Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Quantificação de realce dependente de anticorpo do vírus nas células humanas primárias Zika

doi: 10.3791/58691 Published: January 18, 2019

Summary

Nós descrevemos um método para avaliar o efeito da imunidade pré-existente contra vírus da dengue sobre a infecção pelo vírus Zika usando soro humano, células humanas primárias e quantificação de infecção por reação em cadeia da polimerase em tempo real quantitativa.

Abstract

O recente surgimento dos flavivirus Zika e complicações neurológicas, como síndrome de Guillain-Barré e microcefalia em lactentes, tem trazido preocupações sérias de segurança pública. Entre os fatores de risco, realce dependente de anticorpos (ADE) é uma ameaça a mais significativa, como o recente ressurgimento do vírus Zika (ZIKV) é principalmente em áreas onde a população foi exposta e está em um estado de pré-imunidade para outras estreitamente relacionadas flavivírus, especialmente o vírus da dengue (DENV). Aqui, descrevemos um protocolo para quantificar o efeito dos anticorpos de soro humano contra DENV na infecção ZIKV em células humanas primárias ou linhas celulares.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Entre as doenças virais transmitidas por mosquitos, Zika infecção é um do mais clinicamente importantes1. A infecção é causada pelo flavivirus ZIKV que, na maioria dos casos, usa o Aedes aegypti como seu principal vetor1,2. No entanto, existem estudos que relataram Aedes albopictus como um vetor primário em alguns focos ZIKV3. Embora a infecção é assintomática em muitos casos, os sintomas mais comuns são febre, dor de cabeça e dor de músculo2. Não há cura ou vacina disponível para infecção ZIKV e o tratamento disponível na maior parte é favorável. Surtos recentes de ZIKV na América do Sul levaram a casos graves da doença e aumento do distúrbio neurológico em fetos chamada microcefalia2aproximadamente 20-fold. Como a América do Sul é uma zona endémica de vários arbovírus como vírus DENV e do oeste do Nilo, é crucial investigar se imunidade prévia para outros flavivirus(es) desempenha um papel na gravidade de infecções ZIKV e doença.

Ao longo dos tempos, os vírus evoluíram diferentes estratégias para aumentar suas chances de infecciosidade para assumir a maquinaria de célula do hospedeiro e suprimir a resposta antiviral. Uma das mais fascinantes de todos é o uso de anticorpos pre-imune do hospedeiro por vírus para realçar sua replicação com o fenômeno ADE4. ADE em todos os quatro sorotipos de DENV tem sido bem estudada e demonstrada para aumentar a concentração viral e doença resultado5,6,7. Em um estudo in vitro anterior, mostramos uma melhoria significativa da replicação de ZIKV devido ao pré-existente imunidade DENV em células do sistema imunológico humano primário8. Também demonstrámos um método in vitro relevante para quantificar a capacidade dos anticorpos pré-existentes DENV para melhorar a replicação de ZIKV em células primárias.

O protocolo que desenvolvemos usa amostras de soro humano que são testadas para a neutralização de DENV TCID-50 ou ensaios de teste de neutralização de redução de placas (PRNT), juntamente com ZIKV em células biologicamente relevantes ou células derivadas de tecidos que ZIKV pode infectar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Amostras de soro utilizadas neste estudo foram obtidas de humanos participantes de uma coorte de Columbia. Coleta de amostra foi aprovada pelo Conselho de revisão interna (IRB) na Universidad de Pamplona (Columbia, América do Sul) e Los Potios Hospital8. As amostras foram fornecidas anonimamente e os investigadores não tinham acesso a informações do paciente. As amostras de soro foram verificadas para o sorotipo DENV. As amostras foram confirmadas para neutralizar a infecção DENV in vitro. Para controle, utilizaram-se amostras de soro de indivíduos saudáveis (HC) dos EUA.

Nota: Este protocolo pode ser usado para examinar a replicação ADE de ZIKV em qualquer tipo de célula humana, expressando o receptor de Fcγ. O protocolo é composto de três partes (Figura 1).

1. propagação de células e infecção Setup

Nota: Para este estudo particular, macrófagos primários humanos ou linha de celular U937 mielomonocítica (ATCC-CRL-1593.2) foram utilizados. As células foram mantidas em meio de cultura RPMI suplementado com 10% de soro fetal bovino (FBS) em uma incubadora de 37 ° C com 5% de dióxido de carbono (CO2). Todas as etapas foram realizadas em uma biossegurança de nível 2 (BSL-2) do gabinete de segurança biológica em condições estéreis.

  1. Células de4 sementes 3 x 10 por bem em uma placa de 96 poços de fundo plano estéril junto com 100 µ l de meio e colocá-los na incubadora 37 ° C com 5% de CO2.
  2. Após a semeadura as células, descongelar amostras de soro à temperatura ambiente e fazer 10 vezes diluições em série (ou seja, 1/10, 1/100, 1/1.000, 1/10.000), misturando as amostras em meio livre de soro. Alíquota as diluições em uma placa de 96 poços estéril. Use o vírus sem soro como um controle adicional.
  3. Descongelar o estoque ZIKV a 37 ° C em banho-maria por 1-2 min e rapidamente transferi-los para gelo para uso futuro.
  4. Adicione uma multiplicidade 0.1 de quantidade equivalente de infecção (MOI) da estirpe ZIKV MR766 para as alíquotas de soro.
    Nota: Certifique-se que o fator de diluição permanece constante e o volume total é de ~ 200 µ l; é o suficiente para triplica de cada tratamento. Mantenha três poços não infectados para usar como controle negativo para análise a jusante.
  5. Incube as diluições do soro com o vírus adicionado na incubadora 37 ° C com 5% de CO2 para 1 h, a fim de permitir que os anticorpos DENV para formar complexos com os virions Zika (por conveniência, doravante referida como "complexos imunes").
  6. Aspire a mídia a partir de células que foram semeadas em placa de 96 poços de fundo plano. Lave as células com estéril 1x tampão fosfato salino (1X PBS).
  7. Adicionar 50 µ l dos complexos imunes a cada poço e incube-os na incubadora 37 ° C com 5% de CO2 por 2 h.
  8. Depois de 2 h de incubação, aspirar a mídia contendo os complexos imunes de células, usando um multicanal Pipetar e lavar as células 2 x com PBS 1x para remover completamente os imunocomplexos e qualquer virions desanexadas.
  9. Adicione 100 µ l de fresca mídia completa suplementada com 10% FBS a cada bem e incube as celulas na incubadora 37 ° C com 5% de CO2 por 48 h.

2. extração do RNA

  1. Retirar a placa de 96 poços da incubadora e transferi-lo para a armário de biossegurança.
  2. Aspire a mídia, lavar as células 2 x com PBS 1x e proceder à extração do RNA.
    Nota: RNA pode ser extraído por qualquer método de escolha (consulte a Tabela de materiais).
  3. Adicione 250 µ l de tampão de lise celular com 10% de β-Mercaptoetanol por bem. Pipete o buffer e descer pelo menos 5x juntamente com coçar as células com a ponta da pipeta para acelerar o processo de Lise.
  4. Transferi os lisados celulares para tubos novos, rotulado, estéril 1,5 mL.
  5. Adicione uma quantidade igual de etanol a 70% (250 µ l). Pipetar e descer 4 x - 5x até obter uma mistura clara.
  6. Transfira a mistura (~ 500 µ l) para rotulado colunas baseadas em sílica, em tubos de colheita de 2ml e centrifugar a 15.000 x g durante 30 s. descarte o fluxo através de e manter as colunas em tubos de coleção mesmo.
  7. Adicione 700 µ l de tampão de lavagem 1 para cada coluna e centrifugar a 15.000 x g durante 30 s. descarte o fluxo através de e manter as colunas em tubos de coleção mesmo.
  8. Adicione 500 µ l de tampão de lavagem 2 para cada coluna e centrifugação a 15.000 x g por 30 s. descartar o sobrenadante. Repita este passo 2x.
  9. Transferência as colunas para novos tubos de colheita de 2ml e centrifugar 15.000 x g por 2 min. Certifique-se que colunas baseadas em sílica ficam completamente secas e não há nenhum etanol deixaram de tampão de lavagem 2.
  10. Descarte os tubos de 2 mL e coloque as colunas no novo, estéril, rotulado, tubos de recuperação de 1,5 mL.
  11. Adicione escaldadas (42 ° C) 30 µ l de água livre de RNase no centro de cada coluna e centrifugar 15.000 x g por 1 min.
  12. Recuperar o RNA eluted e quantificar as amostras, usando um espectrofotômetro no comprimento de onda de nm 260.
    Nota: Idealmente, determinar a pureza do RNA pelo cálculo da relação entre os valores de absorvância em 260 nm e 280 nm. Relação de 260/280 do RNA purificado é idealmente entre 1.8-2.0.

3. reação em cadeia da polimerase em tempo real quantitativa

Nota: Reação em cadeia da polimerase em tempo real quantitativa (qRT-PCR) pode ser realizada com o uso de qualquer mistura SYBR green, que geralmente é composta de SYBR Green tingir, Taq DNA polimerase, deoxynucleotide trifosfatos (dNTPs) e uma tintura passiva. Qualquer máquina de qPCR capaz de detecção do SYBR verde pode ser usada para realizar a reação e adquirir os dados. Para este experimento, foi utilizado um kit de RT-PCR de uma etapa que teve um coquetel de SYBR Green I, ROX tintura, Taq DNA polimerase, dNTPs e uma mistura adicional de transcriptase reversa (consulte a Tabela de materiais). Os primers desenhado contra a região de envelope e usado neste estudo para quantificar níveis de genômica de ZIKV são CCGCTGCCCAACACAAG para ZIKV-qF e CCACTAACGTTCTTTTGCAGACAT para ZIKV-qR. Como um controle, humana β-2-microglobulina (B2M) foi medido e utilizado para normalizar a expressão de ZIKV (gene de limpeza). As sequências de cartilha para quantificar a expressão de gene B2M usada neste estudo são CTCCGTGGCCTTAGCTGTG para B2M-qF e TTTGGAGTACGCTGGATAGCCT para B2M-qR. Certifique-se de colocar três técnicas repetições para cada amostra para o ZIKV e os genes B2M. A configuração de RT-PCR é brevemente descrita abaixo.

  1. Instalação de RT-PCR
    1. Uso 100 ng do RNA por amostra.
    2. Adicione 1 µ l de 10 ações µM de primers para diante e reversos de um gene específico para cada reação.
    3. Adicione 0,25 µ l de mistura de transcriptase reversa, por exemplo.
    4. Para cada reação individual, adicione 12,5 µ l de mistura de SYBR Green.
    5. Adicione até 25 µ l de água. Fazer um mestre misturar de todos os reagentes acima mencionados, exceto RNA, alíquota na placa PCR de 96 poços, e adicionar o RNA última.
    6. Feche a placa com fita adesiva transparente.
    7. Centrifugue a placa a 1.000 x g por 1 min misturar os reagentes.
    8. Coloque a placa na máquina de qPCR.
  2. Perfil de RT-PCR
    Nota: Use o perfil de RT-PCR, mostrado no tabela 1.
    1. Incube as amostras a 50 ° C durante 10 minutos para garantir a síntese de DNA complementar (cDNA).
    2. Após a síntese do cDNA, ative a Taq DNA polimerase a 95 ° C por 5 min.
    3. Executar 40 ciclos de desnaturação a 95 ° C por 10 s e recozimento da primeira demão e extensão a 60 ° C por 30 s.
    4. Coloca o passo de curva de derretimento adicionais (65° C) no final.
  3. Análise de dados
    1. Monitorar a curva de derretimento clicando na guia de curva de derretimento no programa usado para executar a máquina qPCR, que, idealmente, mostra um pico único em todas as amostras de um determinado gene confirmar a presença de apenas um amplicon e um valor de amplificação mais de 1.6 se o algori THM considera o valor de amplificação de 100% (o valor de amplificação varia de acordo com o algoritmo usado pela máquina qPCR) 2. Certifique-se de usar incrementos de temperatura de 0,5 ° C entre etapas e um mínimo de tempo de 10 s no protocolo de curva de degelo, para obter melhores resultados.
    2. Depois de certificar-se de que há um único amplicon e amplificação bom valor, primeiro clique na guia dados de quantificação para obter um ciclo quantitativo (valor de Ct/Cq) de cada amostra e exportar para o Microsoft Excel.
    3. Usando uma planilha, calcule a média de cada amostra, usando o valor de Ct. Em seguida, clique em fórmulas e selecione a média. Os valores médios de CT de cada amostra (replicação) são utilizados para uma análise mais aprofundada.
    4. Em seguida, calcular a ΔCt usando a fórmula ΔCt = Ct do gene alvo de média - média Ct do gene do controle (neste caso, ΔCt = Ct do gene ZIKV de média - média Ct do gene B2M).
    5. Calcular ΔΔCt para normalizar os dados (neste caso, ΔΔCt = ΔCt ZIKV samples - amostras de B2M).
    6. Calcule que a dobra aumenta a expressão gênica, digitando a fórmula 2^-(ΔΔCt) para cada valor de ΔΔCt único normalizado. Os resultados do aumento de dobra para realizar testes estatísticos podem ser obtidos como descrito em anteriores estudos9,10.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Na Figura 1, há uma ilustração diagramática passo a passo de todas as etapas envolvidas para realizar o protocolo de ADE. É um diagrama esquemático mostrando todo o processo de ADE de ZIKV devido a imunidade preexistente para DENV. A Figura 2 mostra como soro amostras foram categorizadas em três grupos diferentes: amostras DENV-confirmada a infecção são referidas como o grupo de DENV-infectados, DENV anticorpo-confirmado as amostras são referidos como o grupo de DENV-expostos e saudável soros de indivíduos sem DENV-neutralizando anticorpos ou RNA são chamados de grupo controle saudável (HC). (Figura 2).

Todas as amostras de soro foram autorizadas a fazer complexos com ZIKV e em seguida foram usadas para infectar células de macrófagos. Após postinfection de 48 h, o RNA foi extraído e submetido a qRT-PCR. O experimento representativo na Figura 3 demonstra que a maioria dos soros de contendo anticorpos DENV serótipo 1 a 4 foram capaz de aumentar a replicação de ZIKV em diferentes níveis. O maior aumento em títulos ZIKV foi encontrado em macrófagos tratados com soro contendo anticorpos DENV sorotipo 2 e 4 em comparação com o sorotipo 1 e 3, que mostrou uma relativamente menos indução de ZIKV.

Figure 1
Figura 1 : Ilustração esquemática do protocolo ADE. Uma ilustração passo a passo mostra todas as etapas envolvidas no protocolo todo. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2 : Esquemático do processo experimental. Três tipos de soros foram incubados com vírus Zika. Grupo que consistia em amostras positivas DENV-RNA de (DENV-infectado). Grupo II consistiu em amostras positivas DENV-anticorpo de (DENV-expostos). Grupo III consistiu em amostras sem DENV RNA ou anticorpo (controles saudáveis). A mistura de vírus-soros foi adicionada ao humanos macrófagos e a infecção quantificado. Esta figura foi modificada de Renteria-Londono et al.8. Clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3 : Soros imunes DENV aumenta a infecção ZIKV em macrófagos humanos primários. Soros humanos contendo anticorpos DENV (DENV1-4 sorotipo confirmou, Col são sorotipo desconhecido) ou de controles saudáveis foram diluídos 01:10 de 1:10,000 e incubadas com ZIKV. Os soros são descritos na tabela 1. Primários isolados macrófagos humanos foram infectados com ZIKV sozinho ou com as misturas de ZIKV-soros. (um) DENV1 soro contendo anticorpos. (b) DENV2 contendo anticorpos soros. (c) DENV3 contendo anticorpos soros. (d) DENV4 contendo anticorpos soros. (e) DENV-anticorpo soros de colombiano individuais 1. (f) DENV-anticorpo soros de colombiano 2 individuais. A infecção foi medida pela análise de qRT-PCR em postinfection de 48 h. Técnicas e biológicas réplicas foram feitas em triplicado. Os dados são agrupados e as barras de erro indicam o desvio padrão. T do estudante-test e ANOVA foram utilizados para a análise estatística. P < 0,001. Esta figura foi modificada de Renteria-Londono et al.8. Clique aqui para ver uma versão maior desta figura.

Table 1
Tabela 1: Perfil térmico de qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Reatividade cruzada de anticorpos DENV levando para o ADE de outros sorotipos DENV tem dificultado o desenvolvimento de uma vacina eficaz11. ZIKV pertence à mesma família, Flaviviridae e tem uma considerável homologia com outros flavivírus, especialmente DENV12. O alvo principal de anticorpos neutralizantes para ZIKV e DENV é a proteína de envelope, que compartilha uma homologia de sequência estrutural e quaternário muito alta entre os dois vírus13,14,15. Foi demonstrado que pre-imunidade para DENV ou ZIKV pode aumentar a infecção a outros vírus8,16.

Há um número de diferentes métodos empregados para quantificar a infectividade viral em experimentos de ADE, variando de placa ensaios17, antígeno viral intracelular coloração usando anticorpos conjugados com corantes fluorescentes e citometria de fluxo18 ,19. Estes ensaios são demorados e não é facilmente adaptável para o alto rendimento de várias amostras ao mesmo tempo. Importante, a maioria dos estudos utilizados anticorpos monoclonais de DENV-específicos para verificar seu efeito sobre ZIKV e examinou o ADE em célula linhas apenas20,21. Neste protocolo, descrevemos um método simples mas eficaz, no qual usamos amostras de soro humano pre-imune que têm uma capacidade neutralizante contra DENV, juntamente com células imunitárias humanas primárias, para examinar o efeito do soro na replicação de ZIKV empregando qRT-PCR. Este método é robusto, relevantes e pode ser concluído em três dias. Embora os resultados representativos neste manuscrito mostraram sua aplicação para ZIKV, este protocolo pode ser facilmente modificado e usado por outros flavivírus, como o vírus da febre amarela, vírus da dengue e vírus do Nilo Ocidental. Um fator importante a considerar é que este protocolo tem uma limitação em distinguir entre RNA viral maduro e imaturo.

Durante o protocolo, é fundamental dar atenção ao realizar as extrações de RNA, garantindo que o ambiente é livre de RNase durante todo o RNA etapas de manipulação. Além disso, estoques virais devem ser descongelados a 37 ° C em banho-maria por 1-2 min e coloque imediatamente no gelo. No entanto, o vírus não devem ser mantido em gelo por enquanto, então, ele pode perder sua infecciosidade.

Resultados anteriores têm demonstrado que este protocolo é altamente conveniente e adaptável para lidar com um grande número de amostras e pode ser concluído em relativamente menos tempo do que outros métodos. Este protocolo tem o potencial para ser usado como um ensaio úteis para futuros estudos de ADE.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a declarar.

Acknowledgments

Este trabalho foi generosamente apoiado por 1R21AI129881-01 (a T.M.C), start-up fundos de emergentes infecciosas doenças laboratórios nacionais e o Boston University School of Medicine.

Materials

Name Company Catalog Number Comments
Fetal Bovine Serum  GEMINI 100-106
iCycler  BioRad 785BR02188 Model No. CFX96 Optics Module
Microfuge 18 Centrifuge Beckman Coulter  367160
Nanodrop-1000 Thermoscientific  1072
Quantifast SYBR-One step RT-PCR kit  Qiagen  204154 Used for 1 step RT-qPCR
RNeasy RNA Isolation Kit  Qiagen  74106 Used for RNA extraction
RPMI-medium  Gibco 11875093

DOWNLOAD MATERIALS LIST

References

  1. Hayes, E. B. Zika virus outside Africa. Emerging Infectious Diseases. 15, 1347-1350 (2009).
  2. Grard, G., et al. Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus. PLoS Neglected Tropical Diseases. 8, (2), 2681 (2014).
  3. Fauci, A. S., Morens, D. M. Zika Virus in the Americas--Yet Another Arbovirus Threat. New England Journal of Medicine. 374, (7), 601-604 (2016).
  4. Hawkes, R. A. Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls. Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).
  5. Musso, D., Gubler, D. J. Zika Virus. Clinical Microbiology Reviews. 29, (3), 487-524 (2016).
  6. Vaughn, D. W., et al. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. The Journal of Infectious Diseases. 181, (1), 2-9 (2000).
  7. Khandia, R., et al. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection. Frontiers of Immunology. 9, 597 (2018).
  8. Londono-Renteria, B., et al. A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement. Journal of General Virology. 98, (7), 1702-1712 (2017).
  9. Ganger, M. T., Dietz, G. D., Ewing, S. J. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments. BMC Bioinformatics. 18, (1), 534 (2017).
  10. Renn, L. A., et al. High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes. Journal of Visualized Experiments. (97), e52650 (2015).
  11. McArthur, M. A., et al. Dengue vaccines: recent developments, ongoing challenges and current candidates. Expert Review of Vaccines. 12, (8), 933-953 (2013).
  12. Priyamvada, L., et al. Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology. Emerging Microbes and Infections. 6, (5), 33 (2017).
  13. Dai, L., et al. Molecular basis of antibody-mediated neutralization and protection against flavivirus. IUBMB Life. 68, (10), 783-791 (2016).
  14. Dai, L., et al. Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody. Cell Host & Microbe. 19, (5), 696-704 (2016).
  15. Sirohi, D., et al. The 3.8 A resolution cryo-EM structure of Zika virus. Science. 352, (6284), 467-470 (2016).
  16. George, J., et al. Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques. Scientific Reports. 7, (1), 10498 (2017).
  17. Morens, D. M., Halstead, S. B. Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies. Journal of General Virology. 71, Pt 12 2909-2914 (1990).
  18. Dejnirattisai, W., et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science. 328, (5979), 745-748 (2010).
  19. Priyamvada, L., et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7852-7857 (2016).
  20. Charles, A. S., Christofferson, R. C. Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro. PLoS Currents. 8, (2016).
  21. Swanstrom, J. A., et al. Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus. MBio. 7, (4), (2016).
Quantificação de realce dependente de anticorpo do vírus nas células humanas primárias Zika
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).More

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter