. Renn, L. A., et al. High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes. Journal of Visualized Experiments. (97), e52650 (2015).
  11. McArthur, M. A., et al. Dengue vaccines: recent developments, ongoing challenges and current candidates. Expert Review of Vaccines. 12, (8), 933-953 (2013).
  12. Priyamvada, L., et al. Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology. Emerging Microbes and Infections. 6, (5), 33 (2017).
  13. Dai, L., et al. Molecular basis of antibody-mediated neutralization and protection against flavivirus. IUBMB Life. 68, (10), 783-791 (2016).
  14. Dai, L., et al. Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody. Cell Host & Microbe. 19, (5), 696-704 (2016).
  15. Sirohi, D., et al. The 3.8 A resolution cryo-EM structure of Zika virus. Science. 352, (6284), 467-470 (2016).
  16. George, J., et al. Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques. Scientific Reports. 7, (1), 10498 (2017).
  17. Morens, D. M., Halstead, S. B. Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies. Journal of General Virology. 71, Pt 12 2909-2914 (1990).
  18. Dejnirattisai, W., et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science. 328, (5979), 745-748 (2010).
  19. Priyamvada, L., et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7852-7857 (2016).
  20. Charles, A. S., Christofferson, R. C. Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro. PLoS Currents. 8, (2016).
  21. Swanstrom, J. A., et al. Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus. MBio. 7, (4), (2016).
Quantifizierung der Antikörper-abhängige Verstärkung der Zika-Virus in primären humanen Zellen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).More

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter