Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Количественное определение антител зависимых повышение Зика вируса в первичных клеток человека

doi: 10.3791/58691 Published: January 18, 2019

Summary

Мы описываем метод для оценки воздействия существующих иммунитет против вируса денге на Зика вирусной инфекции с помощью человеческой сыворотки, первичных клеток человека и инфекции количественной оценки количественных реального времени полимеразной цепной реакции.

Abstract

Недавнее появление flavivirus Зика и неврологических осложнений, таких как синдром Гийена-Барре и микроцефалия новорожденных, принесла серьезные общественной безопасности. Среди факторов риска повышение антитела зависимые (ADE) представляет самую серьезную угрозу, как недавнее возрождение Зика вируса (ZIKV) является главным образом в районах, где население подвергается и находится в состоянии предварительной иммунитета в других тесно связанных flaviviruses, особенно вирус денге (DENV). Здесь мы описываем протокол для количественной оценки воздействия человеческой сыворотке антител против DENV на ZIKV инфекции в первичных клеток человека или клеточных линий.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Среди комаров-вирусных заболеваний Зика инфекции является одним из наиболее клинически важные1. Инфекции, вызванные flavivirus ZIKV, который, в большинстве случаев использует Aedes aegypti в качестве своей основной вектор1,2. Однако есть исследования, которые сообщили Aedes albopictus в качестве основного вектора в некоторых ZIKV вспышки3. Хотя инфекция протекает бессимптомно, во многих случаях, наиболее распространенными симптомами являются лихорадка, головная боль и мышечные боли2. Существует никакого лечения или вакцины для ZIKV инфекции и лечения доступны в основном благоприятной. Недавние вспышки ZIKV в Южной Америке привело к тяжелых случаев заболевания и увеличение приблизительно кратной неврологического расстройства в зародышах, названный микроцефалия2. Как Южная Америка является эндемиком несколько арбовирусов как вирус Западного Нила и DENV области, важно расследовать ли предварительного иммунитет к другим flavivirus(es) играет роль в тяжести ZIKV инфекций и болезней.

На протяжении веков вирусы развивались различные стратегии, чтобы увеличить свои шансы инфекционности для того, чтобы взять на себя принимающей ячейки машины и подавляющие противовирусное. Одним из наиболее интересных из всех является использование предварительно иммунных антител хост вирусами для повышения их репликации с явлением Аде4. ADE на всех четырех серотипы DENV был хорошо изученных и продемонстрировал увеличение вирусной титры и болезни результат5,6,7. В предыдущем исследовании в пробирке мы показали значительное повышение ZIKV репликации из-за существующих DENV иммунитета в первичной иммунные клетки человека8. Мы также продемонстрировали соответствующий метод в пробирке для количественной оценки существующих антител DENV возможность повышения ZIKV репликации в Главные ячейки.

Протокол, который мы разработали использует образцы сыворотки крови человека, которые тестируются для DENV обезвреживания в TCID-50 или assays налета сокращения нейтрализации тест (PRNT), наряду с ZIKV в биологически соответствующие клетки или клетки, полученные из тканей, которые могут заразить ZIKV.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Образцы сыворотки, используемые в данном исследовании были получены от человека участников когорте из Колумбии. Сбор проб был одобрен внутреннего обзора Совет (IRB) в Universidad de Памплона (Колумбия, Южная Америка) и Лос Potios больница8. Образцы предоставляются анонимно и следователи не имели доступа к информации о пациентах. Образцы сыворотки были проверены для DENV серотипа. Образцы были далее подтверждены для нейтрализации DENV инфекции в пробирке. Для управления были использованы образцы сыворотки от здоровых лиц (HC) из США.

Примечание: Этот протокол может использоваться для изучения Аде ZIKV репликации в любой тип клеток человека, выражая Fcγ рецепторов. Протокол состоит из трех частей (рис. 1).

1. Мобильный посева и инфекции установки

Примечание: Для этого конкретного исследования, человека первичной макрофаги или U937 миеломоноцитная клеточной линии (ATCC-CRL-1593.2) были использованы. Клетки были сохранены в RPMI среднего роста с 10% плода бычьим сывороточным (ФБС) при 37 ° C инкубатор с 5% двуокиси углерода (CO2). Все шаги были проведены в области биобезопасности уровня 2 кабинета по биобезопасности (BSL-2) в стерильных условиях.

  1. Семенной 3 х 104 клетки на хорошо в стерильных плоским-96-луночных днище наряду с 100 мкл среднего и поместите их в инкубатора 37 ° C с 5% CO2.
  2. После посева клетки, оттепель образцы сыворотки при комнатной температуре и сделать десятикратного серийных разведений (т.е., 1/10, 1/100, 1/1000, 1/10 000), смешивая образцов в среде, свободной от сыворотки. Аликвота разведений в стерильных 96-луночных плиту. Используйте этот вирус без сыворотки как дополнительный элемент управления.
  3. Размораживание ZIKV запас при 37 ° C в ванну воды для 1-2 мин и быстро перевести их на льду для использования в будущем.
  4. Добавьте разносторонность 0.1 эквивалентное количество инфекции (МВД) ZIKV штамма MR766 в сыворотке аликвоты.
    Примечание: Убедитесь, что коэффициент разрежения остается неизменным, и общий объем составляет ~ 200 мкл; Это достаточно для triplicates каждого курса лечения. Держите три скважины неинфицированных для использования в качестве отрицательного контроля для анализа ниже по течению.
  5. Инкубируйте разведения сыворотки вирусом добавлен в инкубаторе 37 ° C с 5% CO2 на 1 час для того чтобы позволить DENV антител к образует комплексы с Зика вирионы (для удобства, именуемый в дальнейшем «иммунные комплексы»).
  6. Аспирационная СМИ из клеток, которые были посеяны в 96-луночных пластины с плоским дном. Вымойте клетки с стерильных 1 x фосфат амортизированное saline (ПБС).
  7. Добавьте 50 мкл иммунных комплексов для каждой скважины и инкубировать их в инкубаторе 37 ° C с 5% CO2 на 2 ч.
  8. После 2 ч инкубации, аспирационная СМИ, содержащий иммунных комплексов из клеток, используя многоканальный Пипетка и вымыть клетки 2 x с ПБС полностью удалить иммунных комплексов и любой неприсоединенной вирионов.
  9. 100 мкл свежей полной СМИ, с 10% FBS каждому хорошо и инкубации клеток в инкубаторе 37 ° C с 5% CO2 в течение 48 часов.

2. РНК добыча

  1. Снять пластину 96-луночных из инкубатора и передать его на биобезопасности кабинета.
  2. Аспирационная СМИ, вымыть клетки 2 x с ПБС и приступить к добыче РНК.
    Примечание: РНК могут быть извлечены любым методом выбора (см. Таблицу материалов).
  3. 250 мкл буфера lysis клетки с 10% β-меркаптоэтанол за хорошо. Пипетка буфера вверх и вниз по крайней мере 5 x вместе с царапин кончиком пипетки для ускорения процедуры лизис клетки.
  4. Передать новые, помечены, стерильные 1.5 мл пробирок lysates клетки.
  5. Добавьте равное количество 70% этанола (250 мкл). Пипетка вверх и вниз 4 x - 5 x до тех пор, пока смесь не станет ясно.
  6. Передача смеси (~ 500 мкл) помечены столбцы на основе силики в 2 мл коллекции трубок и центрифуги на 15000 x g для 30 s. отменить через поток и сохранить столбцы в том же коллекции трубок.
  7. 700 мкл буфера мытья 1 для каждого столбца и центрифуги на 15000 x g для 30 s. отменить через поток и сохранить столбцы в том же коллекции трубок.
  8. Добавьте 500 мкл буфера 2 мыть в каждой колонке и центрифуги на 15000 x g для 30 s. удалить супернатант. Повторите этот шаг 2 x.
  9. Столбцы для новой коллекции трубы 2 мл и центрифуги на 15000 x g на 2 мин убедитесь, что столбцы на основе силики получить абсолютно сухой, и существует не этанола слева от мытья буфера 2 передачи.
  10. Сбросить 2 мл пробирок и место столбцы в новых, стерильные, помечены, 1.5 мл пробирок восстановления.
  11. Мкл подогретую (42 ° С) 30 РНКазы свободной воды в центре каждого столбца и центрифуги на 15000 x g за 1 мин.
  12. Восстановить eluted РНК и количественной оценки образцов, используя спектрофотометр на 260 Нм длины волны.
    Примечание: В идеале определить чистоту РНК, вычисляя соотношение между значения поглощения на 260 Нм и 280 Нм. Очищенный РНК 260/280 соотношение идеально между 1.8-2.0.

3. Количественная реального времени полимеразная цепная реакция

Примечание: Количественные реального времени полимеразной цепной реакции (qRT ПЦР) может осуществляться с помощью любой SYBR Зеленый микс, который обычно состоит из SYBR зеленый я покрасить, полимеразы дна Taq, deoxynucleotide трифосфаты (дНТФ) и пассивной красителя. Любые ПЦР машины способны обнаружения SYBR зеленый может использоваться для выполнения реакции и получения данных. Для этого эксперимента, Комплект ПЦР-одноэтапный была использована, которая была коктейль зеленый SYBR I, ROX краситель, Taq ДНК полимеразы, дНТФ и дополнительные смесь обратной транскриптазы (см. Таблицу материалов). Праймеры направленных против регионе конверт и используется в данном исследовании для количественного определения геномной уровней ZIKV CCGCTGCCCAACACAAG для ZIKV-qF и CCACTAACGTTCTTTTGCAGACAT для ZIKV-qR. Как элемент управления человека β-2-микроглобулина (B2M) измеряется и используется для нормализации выражение ZIKV (уборка гена). CTCCGTGGCCTTAGCTGTG для B2M-qF и TTTGGAGTACGCTGGATAGCCT для B2M-qR последовательностей праймера для количественного определения экспрессии генов B2M, используемое в настоящем исследовании. Обеспечить, чтобы положить три технических репликация для каждого образца для ZIKV и B2M генов. Настройка RT-PCR кратко описывается ниже.

  1. RT-PCR установки
    1. Использование 100 нг РНК на сэмпл.
    2. 1 мкл от 10 мкм запасов праймеров прямого и обратного определенного гена для каждой реакции.
    3. 0,25 мкл обратной транскриптазы смеси на сэмпл.
    4. Для каждой индивидуальной реакции мкл 12,5 SYBR Зеленый микс.
    5. До 25 мкл воды. Сделайте мастер смешать все вышеупомянутые реагентов, за исключением РНК, аликвота в пластину 96-луночных PCR, и добавить РНК последний.
    6. Уплотнение пластину с прозрачной липкой лентой.
    7. Центрифуга пластину на 1000 x g 1 мин смешивать реагенты.
    8. Установите пластину в машину ПЦР.
  2. RT-PCR профиль
    Примечание: Используйте профиль RT-PCR, показано в таблице 1 .
    1. Проинкубируйте образцы при 50 ° C за 10 мин для того, чтобы обеспечить синтез комплементарной ДНК — (cDNA кДНК).
    2. После синтеза cDNA активируйте полимеразы дна Taq на 95 ° C за 5 мин.
    3. Выполните 40 циклов денатурации на 95 ° C 10 s и отжига праймера и расширение при 60 ° C за 30 s.
    4. Положите шаг кривой дополнительная расплава (65° C) в конце.
  3. Анализ данных
    1. Следить за кривой расплава, щелкнув вкладку кривой расплава в программе, используемой для запуска машины ПЦР, который, в идеале, показывает один пик во всех образцах для определенного гена подтвердить наличие только одного ампликон и усиление значения более чем 1.6 Если algori THM считает 2 100% усиления значения (значение усиления варьируется в зависимости от алгоритма, используемого в машину ПЦР). Убедитесь, что для использования с шагом 0.5 ° C температуры между шаги и минимальная выдержка из 10 s в протоколе кривой расплава, для достижения оптимальных результатов.
    2. Убедившись, что есть один ампликон и хорошее усиление значения, сначала нажмите на вкладке данные количественной оценки, чтобы получить количественные цикла (Ct/Cq значение) каждого образца и экспортировать в Microsoft Excel.
    3. Используя таблицу, вычислить среднее значение каждого образца, используя значение Ct. Далее нажмите в формулах и выберите пункт среднее. Средние значения CT каждого образца (репликации) используются для дальнейшего анализа.
    4. Далее, вычислить ΔCt, используя формулу ΔCt = средняя Ct целевого гена - средний Ct гена управления (в данном случае, ΔCt = средняя Ct ZIKV гена - средний Ct B2M гена).
    5. Рассчитать ΔΔCt для нормализации данных (в данном случае, ΔΔCt = ΔCt ZIKV образцы - B2M образцов).
    6. Вычислить раз увеличение экспрессии генов, введя формулу 2^-(ΔΔCt) для каждого единого ΔΔCt нормализовать значения. Результаты увеличения раза для выполнения статистических тестов могут быть получены, как описано в предыдущих исследованиях9,10.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

На рисунке 1является пошаговое схематичных иллюстрацией всех шагов для выполнения протокола Аде. Это схема показаны всю процедуру Аде ZIKV из-за существующих иммунитет к DENV. Рисунок 2 показывает как человеческой сыворотки, образцы были разделены на три различные группы: DENV инфекция подтверждена образцы называются DENV-инфицированных группы, DENV антитела подтвердил образцы называют DENV-подвергаются группы и здоровой sera физических лиц без DENV-нейтрализующих антител или РНК называются группой здоровых контроля (HC). (Рисунок 2).

Все образцы сыворотки было позволено сделать комплексы с ZIKV и затем были использованы для заразить клетки макрофагального. После 48 ч postinfection РНК было извлечено и подвергается qRT-PCR. Представитель эксперимент на рисунке 3 показано, что большинство сера, содержащие DENV серотип 1 до 4 антитела смогли активизировать ZIKV репликации на различных уровнях. Наибольший рост в титры ZIKV был найден в макрофагах, получавших сывороток, содержащих DENV антитела серотипа 2 и 4 по сравнению с серотип 1 и 3, которые показали относительно менее индукции ZIKV.

Figure 1
Рисунок 1 : Схематичных Иллюстрация протокола Аде. Пошаговые иллюстрации показывает все шаги в целом протокол. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 : Схема экспериментальной процедуры. Три типа sera были инкубировали с вирусом Зика. Группа, которую я состоял из DENV-РНК положительных образцов (DENV-инфицированных). II группа состояла из DENV-антитела положительных образцов (DENV-контакт). Группа III состояла из образцов без DENV РНК или антитела (здоровые элементы управления). Вирус сера смесь был добавлен в человека макрофагов и количественно инфекции. Этот рисунок был изменен с Лондоно-Рентерия et al.8. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3 : DENV иммунной сыворотки увеличивает ZIKV инфекции в первичных человеческих макрофагов. Человека сывороток, содержащих DENV антител (DENV1-4 серотип подтвердил, Col серотип неизвестно) или от здоровых элементов были разбавленных 1:10 до границы и инкубировали с ZIKV. Sera, описаны в таблице 1. Первичный изолированных макрофаги человека были инфицированы с ZIKV в одиночку или с ZIKV-сера смеси. () DENV1 антитела содержащих сыворотки. (b) DENV2 антитела содержащих сыворотки. (c) DENV3 антитела содержащих сыворотки. (d) DENV4 антитела содержащих сыворотки. (e) DENV-антитела сыворотки от колумбийского отдельных 1. (f) DENV-антитела сыворотки от колумбийского индивидуальных 2. Инфекция измерялась qRT ПЦР-анализа на 48 ч postinfection. Технические и биологические реплицирует были сделаны в трех экземплярах. Данные объединяются, и погрешностей указать стандартное отклонение. Студента t-тест и ANOVA были использованы для статистического анализа. P < 0,001. Этот рисунок был изменен с Лондоно-Рентерия et al.8. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Table 1
Таблица 1: Тепловой профиль qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Перекрестной реактивности DENV антител, ведущих к Аде другие серотипы DENV препятствовало разработке эффективной вакцины против11. ZIKV принадлежит к той же семье, Флавивирусы и имеет значительную гомологию с другими flaviviruses, особенно DENV12. Основной целью нейтрализующих антител для ZIKV и DENV является белок конверт, который разделяет очень высокой структурной и четвертичные последовательности гомологии между двух вирусов13,14,15. Было продемонстрировано, что предварительно иммунитет к DENV или ZIKV может повысить инфекции другой вирус8,16.

Есть целый ряд различных методов, используемых для количественного определения вирусных инфективности в Аде экспериментов, начиная от налета анализов17, внутриклеточный вирусного антигена окрашивание с помощью антител проспряганное с флуоресцентными красителями и проточной цитометрии18 ,19. Эти анализы являются трудоемким и не легко адаптируется для высокопроизводительного нескольких образцов в то же время. Важно отметить, что большинство исследований используется DENV-специфических моноклональных антител для проверки их влияния на ZIKV и изучил Аде в ячейке строки только20,21. В этом протоколе мы опишем простой, но эффективный метод, в котором мы использовали образцы предварительно иммунной сыворотки крови человека, которые способны нейтрализовать против DENV, наряду с первичной человека иммунные клетки, чтобы изучить эффект сыворотки больного на ZIKV репликации, используя qRT-PCR. Этот метод является надежной, соответствующей и может быть завершена в течение трех дней. Хотя представитель результаты в этой рукописи показывают его применение для ZIKV, этот протокол может быть легко и используется для других flaviviruses, как вирус желтой лихорадки, денге вируса и вирус Западного Нила. Одним из важных факторов для рассмотрения, что этот протокол имеет ограничение в разграничении между Зрелые и незрелые вирусной РНК.

Во время протокол, важно тщательно рассмотреть при выполнении извлечения РНК, обеспечения свободной РНКазы окружающей среды во всех РНК, обработка шагов. Кроме того вирусные акции следует разморозить при 37 ° C в ванну воды для 1-2 мин и немедленно ставятся на льду. Однако вирус не должны храниться на льду, на долго, как, затем, он может потерять его инфективности.

Предыдущие результаты показали, что этот протокол является очень удобным и адаптированы к обрабатывать большое количество образцов и может быть завершена в сравнительно меньше времени, чем другие методы. Этот протокол имеет потенциал, чтобы использоваться в качестве полезных пробирного для будущих исследований Аде.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего объявить.

Acknowledgments

Эта работа была щедро поддержали 1R21AI129881-01 (до T.M.C.), начальное финансирование от национальных возникающих инфекционных заболеваний лабораторий и школы медицины Университета Бостона.

Materials

Name Company Catalog Number Comments
Fetal Bovine Serum  GEMINI 100-106
iCycler  BioRad 785BR02188 Model No. CFX96 Optics Module
Microfuge 18 Centrifuge Beckman Coulter  367160
Nanodrop-1000 Thermoscientific  1072
Quantifast SYBR-One step RT-PCR kit  Qiagen  204154 Used for 1 step RT-qPCR
RNeasy RNA Isolation Kit  Qiagen  74106 Used for RNA extraction
RPMI-medium  Gibco 11875093

DOWNLOAD MATERIALS LIST

References

  1. Hayes, E. B. Zika virus outside Africa. Emerging Infectious Diseases. 15, 1347-1350 (2009).
  2. Grard, G., et al. Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus. PLoS Neglected Tropical Diseases. 8, (2), 2681 (2014).
  3. Fauci, A. S., Morens, D. M. Zika Virus in the Americas--Yet Another Arbovirus Threat. New England Journal of Medicine. 374, (7), 601-604 (2016).
  4. Hawkes, R. A. Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls. Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).
  5. Musso, D., Gubler, D. J. Zika Virus. Clinical Microbiology Reviews. 29, (3), 487-524 (2016).
  6. Vaughn, D. W., et al. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. The Journal of Infectious Diseases. 181, (1), 2-9 (2000).
  7. Khandia, R., et al. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection. Frontiers of Immunology. 9, 597 (2018).
  8. Londono-Renteria, B., et al. A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement. Journal of General Virology. 98, (7), 1702-1712 (2017).
  9. Ganger, M. T., Dietz, G. D., Ewing, S. J. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments. BMC Bioinformatics. 18, (1), 534 (2017).
  10. Renn, L. A., et al. High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes. Journal of Visualized Experiments. (97), e52650 (2015).
  11. McArthur, M. A., et al. Dengue vaccines: recent developments, ongoing challenges and current candidates. Expert Review of Vaccines. 12, (8), 933-953 (2013).
  12. Priyamvada, L., et al. Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology. Emerging Microbes and Infections. 6, (5), 33 (2017).
  13. Dai, L., et al. Molecular basis of antibody-mediated neutralization and protection against flavivirus. IUBMB Life. 68, (10), 783-791 (2016).
  14. Dai, L., et al. Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody. Cell Host & Microbe. 19, (5), 696-704 (2016).
  15. Sirohi, D., et al. The 3.8 A resolution cryo-EM structure of Zika virus. Science. 352, (6284), 467-470 (2016).
  16. George, J., et al. Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques. Scientific Reports. 7, (1), 10498 (2017).
  17. Morens, D. M., Halstead, S. B. Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies. Journal of General Virology. 71, Pt 12 2909-2914 (1990).
  18. Dejnirattisai, W., et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science. 328, (5979), 745-748 (2010).
  19. Priyamvada, L., et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7852-7857 (2016).
  20. Charles, A. S., Christofferson, R. C. Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro. PLoS Currents. 8, (2016).
  21. Swanstrom, J. A., et al. Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus. MBio. 7, (4), (2016).
Количественное определение антител зависимых повышение Зика вируса в первичных клеток человека
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).More

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter