Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Cuantificación de estimulación dependiente de los anticuerpos del Virus Zika en células humanas primarias

doi: 10.3791/58691 Published: January 18, 2019

Summary

Se describe un método para evaluar el efecto de la inmunidad preexistente contra el virus del dengue en la infección del virus Zika mediante el uso de suero humano, las células humanas primarias y cuantificación de la infección por reacción en cadena cuantitativa de la polimerasa en tiempo real.

Abstract

La reciente aparición del flavivirus Zika y complicaciones neurológicas, tales como síndrome de Guillain-Barré y microcefalia en los bebés, ha llevado a preocupaciones graves de seguridad pública. Entre los factores de riesgo, estimulación dependiente de anticuerpos (ADE) representa la amenaza más significativa, como el reciente resurgimiento del virus Zika (ZIKV) es principalmente en las zonas donde la población ha estado expuesta y está en un estado de inmunidad previa a otros estrechamente relacionados flaviviruses, especialmente el virus del dengue (DENV). Aquí, describimos un protocolo para cuantificar el efecto de los anticuerpos del suero humano contra DENV en infección por ZIKV en las células humanas primarias o líneas celulares.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Entre las enfermedades virales transmitidas por mosquitos, la infección Zika es uno de los más clínicamente importantes1. La infección es causada por un flavivirus ZIKV que, en la mayoría de los casos, Aedes aegypti el vector primario1,2. Sin embargo, hay estudios que han reportado Aedes albopictus como vector primario en algunos brotes ZIKV3. Aunque la infección es asintomática en muchos casos, los síntomas más comunes son fiebre, dolor de cabeza y musculares dolor2. No existe ninguna cura o una vacuna para la infección por ZIKV y el tratamiento disponible es principalmente de apoyo. Los brotes recientes de ZIKV en América del sur llevaron a casos severos de la enfermedad y un aumento de aproximadamente 20-fold en el trastorno del desarrollo neurológico en fetos llamado microcefalia2. Como América del sur es una zona endémica de varios arbovirus como virus DENV y del oeste del Nilo, es crucial investigar si inmunidad previa a otros flavivirus(es) desempeña un papel en la severidad de las infecciones ZIKV y enfermedad.

A lo largo de la edad, los virus han evolucionado diferentes estrategias para aumentar sus probabilidades de infectividad para apoderarse de la maquinaria de la célula huésped y suprimir la respuesta antiviral. Uno de los más fascinantes de todos es el uso de anticuerpos previamente inmune anfitrión por los virus para mejorar su replicación con el fenómeno ADE4. ADE a través de los cuatro serotipos de DENV ha sido bien estudiado y demostrado aumentar títulos virales y enfermedad resultado5,6,7. En un estudio in vitro, hemos demostrado realce significativo de replicación ZIKV debido a pre-existir inmunidad DENV en células inmunes humanas primaria8. También hemos demostrado un método in vitro pertinente para cuantificar la capacidad de mejorar la replicación ZIKV en células primarias de anticuerpos preexistente contra DENV.

El protocolo que hemos desarrollado utiliza muestras de suero humano que se prueban para la neutralización de DENV TCID 50 o análisis de la prueba de neutralización de la reducción de placa (PRNT), junto con ZIKV en células biológicamente relevantes o células derivadas de tejidos que pueden infectar ZIKV.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Las muestras de suero utilizadas en este estudio se obtuvieron de los humanos participantes de una cohorte de Columbia. Recogida de la muestra fue aprobada por la Junta de revisión interna (IRB) en Universidad de Pamplona (Colombia, América del Sur) y Los Potios Hospital8. Las muestras se anónimamente y los investigadores no tenían acceso a información para el paciente. Se revisaron las muestras de suero para el serotipo DENV. Las muestras más fueron confirmadas para neutralizar la infección por DENV in vitro. Para el control, se utilizaron muestras de suero de individuos sanos (HC) de los Estados Unidos.

Nota: Este protocolo se puede utilizar para examinar la replicación de ADE de ZIKV en cualquier tipo de célula humana expresando los receptores de Fcγ. El protocolo consta de tres partes (figura 1).

1. siembra de la célula y configuración de infección

Nota: Para este estudio en particular, los macrófagos primarios humanos o línea de celular U937 mielomonocítica (ATCC-CRL-1593.2) fueron utilizados. Las células fueron mantenidas en Medio RPMI suplementado con 10% suero bovino fetal (FBS) en una incubadora de 37 ° C con 5% dióxido de carbono (CO2). Todos los pasos se llevaron a cabo en una bioseguridad nivel 2 (BSL-2) gabinete de seguridad de la biotecnología en condiciones estériles.

  1. Semilla 3 x 104 células por pozo en una placa de 96 pocillos de fondo plano estéril junto con 100 μl de medio y colocarlos en la incubadora de 37 ° C con 5% CO2.
  2. Después de la siembra de las células, descongelar las muestras de suero a temperatura ambiente y hacer diluciones seriadas 10 veces (es decir, 1/10, 1/100, 1/1.000, 1/10.000) mediante la mezcla de las muestras en medio libre de suero. Alícuota las diluciones en una placa de 96 pocillos estéril. Usar el virus sin suero como un control adicional.
  3. Descongelar el stock ZIKV a 37 ° C en un baño de agua durante 1-2 min y transferir rápidamente a hielo para uso futuro.
  4. Añadir una multiplicidad 0.1 de una cantidad equivalente de tensión ZIKV MR766 infección (MOI) de las alícuotas de suero.
    Nota: Asegúrese de que el factor de dilución se mantiene constante y el volumen total es de ~ 200 μL; eso es suficiente por triplicado de cada tratamiento. Mantener tres pozos no infectados para utilizar como control negativo para análisis posteriores.
  5. Incubar las diluciones del suero con el virus añadido en la incubadora de 37 ° C con 5% CO2 durante 1 hora para permitir que los anticuerpos DENV para formar complejos con los viriones Zika (para mayor comodidad, en lo sucesivo como "complejos inmunes").
  6. Aspire los medios de comunicación de las células que fueron sembradas en la placa de 96 pozos de fondo plano. Lavar las células con estéril de 1 x solución salina tamponada con fosfato (PBS de x 1).
  7. Añadir 50 μl de los complejos inmunes a cada pocillo e incubar en la incubadora de 37 ° C con 5% CO2 h 2.
  8. Después de 2 h de incubación, aspirar los medios que contienen complejos inmunes de las células, utilizando un multicanal pipeta y lavar las células 2 x con 1 x PBS para eliminar los complejos inmunes y cualquier virions sueltos.
  9. Añada 100 μl de frescos medios completo suplementados con 10% FBS a cada bien e incubar las células en la incubadora de 37 ° C con 5% CO2 durante 48 h.

2. extracción de RNA

  1. Retire la placa de 96 pocillos de la incubadora y traslado al gabinete de seguridad de la biotecnología.
  2. Aspirar los medios de comunicación, lavar las células 2 x con PBS 1 x y procede a la extracción de RNA.
    Nota: RNA se puede extraer por cualquier método de elección (consulte la Tabla de materiales).
  3. Añadir 250 μl de tampón de lisis celular con 10% β-mercaptoetanol por pozo. Pipeta el búfer y bajar al menos 5 x junto a rayar las células con la punta de la pipeta para acelerar el procedimiento de lisis.
  4. Transferencia de los lysates de la célula a los tubos nuevos, etiquetados, estériles de 1.5 mL.
  5. Añadir una cantidad igual de etanol al 70% (250 μL). Pipetear arriba y abajo 4 x - 5 hasta que la mezcla esté clara.
  6. Transferir la mezcla (~ 500 μl) para etiquetado columnas basadas en silicona en tubos de 2 mL y centrifugar a 15.000 x g durante 30 s. descarte el flujo a través y mantienen las columnas en tubos de la misma.
  7. Añadir 700 μl de tampón de lavado 1 a cada columna y centrifugue a 15.000 x g durante 30 s. descarte el flujo a través y mantienen las columnas en tubos de la misma.
  8. Añadir 500 μl de tampón de lavado 2 cada columna y centrifugue a 15.000 x g por 30 s. descarte el sobrenadante. Repetir este paso 2 x.
  9. Transferencia de la izquierda de las columnas a nuevos tubos de recogida de 2 mL y centrifugar a 15.000 x g durante 2 minutos, asegúrese de que columnas de sílice totalmente secos y no hay etanol de tampón de lavado 2.
  10. Deseche los tubos de 2 mL y colocar las columnas de nuevo, estéril, etiquetados, tubos de recuperación de 1,5 mL.
  11. Agregar a precalentado (42 ° C) 30 μl de agua libre de ARNasa en el centro de cada columna y centrifugar a 15.000 x g durante 1 minuto.
  12. Recuperar el ARN eluído y cuantificar las muestras, usando un espectrofotómetro a una longitud de onda de 260 nm.
    Nota: Lo ideal sería determinar la pureza del ARN mediante el cálculo de la relación entre los valores de absorbancia a 260 nm y 280 nm. Proporción de 260/280 de RNA purificado es idealmente entre 1.8-2.0.

3. cuantitativa de polimerasa en tiempo real la reacción en cadena

Nota: Reacción en cadena de la polimerasa en tiempo real cuantitativa (qRT-PCR) puede llevarse a cabo mediante el uso de cualquier mezcla de verde de SYBR, que generalmente se compone de SYBR Green tinte, Taq ADN polimerasa, Deoxinucleótidos trifosfatos (dNTPs) y un tinte pasivo. Cualquier qPCR máquina capaz de la detección de SYBR verde puede utilizarse para realizar la reacción y obtener los datos. Para este experimento, se utilizó un kit de RT-PCR de un paso que tenía un cóctel de SYBR Green I, ROX tinte, Taq DNA polimerasa, dNTPs y una mezcla adicional de la transcriptasa inversa (véase Tabla de materiales). Los cebadores diseñados contra la región envolvente y utilizados en este estudio para cuantificar niveles genómicos ZIKV son CCGCTGCCCAACACAAG por ZIKV qF y CCACTAACGTTCTTTTGCAGACAT por ZIKV-qR. Como control, humana β-2-microglobulina (B2M) se midió y se utiliza para normalizar la expresión de ZIKV (gen housekeeping). Las secuencias de la cartilla para cuantificar la expresión génica de B2M utilizada en este estudio son CTCCGTGGCCTTAGCTGTG para B2M-qF y TTTGGAGTACGCTGGATAGCCT para B2M-qR. Asegúrese de poner tres repeticiones técnicas para cada muestra el ZIKV y los genes de B2M. La configuración de la RT-PCR se describe brevemente a continuación.

  1. Configuración de RT-PCR
    1. Uso 100 ng de ARN por muestra.
    2. Añadir 1 μl de 10 poblaciones de μm de iniciadores de avance y retroceso de un gen en particular para cada reacción.
    3. Añadir 0,25 μl de mezcla de la transcriptasa reversa por muestra.
    4. Para cada reacción individual, añadir 12,5 μl de mezcla de SYBR Green.
    5. Añadir 25 μl de agua. Hacer un master mix de todos los reactivos antes mencionados excepto RNA, alícuota en la placa PCR de 96 pocillos y añadir RNA última.
    6. Selle la placa con cinta adhesiva transparente.
    7. Centrifugar la placa a 1.000 x g durante 1 minuto mezclar los reactivos.
    8. Poner la placa en la máquina de la qPCR.
  2. Perfil de RT-PCR
    Nota: Utilizar el perfil de RT-PCR que se muestra en la tabla 1.
    1. Incubar las muestras a 50 ° C durante 10 minutos para asegurar la síntesis de ADN complementario (cDNA).
    2. Después de la síntesis de cDNA, activar la Taq ADN polimerasa a 95 ° C durante 5 minutos.
    3. Realizar 40 ciclos de desnaturalización a 95 ° C 10 s primer recocido y extensión a 60 ° C para 30 s.
    4. Poner el paso de la curva de fusión adicional (65° C) en el final.
  3. Análisis de datos
    1. Seguimiento de la curva de fusión haciendo clic en la ficha de curva de fusión en el programa utilizado para hacer funcionar la máquina de la qPCR, que, idealmente, muestra un solo pico en todas las muestras para un gen determinado confirmar la presencia de sola amplicones y un valor de amplificación if más de 1.6 el algori THM considera 2 como el valor de amplificación de 100% (el valor de amplificación varía según el algoritmo utilizado por la máquina de qPCR). Asegúrese de utilizar incrementos de 0.5 ° C temperatura entre pasos y un mínimo de tiempo de 10 s en el protocolo de curva de fusión, para obtener resultados óptimos.
    2. Después de asegurarse de que hay un solo amplicon y amplificación buen valor, primero haga clic en la ficha de datos de cuantificación para obtener un ciclo cuantitativo (valor de Ct/Cq) de cada muestra y exportar a Microsoft Excel.
    3. Una hoja de cálculo, calcular la media de cada muestra utilizando el valor de Ct. A continuación, haga clic en las fórmulas y seleccione la media. Los valores promedio de CT de cada muestra (repetición) se utilizan para su posterior análisis.
    4. A continuación, calcular la ΔCt utilizando la fórmula ΔCt = promedio de Ct del gen Diana - promedio de Ct del gen de control (en este caso, ΔCt = promedio de Ct del gen ZIKV - promedio de Ct del gen de B2M).
    5. Calcular ΔΔCt para normalizar los datos (en este caso, ΔΔCt = ΔCt muestras ZIKV - B2M muestras).
    6. Calcular que el pliegue aumenta la expresión génica escribiendo la fórmula 2^-(ΔΔCt) para cada valor único ΔΔCt normalizado. Los resultados del aumento de doblar para llevar a cabo pruebas estadísticas pueden obtenerse como se indica en anteriores estudios9,10.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En la figura 1, hay una ilustración diagramática paso a paso de todos los pasos necesarios para llevar a cabo el protocolo de ADE. Es un diagrama esquemático mostrando el procedimiento entero de ADE de ZIKV debido a inmunidad preexistente a DENV. La figura 2 muestra cómo humano suero muestras se categorizaron en tres grupos diferentes: muestras de la infección confirmada de DENV se refieren como el grupo de infectados con DENV, DENV anticuerpo-confirmó que las muestras son conocido como el grupo de expuestos por DENV y saludable sueros de individuos sin anticuerpos neutralizantes DENV o RNA se llaman el grupo de control sano (HC). (Figura 2).

Todas las muestras de suero fueron permitidas para hacer complejos con ZIKV y fueron utilizadas para infectar las células macrófagos. Después postinfection de 48 h, RNA fue extraído y sometido a qRT-PCR. El experimento representativo en la figura 3 se muestra que la mayoría de los sueros que contienen anticuerpos DENV serotipo 1 a 4 fueron capaces de mejorar la replicación ZIKV a diferentes niveles. El mayor incremento en los títulos ZIKV fue encontrado en los macrófagos tratados con sueros que contengan anticuerpos DENV serotipo 2 y 4 en comparación con el serotipo 1 y 3, que mostraron una relativamente menor inducción de ZIKV.

Figure 1
Figura 1 : Ilustración esquemática del protocolo ADE. Una ilustración paso a paso muestra todos los pasos involucrados en el protocolo de todo. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 : Esquema del procedimiento experimental de. Tres tipos de sueros se incubaron con el virus Zika. Grupo I consistió en muestras (infectados con DENV) positivas de DENV-RNA. Grupo II consistió en muestras (DENV-expuestas) positivas de DENV-anticuerpo. Grupo III consistió en muestras sin DENV ARN o anticuerpo (controles sanos). La mezcla de virus sera añadida macrófagos humanos y la infección cuantificado. Esta figura ha sido modificada desde Londoño Renteria et al8. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 : Sueros inmunes DENV mejora la infección ZIKV en macrófagos humanos primarios. Suero humano que contiene anticuerpos contra DENV (DENV1-4 serotipo confirmado, Col son serotipo desconocido) o de controles sanos fueron diluidas 1:10 a 1: 10,000 y se incubaron con ZIKV. Los sueros se describen en la tabla 1. Macrófagos humanos aislados primarios fueron infectados con ZIKV solos o con las mezclas de sueros ZIKV. (un) DENV1 sueros que contienen anticuerpos. (b) DENV2 sueros que contienen anticuerpos. (c) DENV3 sueros que contienen anticuerpos. (d) DENV4 sueros que contienen anticuerpos. (e) DENV-anticuerpo sera de Colombia 1 individuales. (f) DENV-anticuerpo sera de Colombia 2 individuales. La infección se midió mediante análisis de qRT-PCR en el postinfection de 48 h. Repeticiones técnicas y biológicas se realizaron por triplicado. Los datos se agruparon, y las barras de error indican la desviación estándar. De Student t-test y ANOVA fueron utilizados para el análisis estadístico. P < 0.001. Esta figura ha sido modificada desde Londoño Renteria et al8. Haga clic aquí para ver una versión más grande de esta figura.

Table 1
Tabla 1: Perfil térmico de qRT-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Reactividad cruzada de anticuerpos contra DENV hacia ADE de otros serotipos DENV ha obstaculizado el desarrollo de una vacuna eficaz11. ZIKV pertenece a la misma familia, Flaviviridae y tiene una considerable homología con otros flaviviruses, especialmente DENV12. El objetivo principal de anticuerpos neutralizantes por ZIKV y DENV es la proteína, que comparte una homología de secuencia estructural y cuaternario muy alto entre los dos virus13,14,15. Se ha demostrado que la inmunidad a DENV o ZIKV puede mejorar la infección de otros virus8,16.

Hay un número de diferentes métodos empleados para cuantificar la infectividad viral en experimentos de ADE, que van desde ensayos de placa17, antígeno viral intracelular tinción con anticuerpos conjugados con tintes fluorescentes y citometría de flujo18 ,19. Estos ensayos son lentos y no fácilmente adaptable para el alto rendimiento de múltiples muestras al mismo tiempo. Importante, la mayoría de los estudios utiliza anticuerpos monoclonales específicos de DENV para comprobar su efecto sobre ZIKV y examinó a la ADE en la célula líneas solamente20,21. En este protocolo, se describe un método sencillo y eficaz en el que se utilizaron muestras de suero previamente inmunes que tienen una capacidad de neutralización contra DENV, junto con las células inmunes humanas primarias, examinar el efecto del suero del paciente en la replicación ZIKV empleando qRT-PCR. Este método es robusto, relevante y puede completarse en tres días. Aunque los resultados representativos en este manuscrito muestran su aplicación por ZIKV, este protocolo puede ser fácilmente modificado y utilizado para otros flaviviruses, como virus de la fiebre amarilla, virus del dengue y virus del Nilo Occidental. Un factor importante a considerar es que este protocolo tiene una limitación en la distinción entre el RNA viral madura e inmadura.

Durante el protocolo, es esencial dar una cuidadosa consideración al realizar las extracciones de RNA, asegurándose de que el ambiente esté libre de Rnasa durante todo el RNA manejo pasos. Además, las poblaciones virales deben descongelarse a 37 ° C en un baño de agua durante 1-2 min y poner inmediatamente en hielo. Sin embargo, el virus no mantener en hielo para siempre y cuando, entonces, puede perder su infectividad.

Los resultados anteriores han demostrado que este protocolo es muy conveniente y adaptable para manejar un gran número de muestras y puede ser completado en un tiempo relativamente menor que otros métodos. Este protocolo tiene el potencial para ser utilizado como un ensayo útil para futuros estudios de ADE.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que declarar.

Acknowledgments

Este trabajo fue apoyado generosamente por 1R21AI129881-01 (a Interpetative), fondos de puesta en marcha de los laboratorios nacionales de emergentes infecciosas enfermedades y la escuela de medicina de la Universidad de Boston.

Materials

Name Company Catalog Number Comments
Fetal Bovine Serum  GEMINI 100-106
iCycler  BioRad 785BR02188 Model No. CFX96 Optics Module
Microfuge 18 Centrifuge Beckman Coulter  367160
Nanodrop-1000 Thermoscientific  1072
Quantifast SYBR-One step RT-PCR kit  Qiagen  204154 Used for 1 step RT-qPCR
RNeasy RNA Isolation Kit  Qiagen  74106 Used for RNA extraction
RPMI-medium  Gibco 11875093

DOWNLOAD MATERIALS LIST

References

  1. Hayes, E. B. Zika virus outside Africa. Emerging Infectious Diseases. 15, 1347-1350 (2009).
  2. Grard, G., et al. Zika virus in Gabon (Central Africa) - 2007: a new threat from Aedes albopictus. PLoS Neglected Tropical Diseases. 8, (2), 2681 (2014).
  3. Fauci, A. S., Morens, D. M. Zika Virus in the Americas--Yet Another Arbovirus Threat. New England Journal of Medicine. 374, (7), 601-604 (2016).
  4. Hawkes, R. A. Enhancement of the Infectivity of Arboviruses by Specific Antisera Produced in Domestic Fowls. Australian Journal of Experimental Biology and Medical Science. 42, 465-482 (1964).
  5. Musso, D., Gubler, D. J. Zika Virus. Clinical Microbiology Reviews. 29, (3), 487-524 (2016).
  6. Vaughn, D. W., et al. Dengue viremia titer, antibody response pattern, and virus serotype correlate with disease severity. The Journal of Infectious Diseases. 181, (1), 2-9 (2000).
  7. Khandia, R., et al. Modulation of Dengue/Zika Virus Pathogenicity by Antibody-Dependent Enhancement and Strategies to Protect Against Enhancement in Zika Virus Infection. Frontiers of Immunology. 9, 597 (2018).
  8. Londono-Renteria, B., et al. A relevant in vitro human model for the study of Zika virus antibody-dependent enhancement. Journal of General Virology. 98, (7), 1702-1712 (2017).
  9. Ganger, M. T., Dietz, G. D., Ewing, S. J. A common base method for analysis of qPCR data and the application of simple blocking in qPCR experiments. BMC Bioinformatics. 18, (1), 534 (2017).
  10. Renn, L. A., et al. High-throughput quantitative real-time RT-PCR assay for determining expression profiles of types I and III interferon subtypes. Journal of Visualized Experiments. (97), e52650 (2015).
  11. McArthur, M. A., et al. Dengue vaccines: recent developments, ongoing challenges and current candidates. Expert Review of Vaccines. 12, (8), 933-953 (2013).
  12. Priyamvada, L., et al. Humoral cross-reactivity between Zika and dengue viruses: implications for protection and pathology. Emerging Microbes and Infections. 6, (5), 33 (2017).
  13. Dai, L., et al. Molecular basis of antibody-mediated neutralization and protection against flavivirus. IUBMB Life. 68, (10), 783-791 (2016).
  14. Dai, L., et al. Structures of the Zika Virus Envelope Protein and Its Complex with a Flavivirus Broadly Protective Antibody. Cell Host & Microbe. 19, (5), 696-704 (2016).
  15. Sirohi, D., et al. The 3.8 A resolution cryo-EM structure of Zika virus. Science. 352, (6284), 467-470 (2016).
  16. George, J., et al. Prior Exposure to Zika Virus Significantly Enhances Peak Dengue-2 Viremia in Rhesus Macaques. Scientific Reports. 7, (1), 10498 (2017).
  17. Morens, D. M., Halstead, S. B. Measurement of antibody-dependent infection enhancement of four dengue virus serotypes by monoclonal and polyclonal antibodies. Journal of General Virology. 71, Pt 12 2909-2914 (1990).
  18. Dejnirattisai, W., et al. Cross-reacting antibodies enhance dengue virus infection in humans. Science. 328, (5979), 745-748 (2010).
  19. Priyamvada, L., et al. Human antibody responses after dengue virus infection are highly cross-reactive to Zika virus. Proceedings of the National Academy of Sciences of the United States of America. 113, (28), 7852-7857 (2016).
  20. Charles, A. S., Christofferson, R. C. Utility of a Dengue-Derived Monoclonal Antibody to Enhance Zika Infection In Vitro. PLoS Currents. 8, (2016).
  21. Swanstrom, J. A., et al. Dengue Virus Envelope Dimer Epitope Monoclonal Antibodies Isolated from Dengue Patients Are Protective against Zika Virus. MBio. 7, (4), (2016).
Cuantificación de estimulación dependiente de los anticuerpos del Virus Zika en células humanas primarias
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).More

Asad, S., Feitosa-Suntheimer, F., Gold, A., Londono-Renteria, B., Colpitts, T. M. Quantification of Antibody-dependent Enhancement of the Zika Virus in Primary Human Cells. J. Vis. Exp. (143), e58691, doi:10.3791/58691 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter