Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

כימות של נוגדנים תלויי שיפור של הנגיף Zika בתאי אדם ראשי

doi: 10.3791/58691 Published: January 18, 2019

Summary

אנו מתארים שיטה להעריך את ההשפעה של הקיימת מראש חסינות מפני וירוס דנגה על זיהום בנגיף Zika באמצעות בנסיוב אדם ראשי תאים אנושיים, כימות זיהום על ידי תגובת שרשרת של פולימראז בזמן אמת כמותית.

Abstract

הופעתה האחרונה של flavivirus Zika וסיבוכים נוירולוגיות, כגון תסמונת גיליאן, microcephaly אצל תינוקות, הביא חששות בטיחות הציבור רציני. בין גורמי הסיכון, נוגדנים תלויי שיפור (איד) מהווה את האיום המשמעותי ביותר, כמו הופעתה האחרונה של הנגיף Zika (ZIKV) הוא בעיקר באזורים נחשף ואיפה נמצא במצב של טרום חסינות אחרים הקשורים קשר הדוק האוכלוסייה flaviviruses, וירוס דנגה במיוחד (DENV). כאן, אנו מתארים את פרוטוקול לכימות תנועת השפעת הנוגדנים בנסיוב אדם נגד DENV על זיהום ZIKV ראשי תאים אנושיים או שורות תאים.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

בין בעקיצות יתושים מחלות ויראליות, Zika זיהום הוא אחד החשובים ביותר קלינית1. הזיהום נגרם על ידי flavivirus ZIKV אשר, ברוב המקרים, משתמש Aedes aegypti כמו וקטור העיקרי שלה,1,2. עם זאת, ישנם מחקרים דיווחו אדס כמו וקטור העיקרי כמה התפרצויות ZIKV3. למרות הזיהום אסימפטומטיים במקרים רבים, התסמינים השכיחים ביותר הם חום גבוה, כאב ראש, כאב שרירים2. יש שום תרופה או חיסון זמין עבור זיהום ZIKV, הטיפול זמין בעיקר הוא תומך. התפרצויות שאירעו של ZIKV בדרום אמריקה הובילה במקרים חמורים של המחלה ועלייה הפרעות התפתחותיות ההתעסקות בשם microcephaly2כ 20-fold. כמו בדרום אמריקה הוא אזור אנדמי ל arboviruses מספר כגון DENV וירוס הנילוס המערבי, זה הכרחי לחקור אם חסינות מוקדמת flavivirus(es) אחרים משחק תפקיד חומרת ZIKV זיהומים ומחלות.

לאורך כל הדורות, וירוסים התפתחו אסטרטגיות שונות כדי להגדיל את הסיכוי של infectivity על מנת להשתלט על המנגנון התא המארח, לדכא את התגובה אנטי-ויראלי. אחד המרתקים ביותר מכל הוא השימוש של המארח נוגדנים מראש המערכת החיסונית על ידי וירוסים כדי לשפר את שכפול שלהם עם התופעה אייד4. אייד על פני כל ארבעת אשר נגרמו מהזנים אליהם של DENV כבר למד היטב והפגינו להגדלת titers נגיפי המחלה התוצאה5,6,7. במחקר במבחנה הקודם, אנחנו הראו שיפור משמעותי של שכפול ZIKV עקב הקיימים מראש DENV חסינות ראשי תאים חיסוניים האנושי8. אנחנו גם הפגינו שיטה במבחנה הרלוונטיים כדי לכמת את היכולת של DENV קיימים נוגדנים כדי לשפר את שכפול ZIKV בתאים הראשי.

פרוטוקול זה פיתחנו משתמש בנסיוב אדם והמדגמים נבדקים על נטרול DENV TCID-50 או מבחני הבדיקה ניטרול הפחתת פלאק (PRNT), יחד עם ZIKV תאים רלוונטי מבחינה ביולוגית או תאים שמקורם ברקמות ZIKV שיכולים להדביק.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

הדוגמאות סרום השתמשו במחקר זה התקבלו ממשתתפים האנושי של עמית מאוניברסיטת קולומביה. אוסף דגימה אושרה על ידי ועדת הבדיקה הפנימית (IRB) למד דה פמפלונה (קולומביה, דרום אמריקה) ואת בית החולים לוס Potios8. הדגימות נמסרו באופן אנונימי והיה החוקרים אין גישה אל המידע למטופל. הדוגמאות סרום היו בדקו את serotype DENV. הדגימות אומתו נוספת כדי לנטרל. את זיהום DENV אין ויטרו. עבור פקד, שימשו הדוגמאות סרום אנשים בריאים (HC) מארה ב.

הערה: פרוטוקול זה יכול לשמש כדי לבחון את שכפול אייד של ZIKV בכל סוג התא האנושי לבטא את הקולטן Fcγ. הפרוטוקול כוללת שלושה חלקים (איור 1).

1. תא זריעה ואת זיהום ההתקנה

הערה: עבור מחקר מסוים, מקרופאגים העיקרי אנושי או שורת התאים myelomonocytic U937 (בקרת האוויר-CRL-1593.2) היו בשימוש. התאים היו מתוחזקים מדיום הגידול RPMI בתוספת 10% סרום שור עוברית (FBS)-חממה 37 ° C עם 5% פחמן דו-חמצני (CO2). כל הפעולות בוצעו עם אבטחה ברמה 2 הקבינט אבטחה (BSL-2) בתנאים סטריליים.

  1. 4 תאי הזרע 3 x 10 טוב בצלחת 96-ובכן שטוח התחתונה סטרילי יחד עם 100 µL בינוני ולמקם אותם בחממה 37 ° C עם 5% CO2.
  2. לאחר זריעה התאים, להפשיר הדוגמאות סרום בטמפרטורת החדר ולהפוך דילולים טורי 10-fold (קרי, 1/10, 1/100, 1/1, 000, 1/10,000) על ידי ערבוב את הדוגמאות סרום ללא בינוני. Aliquot דילולים לתוך צלחת 96-ובכן סטרילי. להשתמש את הווירוס מבלי סרום פקד נוספים.
  3. להפשיר את המניה ZIKV ב 37 מעלות צלזיוס בתוך אמבט מים למשך 1-2 דקות, במהירות העברתם לקרח לשימוש עתידי.
  4. להוסיף ריבוי 0.1 של זיהום (MOI) כמות שוות ערך של זן ZIKV MR766 aliquots בסרום.
    הערה: ודא כי הגורם דילול נשאר קבוע ואמצעי האחסון הכולל ~ 200 µL; זה מספיק בשביל triplicates של כל טיפול. שמור משלוש בארות uninfected שתשמש שליטה שלילי לניתוח במורד הזרם.
  5. דגירה של דילולים סרום עם וירוס נוסף בחממה 37 ° C עם 5% CO2 עבור 1 h כדי לאפשר את הנוגדנים DENV כדי מתחמי טופס עם virions Zika (לנוחיותכם, ןלהל "מכלולי המערכת החיסונית").
  6. האחות התקשורת את התאים היו נזרע בצלחת 96-ובכן שטוח התחתונה. לשטוף את התאים עם עקר 1 x באגירה פוספט תמיסת מלח (1 x PBS).
  7. להוסיף 50 µL של מכלולי המערכת החיסונית כל טוב, דגירה אותם בחממה 37 ° C עם 5% CO2 כבר שעתיים.
  8. לאחר שעתיים של דגירה, תשאף שהמדיה המכילה את מתחמי המערכת החיסונית מתאי, באמצעות רב-ערוצי פיפטה, ולשטוף את התאים 2 x עם PBS 1 x כדי להסיר לחלוטין את מתחמי המערכת החיסונית ואת כל virions כעיגולים בצבע.
  9. להוסיף 100 µL טריים התקשורת מלאה בתוספת 10% FBS לכל טוב ואני דגירה התאים בחממה 37 ° C עם 5% CO2 במשך 48 שעות.

2. RNA החילוץ

  1. הסר את לוחית 96-ובכן של החממה, להעביר אותו אבטחה בארון.
  2. האחות התקשורת, לשטוף את התאים 2 x עם 1 x PBS, והמשך החילוץ-RNA.
    הערה: רנ א ניתן באמצעות אחת השיטות של בחירה (עיין טבלה של חומרים).
  3. להוסיף 250 µL תא מאגר פירוק עם 10% β-mercaptoethanol לכל טוב. Pipette המאגר למעלה ולמטה x לפחות 5 יחד עם גירוד התאים עם קצה פיפטה כדי להאיץ את הליך פירוק.
  4. להעביר את lysates תא חדש, שכותרתו, סטרילי mL 1.5 צינורות.
  5. מוסיפים כמות שווה של 70% אתנול (250 µL). פיפטה לאורך 4 x - 5 x עד שהתערובת תהיה ברורה.
  6. להעביר את התערובת (µL ~ 500) עם התווית מבוסס-סיליקה עמודות ב- 2 mL אוסף צינורות ו centrifuge ב 15,000 x g עבור ביטול ס' 30 את הזרימה ולשמור את העמודות בתוך הצינורות אוסף אותו.
  7. להוסיף 700 µL שטיפת מאגר 1 כל עמודה ו centrifuge ב 15,000 x g עבור ביטול ס' 30 את הזרימה ולשמור את העמודות בתוך הצינורות אוסף אותו.
  8. להוסיף 500 µL שטיפת מאגר 2 כל עמודה, צנטריפוגה ב 15,000 x g עבור 30 ס' להשליך תגובת שיקוע. חזור על שלב זה, 2 x.
  9. העברת שהעמודות צינורות אוסף 2 mL החדש, צנטריפוגה ב 15,000 x g עבור 2 דק. ודא כי עמודות מבוסס-סיליקה להתייבש לחלוטין ואין שום אתנול עזב מהמאגר לשטוף 2.
  10. למחוק את הצינורות 2 מ"ל ולמקם הטורים חדש, סטרילי, שכותרתו, 1.5 mL שחזור צינורות.
  11. להוסיף prewarmed (42 ° C) 30 µL של מים נטולי RNase במרכזו של כל עמודה, צנטריפוגה ב 15,000 x g עבור 1 דקות.
  12. לשחזר את הרנ א eluted ולכמת את הדגימות, שימוש ספקטרופוטומטרים-260 ננומטר אורך גל.
    הערה: באופן אידיאלי, לקבוע את טוהר הרנ א על-ידי חישוב היחס בין הערכים ספיגת ב-260 nm ו 280 ננומטר. יחס 260/280 של RNA מזוכך הוא אידיאלי בין 1.8-2.0.

3. תגובת שרשרת של פולימראז כמותיים בזמן אמת

הערה: כמותיים בזמן אמת תגובת שרשרת פולימראזית (PCR לרביעיית) יכול להתבצע על-ידי שימוש בכל שילוב SYBR ירוק אשר בדרך כלל מורכב SYBR Green אני צובע, Taq DNA פולימראז, deoxynucleotide triphosphates (dNTPs), צבע פסיבי. כל מחשב qPCR מסוגל זיהוי SYBR ירוק ניתן לבצע את התגובה ולרכוש את הנתונים. עבור ניסוי זה, ערכת RT-PCR בשלב אחד שימש אשר היה קוקטייל. של SYBR Green אני רוקס לצבוע, Taq DNA פולימראז, dNTPs, תערובת נוספים של רוורס טרנסקריפטאז (עיין טבלה של חומרים). Primers נגד האזור המעטפה ותחתית השתמשו במחקר זה לכמת רמות גנומית ZIKV הם CCGCTGCCCAACACAAG על ZIKV-העל CCACTAACGTTCTTTTGCAGACAT עבור ZIKV-qR. כפקד, אנושי β-2-microglobulin (B2M) היה נמדד ומשמשת לנרמל את הביטוי של ZIKV (משק הגן). רצפי פריימר לכמת בביטוי הגן B2M השתמשו במחקר זה הן CTCCGTGGCCTTAGCTGTG עבור B2M-העל TTTGGAGTACGCTGGATAGCCT עבור B2M-qR. ודא לשים שלושה משכפל טכני עבור כל דגימה גם את ZIKV וגם את הגנים B2M. ההתקנה של RT-PCR מתואר בקצרה להלן.

  1. RT-PCR ההתקנה
    1. שימוש 100 ננוגרם של RNA לדגימה.
    2. הוסף 1 µL מ- 10 מיקרומטר מניות של תחל ויוצאים של גן מסוים עבור כל תגובה.
    3. הוסף µL 0.25 של רוורס טרנסקריפטאז מיקס לדגימה.
    4. עבור כל תגובה אישית, להוסיף µL 12.5 של מיקס SYBR Green.
    5. להוסיף עד 25 µL של מים. להפוך תבנית בסיס שילוב של כל ריאגנטים הנ"ל חוץ RNA, aliquot אותו בצלחת PCR 96-ובכן, ולהוסיף RNA אחרונה.
    6. חותם לצלחת עם סרט דביק שקוף.
    7. Centrifuge את הצלחת ב x 1000 g עבור 1 דקות לערבב את ריאגנטים.
    8. לשים את הצלחת המכונה qPCR.
  2. RT-PCR פרופיל
    הערה: משתמשים בפרופיל RT-PCR שמוצג טבלה 1.
    1. דגירה בדגימות ב 50 מעלות צלזיוס למשך 10 דקות על מנת להבטיח הסינתזה של דנ א משלים (cDNA).
    2. לאחר הסינתזה cDNA, להפעיל את Taq DNA פולימראז ב 95 מעלות צלזיוס במשך 5 דקות.
    3. לבצע 40 מחזורי דנטורציה ב 95 ° C עבור 10 s ו פריימר חישול והסיומת ב 60 מעלות צלזיוס במשך 30 s.
    4. שם השלב עקומת להמיס נוספים (65° C) בסופו של דבר.
  3. ניתוח נתונים
    1. לנטר את עקומת להמיס על-ידי לחיצה על הכרטיסיה עקומת להמיס במסגרת התוכנית המשמשת להפעלת המכונה qPCR, אשר, באופן אידיאלי, מראה לשיא יחיד כל הדגימות עבור גן מסוים לאשר הנוכחות של אחד בלבד אמפליקון וערך הגברה יותר מ 1.6 אם את algori thm מחשיב 2 כערך הגברה 100% (הערך הגברה משתנה על פי האלגוריתם המשמש את המכונה qPCR). הקפד להשתמש 0.5 ° C דרגות טמפרטורה בין השלבים למינימום החזקת זמן של 10 s בפרוטוקול עקומת להמיס, לקבלת תוצאות אופטימליות.
    2. לאחר שווידאתי ישנם אמפליקון יחיד וערך הגברה טובה, תחילה לחץ על הכרטיסיה נתונים כימות בכדי לקבל מחזור כמותית (Ct/סי ערך) של כל דגימה, ייצוא ל- Microsoft Excel.
    3. בעזרת גיליון אלקטרוני, לחשב את הממוצע של כל דגימה באמצעות הערך Ct. לאחר מכן, לחץ על בנוסחאות ובחר את הממוצע. הערכים CT הממוצע של כל דגימה (שכפול) משמשים לצורך ניתוח נוסף.
    4. בשלב הבא, לחשב את ΔCt באמצעות ΔCt את הנוסחה = average Ct של הגן היעד - ממוצע של Ct של הגן בקרה (במקרה זה, ΔCt = average Ct של הגן ZIKV - ממוצע של Ct של הגן B2M).
    5. לחשב את ΔΔCt כדי לנרמל את הנתונים (במקרה זה, ΔΔCt = ΔCt ZIKV דגימות - B2M דגימות).
    6. לחשב את שהקיפול להגדיל את ביטוי גנים על-ידי הקלדת את 2^-(ΔΔCt) נוסחה עבור כל ערך יחיד ΔΔCt מנורמל. ניתן לקבל את התוצאות של העלייה קיפול כדי לבצע בדיקות סטטיסטיות כפי שמתואר מחקרים קודמת9,10.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

איור 1, יש דוגמה diagrammatic שלב אחר שלב של כל השלבים המעורבים לבצע את פרוטוקול אייד. . זה תרשים סכימטי. מראה כל הליך איד של ZIKV עקב החסינות קיימת מראש DENV. איור 2 מציג בנסיוב אדם כמה דוגמאות היו מקוטלגים לשלוש קבוצות שונות: DENV אישר זיהום דגימות מכונים הקבוצה נגועה DENV, DENV נוגדן-אישר הדגימות לייב הקבוצה חשופים DENV, וגם בריא סרה יחידים ללא נוגדנים DENV-נטרול או RNA נקראות קבוצת הביקורת בריא (HC). (איור 2).

כל הדוגמאות סרום הורשו לעשות מתחמי עם ZIKV, ואז שימשו כדי להדביק תאי מקרופאג. לאחר 48 שעות postinfection, RNA היה חילוץ, נתון לרביעיית-PCR. הניסוי נציג באיור 3 מדגים כי רוב sera המכיל נוגדנים serotype 1 עד 4 DENV הצליחו לשפר את ZIKV שכפול ברמות שונות. העלייה הגבוהה ביותר ZIKV titers נמצא את המקרופאגים שטופלו סרה המכיל נוגדנים serotype 2 ו- 4 DENV לעומת serotype 1 ו- 3, אשר הראו אינדוקציה יחסית פחות של ZIKV.

Figure 1
איור 1 : Diagrammatic איור של פרוטוקול אייד. איור שלב אחר שלב מראה את כל השלבים מעורב פרוטוקול כל. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 : סכמטי של התהליך ניסיוני. שלושה סוגים של sera היו מודגרות בווירוס Zika. קבוצת שאני כללה דוגמאות DENV-RNA חיוביות (DENV-נגוע). הקבוצה השנייה כללה דוגמאות DENV-נוגדנים חיובי (חשופים DENV). קבוצה השלישי כללה דוגמאות ללא DENV RNA או נוגדנים (פקדי בריא). התערובת וירוס-סרה נוספה הזיהום לכמת מאקרופאגים אנושי. איור זה השתנה מ- Londono-Renteria et al.8. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3 : סרה המערכת החיסונית DENV משפר זיהום ZIKV הראשית מקרופאגים אנושי. סרה האנושי המכיל נוגדנים DENV (DENV1-4 serotype אישר, Col הם serotype לא ידוע) או מפני פקדי בריא היו 1:10 מדולל כדי 1:10,000, מודגרות עם ZIKV. שרה מתוארים בטבלה 1. ראשי מקרופאגים אנושית מבודדת נדבקו עם ZIKV לבד או עם תערובות של ZIKV-סרה. סרה המכיל נוגדנים () DENV1. (b) DENV2 המכיל נוגדנים סרה. (ג) DENV3 המכיל נוגדנים סרה. (ד) DENV4 המכיל נוגדנים סרה. (e) DENV-נוגדן סרה מן קולומביאני 1 בודדים. (f) DENV-נוגדן סרה מן קולומביאני 2 בודדים. הזיהום נמדדה על ידי ניתוח לרביעיית-PCR-48 שעות postinfection. טכנית וביולוגית משכפל נעשו דולר. הם איחדו את הנתונים, וציין קווי השגיאה סטיית תקן. הסטודנט t-מבחן ANOVA שימשו עבור ניתוח סטטיסטי. P < 0.001. איור זה השתנה מ- Londono-Renteria et al.8. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Table 1
טבלה 1: פרופיל תרמי של לרביעיית-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

אשיג נוגדנים DENV שמוביל אייד של אחרים DENV אשר נגרמו מהזנים אליהם יש הפריע הפיתוח של חיסון יעיל11. ZIKV שייך למשפחת אותו, Flaviviridae, ויש הומולוגיה ניכר עם flaviviruses אחרים, במיוחד DENV12. המטרה העיקרית של נטרול נוגדנים הן ZIKV והן DENV הוא חלבון מעטפת, אשר חולקת הומולוגיה של רצף רבעוני מבניים גבוהה מאוד בין שני וירוסים13,14,15. זה הוכח, כי חסינות מראש או DENV או ZIKV יכול לשפר את הזיהום של ה אחר וירוס8,16.

ישנם מספר שיטות שונות המועסקים לכמת את infectivity ויראלי בניסויים אייד, החל פלאק מבחני17, תאיים אנטיגן ויראלי מכתים באמצעות נוגדנים מצומדת עם צבעי פלורסנט, cytometry זרימה18 ,19. מבחני אלה הם וישימה לא בקלות תפוקה גבוהה של דגימות מרובים ועתירת באותו זמן. חשוב, רוב המחקרים בשימוש נוגדנים חד-שבטיים DENV ספציפיים כדי לבדוק את השפעתם על ZIKV ובחן את איד תא קווים רק20,21. ב פרוטוקול זה, אנו מתארים שיטה פשוטה אך יעילה שבה השתמשנו בדגימות בנסיוב אדם חסין מראש כי יש יכולת נטרול נגד DENV, יחד עם ראשי תאים חיסוניים אנושי, כדי לבחון את השפעת סרום החולה על שכפול ZIKV על ידי העסקת לרביעיית-PCR. שיטה זו היא איתנה, רלוונטי, יכולה להסתיים תוך שלושה ימים. למרות התוצאות נציג כתב יד זה מציגות את היישום שלה עבור ZIKV, פרוטוקול זה יכול להיות בקלות שונה, משמש flaviviruses אחרים, כמו קדחת צהובה וירוס, וירוס דנגה קדחת הנילוס המערבי. אחד גורם חשוב שיש לקחת בחשבון הוא פרוטוקול זה יש מגבלה של הבחנה בין RNA נגיפי בוגר וילדותי.

במהלך הפרוטוקול, חשוב לתת שיקול דעת זהיר בעת ביצוע של עקירות RNA, המבטיח כי הסביבה היא נטולת RNase במהלך הרנ א הטיפול. יתר על כן, מניות ויראלי צריכה להיות הקרת ב 37 מעלות צלזיוס בתוך אמבט מים למשך 1-2 דקות, מיד לשים על קרח. עם זאת, הנגיף לא צריך להישמר על קרח במשך זמן רב ככל, ואז, הוא יאבד את infectivity שלה.

תוצאות קודמות הדגימו כי פרוטוקול זה מאוד נוח, ובעלת יכולת להתמודד עם מספר רב של דוגמאות, יכולה להסתיים תוך זמן יחסית קצר יותר מאשר שיטות אחרות. פרוטוקול זה יש פוטנציאל לשמש וזמינותו שימושי ללימודי אייד בעתיד.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים יש ריהצהל.

Acknowledgments

עבודה זו נתמכה בנדיבות על ידי 1R21AI129881-01 (ל T.M.C.), סטארט-אפ קרנות לאומיות המתעוררים זיהומיות מחלות המעבדות, ואת הספר לרפואה של אוניברסיטת בוסטון.

Materials

Name Company Catalog Number Comments
Fetal Bovine Serum  GEMINI 100-106
iCycler  BioRad 785BR02188 Model No. CFX96 Optics Module
Microfuge 18 Centrifuge Beckman Coulter  367160
Nanodrop-1000 Thermoscientific  1072
Quantifast SYBR-One step RT-PCR kit  Qiagen  204154 Used for 1 step RT-qPCR
RNeasy RNA Isolation Kit  Qiagen  74106 Used for RNA extraction
RPMI-medium  Gibco 11875093

DOWNLOAD MATERIALS LIST

References

  1. Hayes, E. B. Zika virus outside Africa. Emerging Infectious Diseases. 15, 1347-1350 (2009).
  2. Grard, G., et al. Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus. PLoS Neglected Tropical Diseases. 8, (2), 2681 (2014).
  3. Fauci, A. S., Morens, D. M. Zika Virus in the Americas--Yet Another Arbovirus Threat. New England Journal of Medicine. 374, (7), 601-604 (2016).
  4. Hawkes, R. A. Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls. Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).
  5. Musso, D., Gubler, D. J. Zika Virus. Clinical Microbiology Reviews. 29, (3), 487-524 (2016).
  6. Vaughn, D. W., et al. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. The Journal of Infectious Diseases. 181, (1), 2-9 (2000).
  7. Khandia, R., et al. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection. Frontiers of Immunology. 9, 597 (2018).
  8. Londono-Renteria, B., et al. A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement. Journal of General Virology. 98, (7), 1702-1712 (2017).
  9. Ganger, M. T., Dietz, G. D., Ewing, S. J. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments. BMC Bioinformatics. 18, (1), 534 (2017).
  10. Renn, L. A., et al. High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes. Journal of Visualized Experiments. (97), e52650 (2015).
  11. McArthur, M. A., et al. Dengue vaccines: recent developments, ongoing challenges and current candidates. Expert Review of Vaccines. 12, (8), 933-953 (2013).
  12. Priyamvada, L., et al. Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology. Emerging Microbes and Infections. 6, (5), 33 (2017).
  13. Dai, L., et al. Molecular basis of antibody-mediated neutralization and protection against flavivirus. IUBMB Life. 68, (10), 783-791 (2016).
  14. Dai, L., et al. Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody. Cell Host & Microbe. 19, (5), 696-704 (2016).
  15. Sirohi, D., et al. The 3.8 A resolution cryo-EM structure of Zika virus. Science. 352, (6284), 467-470 (2016).
  16. George, J., et al. Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques. Scientific Reports. 7, (1), 10498 (2017).
  17. Morens, D. M., Halstead, S. B. Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies. Journal of General Virology. 71, Pt 12 2909-2914 (1990).
  18. Dejnirattisai, W., et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science. 328, (5979), 745-748 (2010).
  19. Priyamvada, L., et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7852-7857 (2016).
  20. Charles, A. S., Christofferson, R. C. Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro. PLoS Currents. 8, (2016).
  21. Swanstrom, J. A., et al. Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus. MBio. 7, (4), (2016).
כימות של נוגדנים תלויי שיפור של הנגיף Zika בתאי אדם ראשי
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).More

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter