Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Quantificazione di esaltazione anticorpo-dipendente del Virus in cellule umane primarie Zika

doi: 10.3791/58691 Published: January 18, 2019

Summary

Descriviamo un metodo per valutare l'effetto di pre-esistenti immunità contro il virus della dengue sull'infezione del virus di Zika utilizzando siero umano, cellule umane primarie e quantificazione di infezione da reazione a catena della polimerasi quantitativa in tempo reale.

Abstract

Il recente emergere del flavivirus Zika e complicazioni neurologiche, quali sindrome di Guillain-Barré e microcefalia in infanti, ha portato sicurezza pubblica gravi preoccupazioni. Tra i fattori di rischio, esaltazione anticorpo-dipendente (ADE) rappresenta la minaccia più significativa, come la recente ricomparsa del virus Zika (ZIKV) è principalmente nelle zone dove la popolazione è stata esposta ed è in uno stato di pre-immunità agli altri strettamente connessi flavivirus, specialmente virus dengue (DENV). Qui, descriviamo un protocollo per quantificare l'effetto degli anticorpi del siero umano DENV sull'infezione di ZIKV in cellule umane primarie o linee cellulari.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tra le malattie virali trasmesse da zanzare, Zika infezione è uno del più clinicamente importante1. L'infezione è causata da flavivirus ZIKV che, nella maggior parte dei casi, utilizza Aedes aegypti come suo principale vettore1,2. Tuttavia, ci sono studi che hanno segnalato Aedes albopictus come un vettore primario in alcuni focolai ZIKV3. Anche se l'infezione è asintomatica in molti casi, i sintomi più comuni sono febbre, mal di testa e muscolo dolore2. Non c'è nessuna cura o vaccino disponibile per infezione ZIKV e il trattamento disponibile per la maggior parte è favorevole. Recente insorgenza di ZIKV in Sud America ha portato a gravi casi di malattia e un aumento di circa 20 volte nel disordine dello sviluppo neurologico nei feti che si chiamano microcefalia2. Come il Sud America è una zona endemica per diversi arbovirus come DENV e West Nile virus, è fondamentale indagare se preventiva immunità alle altre flavivirus(es) gioca un ruolo nella severità delle infezioni ZIKV e malattia.

Nel corso dei secoli, i virus hanno evoluto strategie differenti per aumentare le proprie chance di infettività al fine di prendere in consegna la macchina di cellula ospite e sopprimere la risposta antivirale. Uno dei più affascinanti di tutti è l'uso degli host anticorpi pre-immune dai virus per migliorare la loro replica con il fenomeno ADE4. ADE in tutti i quattro sierotipi di DENV è stata ben studiata e ha dimostrato di aumentare i titoli virali e malattia risultato5,6,7. In un precedente studio in vitro, abbiamo dimostrato un miglioramento significativo della replica di ZIKV a causa di preesistenti immunità DENV in cellule immuni umane primarie8. Inoltre, abbiamo dimostrato un metodo in vitro pertinente per quantificare la capacità degli anticorpi preesistenti DENV per migliorare la replica di ZIKV in cellule primarie.

Il protocollo che abbiamo sviluppato utilizza campioni di siero umano che vengono testati per la neutralizzazione di DENV in TCID 50 o prova di neutralizzazione di riduzione della placca (PRNT) assays, insieme con ZIKV in cellule biologicamente rilevanti o cellule derivate dai tessuti che possono infettare ZIKV.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Campioni di siero utilizzati in questo studio sono stati ottenuti dai partecipanti umani di una coorte da Columbia. Raccolta dei campioni è stata approvata dal comitato di revisione interna (IRB) presso Universidad de Pamplona (Colombia, Sud America) e Los Potios ospedale8. I campioni sono stati forniti in forma anonima e gli investigatori non avevano accesso alle informazioni sui pazienti. I campioni di siero sono stati controllati per il sierotipo DENV. I campioni sono stati ulteriormente confermati per neutralizzare l'infezione DENV in vitro. Per il controllo, sono stati utilizzati campioni di siero da individui sani (HC) dagli Stati Uniti.

Nota: Questo protocollo può essere usato per esaminare la replica di ADE di ZIKV in qualsiasi tipo di cellula umana che esprimono il recettore fcy. Il protocollo è costituito da tre parti (Figura 1).

1. cellula semina e infezione di installazione

Nota: Per questo studio particolare, macrofagi umani primari o varietà di cellula myelomonocytic U937 (ATCC-CRL-1593.2) sono stati usati. Le cellule sono state mantenute nel medium di crescita RPMI supplementato con 10% siero bovino fetale (FBS) a un incubatore a 37 ° C con 5% di anidride carbonica (CO2). Tutti i passaggi sono stati effettuati in una biosicurezza livello 2 mobile di biosafety (BSL-2) in condizioni sterili.

  1. Cellule di4 seme 3 x 10 per bene in una piastra a 96 pozzetti a fondo piatto sterile con 100 µ l di terreno e metterli nell'incubatore 37 ° C con 5% CO2.
  2. Dopo la semina delle cellule, scongelare i campioni di siero a temperatura ambiente ed effettuare diluizioni seriali 10 volte (cioè, 1/10, 1/100, 1/1.000, 1/10.000) mescolando i campioni in medium senza siero. Aliquotare le diluizioni in una piastra a 96 pozzetti sterile. Utilizzare il virus senza siero come un ulteriore controllo.
  3. Scongelare il brodo ZIKV a 37 ° C in un bagno di acqua per 1-2 min e trasferirli rapidamente in ghiaccio per un utilizzo futuro.
  4. Aggiungere una molteplicità 0.1 di quantità equivalente di infezione (MOI) del ceppo ZIKV MR766 per le aliquote di siero.
    Nota: Assicurarsi che il fattore di diluizione rimane costante e il volume totale è di ~ 200 µ l; Questo è sufficiente per triplici copie di ogni trattamento. Tenere tre pozzi non infetti da utilizzare come controllo negativo per analisi a valle.
  5. Incubare le diluizioni del siero con il virus aggiunto nell'incubatore 37 ° C con 5% CO2 per 1 h al fine di consentire gli anticorpi DENV per formare complessi con i virions Zika (per comodità, in appresso denominata "complessi immuni").
  6. Aspirare i media dalle cellule che sono state seminate nella piastra a 96 pozzetti a fondo piatto. Lavare le cellule con sterile 1x tampone fosfato salino (1x PBS).
  7. Aggiungere 50 µ l di complessi immuni ad ogni pozzetto e incubare a loro nell'incubatore 37 ° C con 5% CO2 per 2 h.
  8. Dopo 2 h di incubazione, aspirare il supporto contenente i complessi immuni dalle celle, tramite un multicanale Pipettare e lavare le cellule 2 x con PBS 1X per rimuovere completamente i complessi immuni e qualsiasi virioni non collegati.
  9. Aggiungere 100 µ l di fresco multimediale completo supplementato con 10% FBS a ciascun pozzetto ed incubare le cellule nell'incubatore 37 ° C con 5% CO2 per 48 h.

2. estrazione del RNA

  1. Rimuovere la piastra a 96 pozzetti dall'incubatrice e trasferirlo alla cappa di biosicurezza.
  2. Aspirare i media, lavare le cellule 2 x con PBS 1X e procedere all'estrazione di RNA.
    Nota: RNA possa essere estratti con qualsiasi metodo di scelta (fare riferimento alla Tabella materiali).
  3. Aggiungere 250 µ l di tampone di lisi delle cellule con 10% β-mercaptoetanolo per pozzetto. Dispensare il buffer su e giù per almeno 5 x insieme a graffiare le cellule con la punta della pipetta per velocizzare la procedura di lisi.
  4. Trasferire i lisati di cellule nuove, con etichetta, sterili da 1,5 mL provette.
  5. Aggiungere una pari quantità di etanolo al 70% (250 µ l). Pipettare su e giù per 4x - 5x fino a quando la miscela è chiara.
  6. Trasferire la miscela (~ 500 µ l) indicata con colonne a base di silice nelle provette di raccolta da 2 mL e centrifugare a 15.000 x g per 30 s. scartare il flusso attraverso e mantenere le colonne nelle provette di raccolta stesso.
  7. Aggiungere 700 µ l di tampone di lavaggio 1 a ogni colonna e centrifugare a 15.000 x g per 30 s. scartare il flusso attraverso e mantenere le colonne nelle provette di raccolta stesso.
  8. Aggiungere 500 µ l di tampone di lavaggio 2 per ogni colonna e centrifugare a 15.000 x g per 30 s. scartare il surnatante. Ripetere questo passaggio x 2.
  9. Trasferimento le colonne in nuove provette di raccolta da 2 mL e centrifugare a 15.000 x g per 2 min. Accertarsi che le colonne basate su silice ottenere completamente asciutte e non c'è nessun etanolo lasciate dal tampone di lavaggio 2.
  10. Scartare i tubi da 2 mL e posizionare le colonne nel nuovo, sterile, etichettato, provette da 1,5 mL recupero.
  11. Aggiungere preriscaldata (42 ° C) 30 µ l di acqua RNAsi-libera al centro di ogni colonna e centrifugare a 15.000 x g per 1 min.
  12. Recuperare il RNA eluito e quantificare i campioni, utilizzando uno spettrofotometro alla lunghezza d'onda di 260 nm.
    Nota: Idealmente, determinare la purezza del RNA calcolando il rapporto tra i valori di assorbanza a 260 nm e 280 nm. Rapporto di 260/280 di RNA purificato è idealmente tra 1.8-2.0.

3. quantitativa Real-Time Polymerase Chain Reaction

Nota: Reazione a catena della polimerasi in tempo reale quantitativa (qRT-PCR) può essere effettuata utilizzando qualsiasi combinazione SYBR green che solitamente si compone di SYBR Green tingere, Taq DNA polimerasi, deossinucleotidi trifosfati (dNTPs) e una tintura passiva. Qualsiasi macchina qPCR capace di rilevazione di SYBR green può essere utilizzata per eseguire la reazione e acquisire i dati. Per questo esperimento, un kit di One-step RT-PCR è stato usato che aveva un cocktail di SYBR Green I, ROX tintura, Taq DNA polimerasi, dNTP e un'ulteriore miscela della trascrittasi inversa (vedere Tabella materiali). I primer progettato contro la regione di busta e utilizzato in questo studio per quantificare i livelli di genomica di ZIKV sono CCGCTGCCCAACACAAG per ZIKV-qF e CCACTAACGTTCTTTTGCAGACAT per ZIKV-qR. Come controllo, umano β-2-microglobulina (B2M) è stata misurata e utilizzato per normalizzare l'espressione di ZIKV (gene housekeeping). Le sequenze dell'iniettore per quantificare l'espressione genica di B2M utilizzato in questo studio sono CTCCGTGGCCTTAGCTGTG per B2M-qF e TTTGGAGTACGCTGGATAGCCT per B2M-qR. Assicurarsi di mettere tre tecnici replicati per ciascun campione per i geni di B2M e il ZIKV. L'installazione della RT-PCR è brevemente descritto di seguito.

  1. Installazione di RT-PCR
    1. Uso 100 ng di RNA per campione.
    2. Aggiungere 1 µ l da 10 azioni µM di primers inversa e diretta di un gene particolare per ogni reazione.
    3. Aggiungere 0,25 µ l di miscela della trascrittasi inversa per esempio.
    4. Per ogni reazione individuale, aggiungere 12,5 µ l della miscela SYBR Green.
    5. Aggiungere fino a 25 µ l di acqua. Fare un master di tutti i suddetti reagenti tranne RNA, aliquota mescolarlo nella piastra PCR a 96 pozzetti, e aggiungere RNA Ultima.
    6. Sigillare la piastra con nastro adesivo trasparente.
    7. Centrifugare la piastra a 1.000 x g per 1 min mescolare i reagenti.
    8. Mettere la piastra nella macchina qPCR.
  2. Profilo di RT-PCR
    Nota: Utilizzare il profilo di RT-PCR indicato nella tabella 1.
    1. Incubare i campioni a 50 ° C per 10 min al fine di garantire la sintesi di DNA complementare (cDNA).
    2. Dopo la sintesi di cDNA, attivare la Taq DNA polimerasi a 95 ° C per 5 min.
    3. Eseguire 40 cicli di denaturazione a 95 ° C per 10 s e ricottura di primer e l'estensione a 60 ° C per 30 s.
    4. Mettere il passo di curva di fusione aggiuntive (65° C) alla fine.
  3. Analisi dei dati
    1. Monitorare la curva di fusione facendo clic sulla scheda curva di fusione nel programma utilizzato per eseguire la macchina qPCR, che, idealmente, Mostra un singolo picco in tutti i campioni per un particolare gene confermare la presenza di solo un amplicone e un valore di amplificazione più di 1,6 se il algori THM considera 2 come il valore di amplificazione di 100% (il valore di amplificazione varia in base all'algoritmo utilizzato dalla macchina qPCR). Assicurarsi di utilizzare con incrementi di 0,5 ° C temperatura tra passaggi e un minimo di partecipazione di tempo di 10 s dal protocollo di curva di fusione, per ottenere risultati ottimali.
    2. Dopo essersi assicurati che non ci sono un valore singolo amplicone e buona amplificazione prima fare clic sulla scheda di dati di quantificazione per ottenere un ciclo quantitativo (valore di Ct/Cq) di ciascun campione ed esportare in Microsoft Excel.
    3. Utilizzando un foglio di calcolo, calcolare la media di ciascun campione utilizzando il valore di Ct. Successivamente, fare clic nelle formule e selezionare Media. I valori di CT medio di ogni campione (replica) vengono utilizzati per ulteriori analisi.
    4. Successivamente, calcolare il ΔCt utilizzando la formula ΔCt = media Ct del gene target - media Ct del gene di controllo (in questo caso, ΔCt = media Ct del gene ZIKV - media Ct del gene B2M).
    5. Calcolare ΔΔCt per normalizzare i dati (in questo caso, ΔΔCt = ΔCt ZIKV - esempi B2M).
    6. Calcolare che la piega aumenta l'espressione genica digitando la formula 2^-(ΔΔCt) per ogni valore di singola ΔΔCt normalizzato. I risultati dell'aumento di piega per eseguire test statistici possono essere ottenuti come descritto in precedenti studi9,10.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nella Figura 1, c'è un'illustrazione schematica passo passo tutti i passaggi eseguire il protocollo di ADE. È un diagramma schematico mostrando tutta la procedura di ADE di ZIKV dovuto immunità pre-esistente a DENV. La figura 2 Mostra come siero campioni sono stati classificati in tre gruppi differenti: campioni di infezione confermata DENV sono indicati come il gruppo DENV-infettati, DENV anticorpo-confermato campioni sono denominati il gruppo DENV-esposti e sano sieri degli individui senza anticorpi neutralizzanti DENV o RNA sono chiamati il gruppo di controllo sano (HC). (Figura 2).

Tutti i campioni di siero sono stati permessi fare complessi con ZIKV e sono stati poi utilizzati per infettare cellule del macrofago. Dopo un postinfection di 48h, RNA è stato estratto e sottoposto a qRT-PCR. L'esperimento rappresentanza nella Figura 3 viene illustrato che la maggior parte dei sieri contenenti anticorpi sierotipo 1 a 4 DENV erano in grado di migliorare la replica ZIKV a diversi livelli. Il maggior incremento nei titoli ZIKV è stato trovato nei macrofagi trattati con sieri contenenti anticorpi sierotipo 2 e 4 DENV rispetto al sierotipo 1 e 3, che ha mostrato un relativamente meno induzione di ZIKV.

Figure 1
Figura 1 : Illustrazione schematica del protocollo ADE. Un'illustrazione passo passo vengono illustrati tutti i passaggi l'intero protocollo. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 : Schematica delle procedure sperimentali. Tre tipi di sieri sono stati incubati con il virus di Zika. Gruppo che i ha consistito dei campioni in DENV-RNA positivi (DENV-infettati). Gruppo II ha consistito dei campioni in DENV-anticorpo positivi (DENV-esposti). Gruppo III ha consistito dei campioni senza DENV RNA o anticorpo (comandi sani). La miscela di virus-sieri inserita in macrofagi umani e l'infezione quantificato. Questa figura è stata modificata da Londono-Renteria et al.8. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 : Sieri immuni DENV migliora l'infezione ZIKV in macrofagi umani primari. Siero umano contenente anticorpi DENV (DENV1-4 sono sierotipo confermato, Col sierotipo sconosciuto) o da controlli sani sono stati diluiti 01:10 a 1: 10.000 e incubati con ZIKV. I sieri sono descritti nella tabella 1. Primaria di macrofagi umani isolati sono stati infettati con ZIKV da solo o con le miscele di ZIKV-sieri. (un) DENV1 sieri contenenti anticorpi. (b) DENV2 sieri contenenti anticorpi. (c) DENV3 sieri contenenti anticorpi. (d) DENV4 sieri contenenti anticorpi. (e), DENV-anticorpo sieri da colombiano individuali 1. (f), DENV-anticorpo sieri da colombiano 2 singoli. L'infezione è stata misurata dall'analisi di qRT-PCR a un postinfection di 48 h. Repliche di tecniche e biologiche sono state fatte in triplice copia. I dati sono riuniti, e le barre di errore indicano la deviazione standard. Di Student t-test e ANOVA sono stati utilizzati per l'analisi statistica. P < 0,001. Questa figura è stata modificata da Londono-Renteria et al.8. Clicca qui per visualizzare una versione più grande di questa figura.

Table 1
Tabella 1: Profilo termico di qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Cross-reattività degli anticorpi DENV verso l'ADE di altri sierotipi DENV ha ostacolato lo sviluppo di un vaccino efficace11. ZIKV appartiene alla stessa famiglia, Flaviviridae e ha una notevole omologia con altri flavivirus, soprattutto DENV12. Il bersaglio principale degli anticorpi neutralizzanti per ZIKV e DENV è la proteina dell'involucro, che condivide un'omologia di sequenza strutturale e Quaternario molto elevato tra i due virus13,14,15. È stato dimostrato che pre-immunità a DENV o ZIKV può migliorare l'infezione di altri il virus8,16.

Ci sono una serie di diversi metodi utilizzati per quantificare l'infettività virale negli esperimenti di ADE, che vanno dalla placca saggi17, antigene virale intracellulare che macchia usando gli anticorpi coniugati con coloranti fluorescenti e citometria a flusso18 ,19. Queste analisi sono che richiede tempo e non facilmente adattabile per il high-throughput di campioni multipli allo stesso tempo. D'importanza, la maggior parte degli studi utilizzati anticorpi monoclonali specifici DENV per verificare il loro effetto sulla ZIKV e ha esaminato l'ADE in cella linee soltanto20,21. In questo protocollo, descriviamo un metodo semplice ma efficace, in cui abbiamo utilizzato campioni di siero pre-immune umano che hanno una capacità neutralizzanti contro DENV, insieme a cellule immuni umane primarie, per esaminare l'effetto del siero del paziente sulla replica di ZIKV impiegando qRT-PCR. Questo metodo è robusto, pertinenti e può essere completato in tre giorni. Anche se i risultati rappresentativi in questo manoscritto mostrano la sua applicazione per ZIKV, questo protocollo può essere facilmente modificato e utilizzato per altri flavivirus, come il virus della febbre gialla, virus dengue e West Nile virus. Un fattore importante da considerare è che questo protocollo ha una limitazione nella distinzione fra RNA virale maturo e immaturo.

Durante il protocollo, è fondamentale prestare particolare attenzione quando si eseguono le estrazioni RNA, assicurando che l'ambiente sia privo di RNAsi durante tutto il RNA manipolazione. Inoltre, stock virali dovrebbe essere scongelate a 37 ° C in un bagno di acqua per 1-2 min e subito messo sul ghiaccio. Tuttavia, il virus non dovrebbe essere tenuto su ghiaccio per molto tempo come, allora, può perdere sua infettività.

Risultati precedenti hanno dimostrato che questo protocollo è altamente conveniente e adattabili per gestire un gran numero di campioni e può essere completato in meno tempo rispetto ad altri metodi. Questo protocollo ha il potenziale per essere utilizzato come un test utile per gli studi futuri di ADE.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da dichiarare.

Acknowledgments

Questo lavoro è stato generosamente supportato da 1R21AI129881-01 (al t.m.c.), fondi di Start-up dal National Laboratories malattie infettive emergenti e la Boston University School of Medicine.

Materials

Name Company Catalog Number Comments
Fetal Bovine Serum  GEMINI 100-106
iCycler  BioRad 785BR02188 Model No. CFX96 Optics Module
Microfuge 18 Centrifuge Beckman Coulter  367160
Nanodrop-1000 Thermoscientific  1072
Quantifast SYBR-One step RT-PCR kit  Qiagen  204154 Used for 1 step RT-qPCR
RNeasy RNA Isolation Kit  Qiagen  74106 Used for RNA extraction
RPMI-medium  Gibco 11875093

DOWNLOAD MATERIALS LIST

References

  1. Hayes, E. B. Zika virus outside Africa. Emerging Infectious Diseases. 15, 1347-1350 (2009).
  2. Grard, G., et al. Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus. PLoS Neglected Tropical Diseases. 8, (2), 2681 (2014).
  3. Fauci, A. S., Morens, D. M. Zika Virus in the Americas--Yet Another Arbovirus Threat. New England Journal of Medicine. 374, (7), 601-604 (2016).
  4. Hawkes, R. A. Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls. Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).
  5. Musso, D., Gubler, D. J. Zika Virus. Clinical Microbiology Reviews. 29, (3), 487-524 (2016).
  6. Vaughn, D. W., et al. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. The Journal of Infectious Diseases. 181, (1), 2-9 (2000).
  7. Khandia, R., et al. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection. Frontiers of Immunology. 9, 597 (2018).
  8. Londono-Renteria, B., et al. A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement. Journal of General Virology. 98, (7), 1702-1712 (2017).
  9. Ganger, M. T., Dietz, G. D., Ewing, S. J. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments. BMC Bioinformatics. 18, (1), 534 (2017).
  10. Renn, L. A., et al. High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes. Journal of Visualized Experiments. (97), e52650 (2015).
  11. McArthur, M. A., et al. Dengue vaccines: recent developments, ongoing challenges and current candidates. Expert Review of Vaccines. 12, (8), 933-953 (2013).
  12. Priyamvada, L., et al. Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology. Emerging Microbes and Infections. 6, (5), 33 (2017).
  13. Dai, L., et al. Molecular basis of antibody-mediated neutralization and protection against flavivirus. IUBMB Life. 68, (10), 783-791 (2016).
  14. Dai, L., et al. Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody. Cell Host & Microbe. 19, (5), 696-704 (2016).
  15. Sirohi, D., et al. The 3.8 A resolution cryo-EM structure of Zika virus. Science. 352, (6284), 467-470 (2016).
  16. George, J., et al. Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques. Scientific Reports. 7, (1), 10498 (2017).
  17. Morens, D. M., Halstead, S. B. Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies. Journal of General Virology. 71, Pt 12 2909-2914 (1990).
  18. Dejnirattisai, W., et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science. 328, (5979), 745-748 (2010).
  19. Priyamvada, L., et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7852-7857 (2016).
  20. Charles, A. S., Christofferson, R. C. Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro. PLoS Currents. 8, (2016).
  21. Swanstrom, J. A., et al. Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus. MBio. 7, (4), (2016).
Quantificazione di esaltazione anticorpo-dipendente del Virus in cellule umane primarie Zika
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).More

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter