Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Bepalende 3'-Termini en sequenties van ontluikende Single-Stranded virale DNA moleculen tijdens HIV-1 Reverse transcriptie in geïnfecteerde cellen

doi: 10.3791/58715 Published: January 30, 2019

Summary

Hier presenteren we een diepe rangschikken benadering waarmee een onbevooroordeelde bepaling van ontluikende 3'-termini en vogelgriepvirus profielen van single-stranded DNA moleculen. De belangrijkste toepassing is de karakterisatie van ontluikende retrovirale complementaire Ani (cDNAs), de tussenproducten die tijdens het proces van retrovirale omgekeerde transcriptie gegenereerd.

Abstract

Controle van nucleïnezuur tussenproducten tijdens virus replicatie biedt inzicht in de effecten en de mechanismen van het optreden van antivirale verbindingen en host cel eiwitten op virale DNA-synthese. We behandelen hier het ontbreken van een cel-gebaseerde high-dekking en hoge-resolutie bepaling dat kan definiëren retrovirale omgekeerde transcriptie tussenproducten in het fysiologische kader van virusbesmetting. De beschreven methode vangt de 3'-termini van ontluikende complementaire DNA (cDNA) moleculen binnen HIV-1 besmette cellen met één nucleotide resolutie. Het protocol gaat oogsten van hele cel DNA, gerichte verrijking van virale DNA via hybride vastleggen, adapter afbinding, grootte fractionering door gel zuivering, PCR versterking, diepe sequencing en data-analyse. Een belangrijke stap is de efficiënte en onpartijdige Afbinding van adapter moleculen te openen van de 3'-DNA termini. Toepassing van de beschreven methode bepaalt de overvloed van omgekeerde afschriften van elke specifieke lengte in een monster. Het biedt ook informatie over de (interne) opeenvolging variatie in omgekeerde afschriften en daarmee een potentiële mutaties. De bepaling is in het algemeen, geschikt voor vragen met betrekking tot DNA 3'-uitbreiding, op voorwaarde dat de volgorde van de sjabloon heet.

Introduction

Om te ontleden en begrijpen van de virale replicatie volledig, steeds meer geraffineerde technieken die replicatie vangen zijn tussenproducten vereist. In het bijzonder de precieze definitie van virale nucleïnezuur soorten in het kader van geïnfecteerde cellen kan bieden nieuwe inzichten, aangezien veel virale replicatie mechanismen hebben tot nu toe is onderzocht in geïsoleerde in vitro reacties. Een goed voorbeeld is het proces van omgekeerde transcriptie in retrovirussen, zoals humaan immunodeficiëntie virus (HIV-1) 1. De verschillende stappen van HIV-1 omgekeerde transcriptie, waarin het virale enzym reverse transcriptase (RT) het single-stranded RNA genoom naar double-stranded DNA kopieert, voornamelijk in de primer extensie testen met gezuiverde eiwitten bestudeerde en stikstofbase geweest zuren1,2,3,4,5. Terwijl fundamentele beginselen zijn vastgesteld, wordt deze gehaltebepalingen alle virale en cellulaire componenten niet te nemen en kunnen niet overeen met biologisch relevante stoichiometries van betrokken factoren. Dus, we ontwierpen een krachtige techniek om te bepalen van de spectra van omgekeerde transcriptie tussenproducten met hun precieze cDNA 3'-termini (dat wil zeggen, bepalen hun exacte lengtes) en nucleotidesequenties in het kader van infecties van het leven cellen6. Verzameling van gegevens van tijd cursus experimenten kunnen worden gebruikt om het vergelijken van het profiel van afschriften onder verschillende omstandigheden, zoals de aanwezigheid van antivirale moleculen of eiwitten, die invloed op de efficiëntie en processivity van DNA-synthese hebben kunnen en accumulatie. Hierdoor kan een meer gedetailleerd inzicht in de levenscyclus van de natuurlijke ziekteverwekker, die vaak de basis voor gerichte drug design en succesvolle therapeutische interventie is.

HIV-1 omgekeerde transcriptie bestaat uit een reeks van opeenvolgende gebeurtenissen gestart door het gloeien van een tRNA primer aan de genomic RNA-sjabloon, die vervolgens wordt uitgebreid door RT te produceren van een afschrift van de korte single-stranded cDNA genoemd een minteken fronten sterk-stop (-sss) (Zie Figuur 1). Vervolgens - sss cDNA wordt overgebracht van de 5'-lange terminal herhalen (LTR) aan de 3'-LTR van de genomic RNA, waar het anneals en fungeert als de primer voor voortdurende RT rek van de minus gemedieerde strand DNA (Bekijk beoordelingen op omgekeerde transcriptie1 , 2 , 3 , 4). deze eerste strand overdracht is één van de snelheidslimieten stappen van omgekeerde transcriptie; Vandaar, cDNA - sss is bekend om te accumuleren. Het basisontwerp workflow en bibliotheek vast te leggen van de omgekeerde transcriptie-producten in de geïnfecteerde cellen is uiteengezet in Figuur 2a. De specifieke primers en analyse instellingen die worden gebruikt in het protocol en in tabel 1 genoemde doel al vroeg reverse transcriptie cDNA tussenproducten binnen het bereik van de lengte van 23 tot ~ 650 nt, waarin de 180-182 nt - sss DNA. Echter zal passende kleine aanpassingen aan de strategie niet alleen laat omgekeerde transcriptie producten, maar ook andere virussen en systemen, toepassing laten waar het doel is om op te sporen met DNA van 3'-OH eindigt. Belangrijke beperkingen te overwegen omvat het bereik van de lengte van het eindproduct van PCR in de bibliotheek; in het bijzonder zal sjablonen in die de afstand tussen de adapter op de open 3'-terminus en de site van upstream primer meer dan ~ 1000 nt waarschijnlijk worden minder efficiënt sequenced, potentieel invoering van misleidende technische vooroordelen tijdens bibliotheek voorbereiding) Zie de beschrijving voor meer details en aanpassing suggesties).

Eerder hebben gerapporteerde technieken voor de systematische bepaling van 3'-termini van nucleïnezuur strengen gericht op RNA, geen DNA, moleculen. Een voorbeeld is 3' RACE (snelle versterking van cDNA eindigt)7, dat afhankelijk van de polyadenylatie van mRNA is. Daarnaast werden adapter afbinding gebaseerde strategieën met RNA ligases ontwikkeld, die RLM-RACE (RNA ligase-gemedieerde RACE)8 of LACE (afbinding gebaseerde versterking van cDNA eindigt)9hebt opgenomen. Het is belangrijk om te benadrukken dat afbinding gebaseerde amplifications gevoelig voor vooringenomenheid geïntroduceerd door de afbinding reactie zelf zijn. Bijvoorbeeld, wellicht afbinding min of meer efficiënte afhankelijk van een bepaalde nucleotide in de 3'-positie, de volgorde, totale molecuul lengte of plaatselijke structuur. Dergelijke ligase voorkeuren leiden tot onvolledige vangen van moleculen en onjuiste voorstelling van zaken in de uitlezing, die wij en anderen hebben waargenomen9,10. U wilt minimaliseren afbinding vooringenomenheid tijdens de adapter toevoeging stappen in het protocol hierin beschreven, we een aantal afbinding strategieën getest en gevonden van het gebruik van T4 DNA ligase met een haarspeld single-stranded DNA adapter (zoals beschreven door Kwok et al.. 11) als de enige procedure met in de buurt van kwantitatieve afbinding dat niet leiden aanzienlijke verschillen in afbinding efficiëntie tot wanneer beoordeeld met een speciaal geselecteerde besturingselement oligonucleotides6. De keuze van deze strategie Afbinding is daarom een belangrijk element in het succes van dit protocol.

Tot op heden, monitoring van HIV-1 RT progressie in de geïnfecteerde cellen is voornamelijk bereikt door het meten van de producten van de omgekeerde transcriptie van verschillende lengte met kwantitatieve PCR (qPCR) met behulp van primer-sonde sets die uniek korter of langer meten (begin en laat, respectievelijk) cDNA producten12,13,14. Terwijl deze qPCR benadering geschikt is voor het bepalen van de intrinsieke efficiëntie van het proces van omgekeerde transcriptie in cellulaire systemen, is de output van relatief lage resolutie, met geen opeenvolgingsinformatie wordt afgeleid. Onze nieuwe aanpak, gebaseerd op geoptimaliseerde adapter afbinding, PCR-gemedieerde bibliotheek generatie en diepe sequencing adressen de technologische kloof en biedt een kans om te controleren van omgekeerde transcriptie tijdens HIV-1 infectie kwantitatief en één nucleotide resolutie.

We hebben laten zien dat het nut van deze methode in een studie die een onderscheid tussen twee voorgestelde modellen voor de capaciteit van de HIV-1 beperking factor APOBEC3G (apolipoproteïne B mRNA bewerken enzym katalytische polypeptide-achtige 3G gemaakt) te mengen met het productie van virale omgekeerde afschriften6.

Protocol

Opmerking: Raadpleeg de Tabel van de materialen voor specifieke reagentia en apparatuur die in dit protocol wordt gebruikt.

1. virus productie en cel infectie

Let op: De besmettelijke HIV-1 moet alleen op goedgekeurde bioveiligheid insluiting laboratoria worden behandeld.

Opmerking: Productie van HIV-1 deeltjes door voorbijgaande transfectie van menselijke embryonale nier (HEK) 293T cellen, zoals beschreven in stap 1.1, is een standaardprocedure en is eerder beschreven15,16. Eerder beschreven algemene celkweek procedures zijn17.

  1. HIV-1 virus productie.
    1. Handhaven 293T cellen in de Dulbecco bewerkt Eagle medium (DMEM), aangevuld met 10% foetale runderserum (FBS) en 1% penicilline/streptomycine (volledige DMEM) in een standaard cel cultuur incubator bij 37 ° C en 5% CO2 zoals eerder beschreven17.
    2. In een standaard laminaire flow weefselkweek kap Verwijder het medium van de groei en voeg 3 mL trypsine voorverwarmde (37 ° C) aan een in de buurt van-heuvels 10 cm cel cultuur schotel (~1.2 x 107 cellen) van 293T cellen. Zet de schotel terug in de incubator voor 2-3 min.
    3. Rekening de schotel uit de incubator terug de weefselkweek kap en voeg 7 mL van volledige medium. Pipetteer op en neer binnen het Gerecht meerdere malen naar resuspendeer de cellen. Splitsen van de cellen 1:4 door 2,5 mL van de celsuspensie toe te voegen aan een nieuwe 10 cm schotel en vul deze met 7,5 mL volledige voedingsbodem.
    4. De volgende dag, meng 10 µg proviraal HIV-1 plasmide DNA (zoals pNL4.3) met 1 mL serumvrij minimaal essentiële medium en voeg polyethylenimine (PEI) oplossing (25.000 mW, 1 mg/mL pH 7) aan 4.5 µL per 1 µg DNA. Incubeer gedurende 10 min op RT en ontkleuring toe te voegen aan de cellen van de 293T.
    5. 24u na transfectie, het medium verwijderen en te vervangen door 6 mL van volledige DMEM met RNase-vrije DNase op 20 U/mL medium. Na 6 uur, door het medium te vervangen door 10 mL van volledige DMEM.
    6. 48 uur na de transfectie, oogst het supernatant en filtreer het door een 0,22 µm filter, met behulp van een 10 mL spuit, in een polypropyleen tube van 15 mL.
    7. Voeg 2 mL steriele 20 gewichtspercenten sacharose in 1 x fosfaatgebufferde zoutoplossing (PBS) aan een open-top dunwandige ultracentrifuge buis. Langzaam bedekken de sacharose met de gefilterde cel bezinken.
    8. Centrifugeer gedurende 1 h 15 min bij 134.000 x g bij 4 ° C met behulp van een ultracentrifuge.
    9. Verwijder zorgvuldig de buizen van de ultracentrifuge. Langzaam opstijgen naar zowel de bovendrijvende substantie als sacharose met behulp van het een zuiging of een pipet. Gebruik een kleinere pipet en kantelen van de buis bij het nemen van de laatste sacharoseoplossing uit. Laat het Ingehuld virus in de onderkant van de buis.
      Opmerking: De pellet zal niet zichtbaar zijn.
    10. Voeg 200 µL van 1 x PBS, laat in de koelkast voor 4 tot 12 h resuspendeer en bevriezen in 20 µL aliquots bij-80 ° C.
    11. Bepalen p24Gag inhoud gebruikt het een p24 HIV-1 antigeen ELISA kit (volgende fabrikant instructies).
  2. T-cel lijn infectie.
    1. Cultuur een vereeuwigd T-cel-lijn (bv., CEM-SS cellen) in Roswell Park Memorial Instituut (RPMI) 1640 medium aangevuld met 10% FBS en 1% penicilline/streptomycine (volledige RPMI). Met behulp van een hemocytometer18 en zaad 1 goed per monster met 1 mL van de volledige RPMI met 2 x 106 cellen/mL in een 12-well formaat plaat voor de cultuur van de cel cellen te tellen.
    2. Toevoegen van HIV-1 deeltjes gelijk aan 150 ng p24Gag en plaats de plaat in een swingende Centrifugeer emmer met biocontainment deksels te draai-infecteren door centrifugeren in een benchtop centrifuge voor 2 h bij 2.000 x g bij 30 ° C.
    3. Verwijder plaat uit de centrifuge en laat het rusten gedurende 1 uur in een standaard weefselkweek incubator bij 37 ° C en 5% CO2.
    4. Verzamelen om te wassen input virus af, cellen door overdracht van de cel schorsingen microcentrifuge buizen en centrifugeren in een microcentrifuge op RT (RT) bij 500 x g gedurende 2 min. Opstijgen het supernatant zonder verstoring van de cel-pellet.
    5. Resuspendeer de cel pellets in voorverwarmde (37 ° C), 1 mL steriele 1 x PBS. Herhaal het centrifugeren, supernatant verwijdering en resuspensie stappen twee meer tijden.
    6. Centrifugeer nogmaals, verwijder het supernatant en resuspendeer de cel pellets in 1 mL van volledige RPMI. Voeg elke schorsing aan één putje in een nieuwe 12 goed plaat.
    7. Oogsten in 6 uur na eerste toevoeging van virus (4 h na centrifugeren), de cellen op door middel van centrifugeren, zoals gedaan in stap 1.2.4. Verwijderen en verwijder het supernatant. De cel pellets kunnen worden bevroren bij-80 ° C of verwerkt rechtstreeks voor DNA-extractie.

2. DNA-extractie, HIV-1 DNA kwantificering en verrijking door hybride vastleggen

  1. Pak de hele cel DNA met een bloed en weefsel totale DNA extractie kit door het volgen van de handleiding van de kit voor weefselkweek cellen. De enige wijziging is elutie in 200 µL van nuclease-vrije H2O in plaats van de meegeleverde elutie buffer.
    Opmerking: Na toevoeging van de chaotropic lysis-buffermengsel (de kit "AL buffer") en de proteïnase, monsters kunnen worden verwijderd uit het laboratorium van de insluiting bioveiligheid en verwerkt in een laboratorium standaard veiligheid niveau voor de rest van het protocol.
  2. Het bepalen van het exemplaaraantal van HIV-1 cDNA door qPCR.
    1. Neem 17 µL van het eluaat uit stap 2.1 en voeg 2 µL van 10 x restrictie-enzym buffer samen met 1 µL van het restrictie-enzym DpnI. Incubeer gedurende 1 uur bij 37 ° C om alle potentiële residuele input plasmide DNA van transfectie.
    2. Uitvoeren van qPCR voor min fronten sterk-stop cDNA met behulp van de volgende primer sonde set: oHC64 (5 '-taactagggaacccactgc-3) en oHC65 (5 '-gctagagattttccacactg-3) en sonde oHC66 (5 '-FAM-acacaacagacgggcacacacta-TAMRA-3 '). qPCR setup en exacte voorwaarden kunnen worden gevonden in de referenties6,13. Voorhebben over monsters met een seriële verdunning van pNL4.3 proviraal plasmide als een standaard curve te bepalen van moleculen van cDNA moleculen.
      Opmerking: Zie bespreking voor verwachte hoeveelheden.
  3. HIV-1 DNA verrijking door hybride vastleggen.
    Opmerking: Vanuit deze stap voorwaarts is het beter om het gebruik van microcentrifuge buizen met lage nucleïnezuur bindende eigenschappen evenals aërosol filter Pipetteer tips voor alle DNA-monsters. Indien mogelijk, werken in een PCR-workstation. Alle stappen en reagentia zijn op RT (RT), tenzij anders vermeld.
    1. Pipetteer 100 µL kralen per monster in de buis van een enkele microcentrifuge ter voorbereiding van een master mix van magnetische daar kralen. Plaats de buis op een magneet geschikt voor buizen van de microcentrifuge.
    2. Nadat de kralen hebben geregeld naar de zijde van de magneet van de buis (~ 1 min), opstijgen van de opslag-buffer, verwijderen van de buis van de magneet en resuspendeer kralen in 500 µL van bind en buffer (BW buffer, 5 mM Tris-HCL pH 7.5, 0.5 mM EDTA wassen 1 M NaCl) te wassen.
    3. Plaats de buis terug op magneet, verwijder het supernatant en voeg van 500 µL caseïne oplossing. Neem van de magneet, resuspendeer en incubeer gedurende 10 min op de RT, dan wassen met BW buffer.
      Opmerking: Een wassen verwijst naar de plaatsen van de buis aan de magneet, opstijgen het supernatant, nemen de buis uit de magneet, het toevoegen van de buffer en resuspending.
    4. Plaats buis terug op de magneet, opstijgen het supernatant en resuspendeer kralen in 500 µL van BW buffer. Voeg 50 pmol van elke vastleggen biotinyleerd oligonucleotides (Zie tabel 1, drie oligos in dit geval) per monster. (Bijvoorbeeld als 5 DNA-monsters worden verwerkt moeten, gebruiken 500 µL van magnetische kralen uit stap 2.3.1 en 250 pmol van elke oligonucleotide).
    5. Incubeer gedurende 30 min op RT terwijl het schommelen in een eind over mixer.
    6. Kralen met de geïmmobiliseerdet oligonucleotides tweemaal met 500 µL van 1 x tien buffer (10 mM Tris HCl pH 8,0, 1 mM EDTA, 100 mM NaCl) wassen.
    7. Resuspendeer kralen in 10 µL van 1 x tien buffer per monster.
    8. Voor elk monster label een microcentrifuge buis en 10 µL van kralen schorsing, 170 µL van DNA toe te voegen (uit stap 2.1) en 90 µL van 3 x tien buffer. Bebroed in een blok van de droge hitte op 92 ° C gedurende 2 minuten te denatureren van het DNA.
    9. De buisjes naar een blok van verschillende droge hitte, die is ingesteld op 52 ° C, en incubeer gedurende 1 h. omkeren te mengen regelmatig (~ elke 10 min) tijdens deze incubatie.
    10. Een keer wassen met 500 µL 1 x tien buffer en resuspendeer in 35 µL nuclease-vrije H2O.
    11. Incubeer de buizen op 92 ° C in een blok van de droge hitte gedurende 2 minuten om te elueren. Vervolgens verplaatst snel de buizen op de magneet (één buis tegelijk). Zodra kralen zijn gebonden aan de kant van de buis, breng het supernatant met het DNA van HIV-1 aan een verse buis.
    12. Optioneel: Herhaal qPCR (zoals gedaan in stap 2.2.2) om te bepalen van de herstelde cDNA van HIV-1.
      Opmerking: Zie bespreking voor verwachte hoeveelheden.

3. adapter afbinding

  1. Voorbereiding van de adapter
    1. Resuspendeer gelyofiliseerd adapter (Zie tabel 1 "volledige Kwok + MiSeq") op 100 µM in nuclease-vrije H2O.
    2. Per monster plus één controlemonster, combineren 0,45 µL van 10 x T4 DNA ligase buffer 4 µL van adapter en 0,05 µL van nuclease-vrije H2O. warmte tot 92 ° C gedurende 2 minuten en laat elke afkoelen langzaam.
      Opmerking: Als de optie beschikbaar is gebruik een PCR-machine met verstelbare koeling tarief (gebruik 2%-tarief). Dit duurt ongeveer 30 min van 92 ° C tot 16 ° C. U kunt ook gebruik van een blok van droge hitte op 92 ° C en uitschakelen. Neem de adapter mastermix uit wanneer de warmte blok terug op RT. is Dit is om te laten de adapter vormen een haarspeld-structuur (Zie Figuur 2b).
  2. Voorbereiding van een reactie van de controle met een set van samengestelde oligonucleotides (Zie tabel 2) in plaats van DNA geëxtraheerd uit cellen.
    1. Voorraden 100 µM van elke oligonucleotide maken Meng 1 µL van elk van de 17 oligonucelotides en 8 µL van H2O voor een mengsel verhouding in een eindvolume van 25 µL toevoegen.
    2. Verdun de mix 1:2,500 in nuclease-vrije H2O in een seriële verdunning. Combineer 1 µL van het mengsel met 17.3 µL van nuclease-gratis H2O om te gebruiken in de controle monster afbinding in stap 3.3.1 zodat elke oligonucleotide aanwezig op 1.6 fmol is (gelijk aan 0.026 nM in de 60 µL reactie).
  3. Ligations instellen
    1. Voor 60 µL eindvolume reacties in PCR buizen combineren 6 µL van 10 x T4 DNA ligase buffer, 24 µL van 40% PEG, 6 µL van 5 M betaïne, 4.5 µL (400 pmol) van adapter (pre-annelead zoals in stap 3.1.2), 1.2 µL van T4 DNA ligase (2.000.000 eenheden/mL) en 18.3 µL van DNA (vanaf stap 2.3.11)
      Opmerking: Wees extra voorzichtig met visceuze oplossingen zoals 40% PEG om nauwkeurige volumes. Maak niet een mastermix.
    2. Dezelfde reactie als uitgevoerd in stap 3.3.1 maar met het besturingselement oligonucleotide mix, bereid in stap 3.2.2 ingesteld.
    3. Meng de reacties goed en na een nacht bebroeden in een PCR machine bij 16 ° C.

4. adapter verwijderen en grootte scheiding

  1. Denaturering van de Elektroforese van het gel
    1. Voeg 30 µL van formamide-bevattende DNA-gel laden van de buffer met elke afbinding-reactie. Meng goed door pipetteren.
    2. Warmte voor 2 min bij 94 ° C in PCR machine, onmiddellijk zet dan op ijs.
    3. Plaats een geprefabriceerd 6% Tris/boraat/EDTA (FSME) denatureren ureum polyacrylamidegel (10-well kam) in een passende gel-tank. Toevoegen van 1 x TBE (89 mM Tris-base, boorzuur 89 mM, 2 mM EDTA) lopende buffer en vooraf uitvoeren de gel voor 20 min op 250 V/max-constante.
    4. De gel zakken met het runnen van de buffer met behulp van een spuit en naald 21G wassen.
    5. Belasting elk 90 µL monster in drie putten (30 µL per putje) en run voor 20 min (250 V/max) tot de voorkant van de donkerblauwe kleurstof ongeveer halverwege door het gel is.
  2. Kleuring en snijden nucleïnezuren uit de gel
    1. Bereiden 3 kleine microcentrifuge buizen (0,5 mL) per monster door prikken gaten in de bodem met behulp van een naald spuit 21 G (Neem voorzichtigheid tijdens het werken met slijpsel). Elk van de bereid buizen in een tube van 2,0 mL microcentrifuge invoegen en hen label met de naam van het monster plus "laag", "Midden" of "hoog".
    2. Neem en loeren open de gel-cassette. Snijd de gel verticaal met een scheermesje royaal accijnzen de strip met de 3 putten van geladen monsters. De gel-strip toevoegen aan een container met 1 x FSME (ongeveer 30 mL) en 5 µL van cyanine nucleïnezuur vlek. Incubeer gedurende 3-5 min.
      Opmerking: De gel extractie stap is bijzonder gevoelig voor kruisbesmetting. Het is raadzaam om alleen 1 monster per gel en het gebruik van een aparte, schone container voor elke gel kleuring worden uitgevoerd. Handschoenen moeten worden gewijzigd als gel deeltjes contact met gehandschoende vingers.
    3. Reinigen van het oppervlak van een blauwe lichte transilluminator grondig met ddH2O. De gel-stuk uit de kleuring container nemen en toe te voegen aan de lichtbak.
    4. Zet de lichtbak en inspecteren van de gekleurde nucleic zuren door de oranje filter.
      Opmerking: De adapter meestal verschijnt overbelast en grote "blob" met ligaturen HIV-1 DNA waarop hoger wordt uitgevoerd als een streep worden uitgevoerd.
    5. Met behulp van een nieuwe scheermes, knippen weg de zijkanten van de gel als er gebieden met geen enkel monster geladen nog steeds aanwezig. Vervolgens snijd net boven de adapter aan op de adapter verwijderen en lager gel delen. Ten slotte weggesneden helemaal boven aan de gel, met inbegrip van ongeveer 1 mm van de gel zakken, die vaak een scherpe intens signaal van hoger molecuulgewicht DNA hebben.
    6. Verdeel de resterende gel stuk met het monster, die meestal ~ 2 x 3 is cm groot, horizontaal in drie zelfs stukjes: "laag", "Midden" en "hoog" molecuulgewicht gebieden.
      Opmerking: Elk stuk zal nu afzonderlijk worden behandeld [dwz., zal er drie buizen (laag, mid en hoog)] per oorspronkelijke monster.
    7. Snijd elk van de drie gel fragmenten in kleinere stukken (~ 2 x 2 mm deeltjes) en ze vervolgens overbrengen naar de geprepareerde 0,5 mL microcentrifuge buizen (stap 4.2.1).
    8. Spin op topsnelheid met open deksels voor 1 min te knijpen de gel stukken door het gat in de buis 2 mL maken een slush gel. Als elk gel deeltjes in de onderkant van de buis van 0,5 mL blijven, kunt u deze overbrengen naar de 2 mL-buis handmatig met behulp van een naald of pipette uiteinde.
  3. DNA-extractie
    1. 1 mL van ureum gel extractie buffer (0.5 M NH4CH3CO2, 1 mM EDTA, 0,2% SDS) aan de gel slush toevoegen. Draaien van buizen voor een minimum van 3 uur ('s nachts is aanvaardbaar) op RT met een mixer eind over.
    2. Gebruik een schone pincet set één kleine ronde glazen vezel filter toevoegen aan centrifuge kolommen met cellulose acetaat membraanfilters (0,2 µm), die voorkomt verstopping van het membraan. Zet het filter in plaats met een omgekeerde Pipetteer tip.
    3. Kort draaien de 2 mL buisjes met gel slush en extractie buffer in een microcentrifuge en 700 µL van het supernatans overbrengen in de kolommen bereid filter. Houd de gel slush en resterende supernatant.
    4. Centrifugeer het filter kolommen in een microcentrifuge op topsnelheid voor 1 min. overdracht de flowthrough in een nieuwe 2.0 mL microcentrifuge buis.
    5. Herlaad de kolommen met de resterende bovendrijvende substantie. Proberen te krijgen van zo veel vloeistof mogelijk bij de winning slush. Overdracht van gel stukken uitmaakt niet. Spin opnieuw en flowthroughs van de dezelfde extractie monsters te combineren.
  4. DNA neerslag
    1. Voeg 3 µL van polyA RNA (1 µg/µL; als een drager), 1 µL van glycogeen en 0,7 mL isopropanol en aan de flowthrough uit stap 4.3.5. Vortex kort en bevriezing bij-80 ° C's nachts.
    2. Monsters te nemen uit de vriezer-80 ° C en laat ze ontdooien kort. Leg ze in een gekoeld (4 ° C) microcentrifuge en spin voor 30 min op topsnelheid.
    3. Verwijderen en verwijder het supernatant. Wees zeer voorzichtig niet te verwijderen van de pellet. Laat 30 tot 50 µL van vloeistof als het is niet zeker dat pellet anders zou worden verwijderd.
      Opmerking: Doorgaans alle "hoge" monsters blijkt een zichtbaarder pellet dan "Midden" en "laag" monsters.
    4. Voeg 800 µL van 80% ethanol. Omkeren van buizen en spin weer voor 1 min op topsnelheid. Verwijderen van de meerderheid van ethanol met een pipet kort de buizen weer draaien en verwijderen meer ethanol met een kleiner volume pipet.
    5. Laat alle resterende ethanol verdampen door het plaatsen van de buizen met een open deksel in een blok van de droge hitte 55 ° C. Wanneer monsters zijn droog (2-4 min) Voeg 20 µL van nuclease-vrije H2O en de verspreiding rond de onderkant van de buis om ervoor te zorgen de DNA-pellet wordt ontbonden. Het DNA-monster kan worden opgeslagen bij-20 ° C.

5. PCR versterking en voorbereiding van de bibliotheek

  1. Een 40 µL van het PCR reactie met 20 µL van de polymerase van DNA pre-mix ingesteld, 18 µL van geprecipiteerde en redissolved DNA uit stap 4.4.5, 1 µL voorste primer "MP1.0 + 22HIV" (10µM) (Zie tabel 1), en 1 µL van multiplex oligo inleidingen (index inleidingen 1 tot en met 24) (zie tabel van Ma materialen).
    Opmerking: Voer dat de drie reacties (laag, mid, hoge) van elk monster in aparte PCR reacties, maar met dezelfde geïndexeerd primer. Gebruik een andere index voor elk van de originele exemplaren van de infectie.
    1. De PCR reacties onder de volgende omstandigheden worden uitgevoerd: 2 min op 94 ° C denaturatie, dan 18 cycli van 3-staps PCR; 15 s bij 94 ° C denaturatie, 15 s gloeien bij 55 ° C en 30 s uitbreiding bij 68 ° C.
  2. Als een optie voor kwaliteitscontrole, analyseren van PCR reacties met hoge gevoeligheid geautomatiseerd gel elektroforese systeem. Neem 2 µL van een laag, mid en hoog monster uit te voeren vanaf instructie van de fabrikant.
    Opmerking: De twee inleidingen moet zichtbaar en vaak uitvoeren op een berekende lengte van over 45 en 95 nt (werkelijke lengte verschilt). Bovendien DNA moet worden gevonden tussen 150 tot 500 nt. Als geen signaal aanwezig is, is het raadzaam om toe te voegen extra cycli van PCR, tussen 2 en 10 extra cycli. Voeg geen extra cycli voor de oligonucleotide controlemonsters gemaakt in stap 3.3.2.
  3. Schakel de inleidingen gebruiken een paramagnetisch kraal gebaseerde PCR schoonmaak systeem.
    1. Neem 20 µL van elke PCR-reactie en bundelen van de monsters samen (Meng alle monsters op dit punt). De resterende 20 µL reacties bevriezen als back-ups bij-20 ° C.
    2. Laat de paramagnetisch kralen komen aan RT en meng de gepoolde PCR reacties met 1,8 x het volume van de oplossing van de kraal. Meng door pipetteren en incubeer gedurende 5 min.
      Opmerking: Als een voorbeeld, als 4 monsters werden voorbereid en elk laag, mid en hoog reacties hebben, het volume zou 4 x 3 x 20 µL = 240 µL PCR reacties met een 432 µL kraal oplossing.
    3. Zet de buizen op een microcentrifuge buis magneet, laat de kralen binden voor ~ 1 min en opstijgen het supernatant moet worden verwijderd. Laat de buizen aan de magneet en voeg 500 µL van 80% ethanol.
    4. Laat de ethanol voor 30 s, vervolgens grondig opstijgen en laat de kralen airdry voor ~ 5 min. Voeg 40 µL van nuclease-vrije H2O, nemen de buizen uit de magneet en Pipetteer op en neer meerdere keren.
    5. Laat de schorsing voor 5 min. Zet de buis terug op de magneet, laat de kralen regelen naar de kant en het supernatant overbrengen in een nieuwe buis. Dit is de bibliotheek. Neem een 10 µL aliquoot voor kwaliteitscontroles en het bevriezen van de rest bij-20 ° C.

6. evaluatie van de bibliotheek

  1. Het bepalen van de kwaliteit van de bibliotheek, concentratie en molarity.
    1. Gebruik een fluorimetrische kwantificering methode. Meten 1 µL en 3 µL van de bibliotheek met een hoge gevoeligheid dsDNA assay kit volgens instructies van de fabrikant.
      Opmerking: Typische concentraties zijn tussen 1 en 10 ng/µL.
    2. Maatregel de bibliotheek DNA molecuulgewicht spectrum door hoge gevoeligheid geautomatiseerd gelelektroforese zoals hierboven (stap 5.2) beschreven.
    3. Gebruik de geautomatiseerde gel elektroforese analyse om te bepalen van het gemiddelde molecuulgewicht van de bibliotheek en berekenen om te verdunnen van de bibliotheek in nuclease-vrije H2O tot en met 4 nM. Verschillende bibliotheken kunnen worden gecombineerd, zolang alle indices uniek zijn.
  2. Optionele lage doorvoersnelheid kwaliteitscontrole
    1. De bibliotheek van DNA onverminderd TA klonen19 bibliotheek moleculen in vectoren voor versterking invoegen. Volg de instructies van de kit, groeien ~ 10-20 kolonies en uittreksel via miniprep de protocollen van DNA, zoals beschreven hier20.
    2. Reeks vector met lokale sequencing services en check dat de inserts de gewenste HIV-1 bevatten afgeleide reeksen en de bibliotheek-specifieke adapters.

7. high-Throughput Sequencing Run

  1. Een sequencing monster vel maken met de commerciële software geleverd bij de sequencing-platform.
    1. Aangeven van de geselecteerde sequentie-kit. Meestal kiezen een 150-cyclus-kit, maar anderen zijn afhankelijk van de gewenste Lees lengte geschikt.
    2. Selecteer "Alleen Fastq" als de werkstroom toepassing. Kies een van de sjablonen die de 24 indices aanwezig in de multiplex oligonucleotide kits (aangegeven in de handleiding van de kit) bevat.
    3. Selecteer "25 nt" voor Read1 en "125 nt" voor Read2. Houd 6 nt voor enkele index lezen.
      Opmerking: In de interne analyse alleen Read2 wordt gebruikt in de analyse. Read1 houden bij een minimum van 25 nt voor sequencing platform algoritme doeleinden.
  2. Volg de instructies van de fabrikant van juist voor de vooraf uitvoeren bibliotheek voorbereiding en setup. Kiezen voor de maximale 20 pM concentratie en gebruik een 15% PhiX piek, als de bibliotheek van zeer lage complexiteit is.

8. de gegevensanalyse

  1. Controleer of het pass filter percentage en de gemiddelde score van de kwaliteit van de Q30 aanvaardbaar volgens de rangschikking van de fabrikant van het platform de richtsnoeren.
    Opmerking: Pass filter is meestal > 90% en Q30 scores zijn doorgaans > 80%.
  2. Download de. fastq.gz bestanden vanuit de fabrikant sequencing hub.
  3. De sequencing-script instellen
    1. Maak een nieuwe map (map) met de naam "AnalysisXYZ" en ga naar https://github.com/malimlab/seqparse voor het downloaden van alle broncode-bestanden (parse_sam.pl, rc_extract.pl, parse.sh) in deze map.
    2. Download de korte-lezen aligner Bowtie, versie 1.1.2, van http://bowtie-bio.sourceforge.net/index.shtml in de zelfde folder.
    3. De download maakt u een submap binnen de "AnalysisXYZ", "Bowtie-1.1.2" genoemd. Binnen deze map openen subdirectory "indexen" en downloaden van de sequenties van de meegeleverde sjabloon bestaande uit 6 bestanden met de extensies van de .ebwt.
    4. Download de FASTQ/A korte leest voorbehandeling toolkit fastx-0.0.13 van http://hannonlab.cshl.edu/fastx_toolkit/download.html in de map "AnalysisXYZ".
    5. Download zowel Samtools (https://sourceforge.net/projects/samtools/files/) en bam-readcount (https://github.com/genome/bam-readcount) naar de directory "Documenten".
  4. Verplaats de. fastq.gz bestanden, gedownload in stap 8.2, van alle gelezen 2s (eindigend op... _R2_001.fastq.gz) naar de map "AnalysisXYZ".
  5. Open de command console/terminal. Verplaatsen naar de "AnalysisXYZ" als de huidige directory met behulp van cd commando's. Type "./parse.sh." de scripts uit te voeren.
  6. Vindt de bestanden met samenvattingen van de .csv voor alle monsters op totale Lees graven, lengte aangepast lezen graven, en normaliseert Lees graven, evenals bestanden met de basis variatie, voor elk monster in een map met de naam parse_results binnen de folder van de "Analyse XYZ".
    Opmerking: Zie de discussie voor meer informatie over het analyseproces. Het script retourneert csv bestanden met totale leest voor elk nucleotide langs de HIV-1NL4.3 sterke-stop sequenties en eerste strand overdracht tot nucleotide 635. Als richtsnoer, worden 50.000 tot 100.000 unieke leest doorgaans waargenomen in monsters van infecties met de vermelde cel nummers en virale entmateriaal en zonder antivirale eiwitten of verbindingen. De oligonucleotide controlemonster produceert meestal 100.000 tot 200.000 leest.

Representative Results

De techniek die in dit artikel beschreven werd toegepast op een bredere studie inspelen op de mechanismen die ten grondslag liggen aan de remming van HIV-1 omgekeerde transcriptie door de antiretrovirale menselijke eiwit APOBEC3G (A3G)6. Figuur 3 toont representatieve resultaten verkregen na de dienst van het protocol in monsters van CEM-SS T-cellen geïnfecteerd met vif-deficiënte HIV-1 in de afwezigheid of de aanwezigheid van A3G. Het totale aantal unieke leest elk monster verkregen na het uitfilteren van PCR duplicaten die de zelfde 6 hebben nt barcode en dezelfde lengte (uitgevoerd door de analysesoftware die) worden uitgezet in Figuur 3een. Toename van A3G minder totale lees als gevolg van de remmende werking van A3G op RT gemedieerde cDNA synthese eerder beschreven en gemeten door qPCR6,13,21,22. In Figuur 3, onderb, de Fractie van de moleculen op elke mogelijke lengte binnen de eerste 182 nt staan. Voor HIV-1 infectie in de afwezigheid van A3G, de meest voorkomende soort is de belangrijkste 180 nt sterke-stop molecuul zelf, met enkele accumulatie van luidt in het korter bereik (23 tot en met 40 nt) (bovenaan de grafiek, blauwe histogrammen). De toevoeging van A3G wijzigingen die dit profiel als een scherpe toename van kortere, afgekapt cDNA moleculen op enkele zeer specifieke, reproduceerbare posities is gedetecteerd (middelste en onderste grafieken). Aangezien A3G een cytosinetrifosfaat Dipyridamol, cytosine-naar-uridine is (aangeduid als C-te-T) optreden mutaties in de cDNA wanneer A3G aanwezig in de infecteren virionen21,23,24 is. Met behulp van de informatie verkregen sequencing, was het percentage van C-naar-T mutaties uitgezet op dezelfde grafiek (rode stippellijn). Opgemerkt moet worden dat het vogelgriepvirus profiel is afgeleid van alle unieke leest gecombineerd en dekking van elk nucleotide zullen variëren. Echter, indien vereist opeenvolgingsinformatie kan worden gerelateerde terug naar elke molecuul en gecorreleerd met een specifieke 3'-terminus. De verstrekte gegevens werden ontleend aan Pollpeter et al. 6 en de correlatie tussen vogelgriepvirus en cDNA lengte profielen bleek te wijten aan de detectie- en splitsing van deaminated cDNA door de cellulaire DNA repair machines.

Een positieve controle voor de aanpak van de 3'-toewijzing kan gemakkelijk worden geproduceerd door een pool van synthetische oligonucleotides voor de bekende reeks, lengte en concentratie te verwerken. Dit besturingselement is toegevoegd aan de afbinding van de adapter in stap 3.3.2 en geadviseerd om te worden opgenomen in alle multiplexed bibliotheken. Gegevens die zijn verkregen uit een controlemonster moet alle de oligonucleotides op de verwachte input verhoudingen, met slechts zeer lichte achtergrond leest. Figuur 4 ziet u resultaten van een positieve controle set 17 chemisch samengestelde oligonucleotides (voor reeksen, Zie tabel 2), die werden gemixt in mengsel ratio's. Zoals verwacht, verschijnen alle moleculen in dicht bij gelijke overvloed met slechts kleine variaties (bovenste grafiek). Terwijl de meeste posities binnen de opeenvolging van de DNA - sss die niet werden vertegenwoordigd door een oligonucleotide nul Lees graven terugkeren, zien we minder gangbare diersoorten die 1 of 2 nt korter is dan de feitelijke controle oligonucleotides. We hebben niet verder onderzocht deze minder gangbare soorten maar veronderstellen dat zij aangetaste of onvolledige producten potentieel aanwezig in de meegeleverde oligonucleotide voorraden bij aankoop vertegenwoordigen (oligonucleotides werden besteld zoals HPLC gezuiverd, waarvoor de de fabrikant geeft aan zuiverheid van > 80%). De onderste grafiek toont de controlemonster uit een andere bibliotheek uitvoert, waar variatie enigszins hoger is geplaatst tussen de 17 oligonucleotides en correleert met totale lengte in die zin dat langere controle moleculen efficiënter worden gedetecteerd dan kortere audiobestanden splitsen. Dit kan worden veroorzaakt door een kleine vertekening in PCR reacties of clustering tijdens MiSeq sequencing, die een optimale invoegen grootte heeft en kan optreden met bibliotheken uitvoering met name brede invoegen bereiken. Een simpele manier om aan te pakken dit bias is de toepassing van een normalisatie-factor op basis van de helling die aangeeft van de bias correleren aan molecuul lengte (roze lijn). De vereiste berekeningen zijn opgenomen in de analyseprogramma (zie stap 8.3 in het protocol).

Figure 1
Figuur 1: Diagram toont de eerste stappen van HIV-1 reverse transcriptie. Het proces begint met het gloeien van tRNA(Lys,3) (sinaasappel) naar de primer bindende site (PBS) in de genomische virale RNA (stap 1), waarmee de inleiding en de rek van virale cDNA (blauw, stap 2). Gelijktijdig, is de sjabloon genomic RNA afgebroken door RNaseH activiteit voor RT (stap 3). De eerste volledige intermediaire in het proces van omgekeerde transcriptie is de min-strand sterke-halte (-) sss cDNA, die is voltooid wanneer de RT gekatalyseerd polymerisatie het 5'-eindpunt van de gRNA (R) herhalingsgebied (stap 3 bereikt). De tussenliggende (-)-sss wordt overgedragen aan de 3'-terminus van de genomic RNA-sjabloon door gloeien aan de complementaire terminal 3'-lange (LTR) R herhalingsgebied. Hiervandaan blijft polymerisatie (stap 4). In de beschreven methode wordt de omgekeerde transcriptie progressie bepaald door kaart brengen van de exacte lengte van de ontluikende virale cDNA (blauw). PPT, polypurine darmkanaal; U5, unieke 5'-reeks; U3, unieke 3'-reeks. Dit cijfer wordt gepubliceerd van een eerdere publicatie6. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : Workflow overzicht en schema's van de PCR versterking strategie en adapter afbinding. (a) workflow overzicht van de belangrijkste stappen van de beschreven techniek om te bepalen van de 3'-termini voor HIV-1 omkeren afschriften in geïnfecteerde cellen. De figuur wordt aangepast van een eerdere publicatie6. (b) Schematische voorstelling van de adapter afbinding en PCR versterking strategie. Ontluikende cDNA moleculen van verschillende lengten die zijn gezuiverd in vorige stappen naar een single-stranded DNA adapter met behulp van T4 DNA ligase als ligatuur zijn verbonden. De haarspeld-adapter (benoemde "volledige Kwok + MiSeq", Zie tabel 1) ontwerp is geïnspireerd door Kwok et al. 11. de adapter draagt een willekeurige 6 nt barcode reeks, die zorgt voor base-paring om afbinding en tegelijkertijd dient als een identifier voor unieke leest. De 3'-termini van de adapter draagt een spacer (SpC3) om te voorkomen dat de zelf-Afbinding. Ligaturen producten zijn gescheiden van overtollige adapter door denaturering van polyacrylamide gelelektroforese (pagina). Nucleic zuren in de gel zijn gekleurd en snijd in drie afzonderlijke, gelijke-grootte gel stukken in het gebied boven de adapter aan op de put, zoals gedaan in25. De producten zijn na elutie, neerslag en resuspensie, PCR versterkt met inleidingen gloeien in de bekende reeks van de adapter (primer 1, multiplex oligonucleotide kit, Zie Tabel van materialen) en een uitvoering van de eerste 22 primer nt van de HIV-1 5'-LTR reeks onmiddellijk na het tRNA (primer 2, MP1.0 + 22HIV). De 5'-termini van de gekozen inleidingen voeren adapters voor het gekozen sequencing platform (P5 en P7) evenals een index opeenvolging te onderscheiden van de afzonderlijke monsters worden uitgevoerd in dezelfde bibliotheek. Uitgangspunten van de sequencing Lees inleidingen worden aangegeven. De blue box geeft de regio van belang zijn voor het bepalen van de oorspronkelijke 3'-termini van de vastgelegde molecule. Dit percentage is aangepast van een eerdere publicatie6. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 : Representatieve resultaten. (a) de totale Lees telling van representatieve monsters verwerkt met het protocol beschreven. Dit omvat alle sequenties die werden geïdentificeerd als unieke leest van HIV-1 moleculen met hun 3'-termini binnen de eerste 635 nt van de minus strand cDNA (tot de PPT, Zie Figuur 1). Infectie met HIV-1 niet uitvoering A3G levert het hoogste aantal leest, overwegende dat A3G cDNA synthese remt en daardoor het totaal lezen tellen vermindert. Niet-geïnfecteerde cellen diende als een negatieve controle, terwijl een aantal synthetische oligonucleotides een positieve controle biedt. b) het relatieve overvloed van cDNAs voor elke lengte tussen nt posities 23 en 182 (full-length - sss cDNA is 180 tot en met 182 nt) van de HIV-1NL4.3 sequentie (x-as) is getoond in blauw histogrammen (schaal op de linker y-as). De relatieve overvloed van cDNA was berekend op basis van het absolute aantal sequenties gespreksafgifte op een bepaalde nucleotide binnen de - sss cDNA volgorde gedeeld door de som van alle luidt het meten van 182nt of minder. Weergegeven in onderbroken rode lijnen zijn de percentages van luidt uitvoering van C-naar-T/U mutaties op de respectieve positie (schaal op de juiste y--assen). Figuur 3 b wordt gepubliceerd van een eerdere publicatie6. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4 : Representatieve resultaten van controlemonsters. Komt te staan, zijn twee profielen voor zwembaden met mengsel bedragen van 17 verschillende lengte synthetische oligonucleotides. Deze oligonucleotides hebben sequenties van HIV-1NL4.3 en werden geselecteerd om de dekking van verschillende lengtes en alle 4 bases als een 3'-nucleotide (Zie tabel 2). De bovenste grafiek toont de positieve controlemonster uit Figuur 3een. Geen significante overhellen naar de lengte van het molecuul of het open 3'-termini is gedetecteerd. De onderste grafiek toont een andere bibliotheek uitvoert, die een kleine lengte bias in sequencing geproduceerd. In dit geval is het aan te raden om het toepassen van een factor van normalisatie, die wordt afgeleid uit de helling (afgebeeld in roze) die de grootte bias vertegenwoordigt. Dit cijfer wordt gepubliceerd van een eerdere publicatie6. Klik hier voor een grotere versie van dit cijfer.

Oligo-naam Lengte in nt Volgorde Doel Fabrikant (zuivering)
volledige Kwok + MiSeq 61 5'-PHO-tgaagagcctagtcgctgttcannnnnnctgcccatagagagatcggaagagcacacgtct-SpC3-3' Adapter IDT DNA-technologieën (HPLC)
2xBiotin SS aas 40 5'-Biotine-cagtgtggaaaatctctagcagtggcgcccgaacagggac-Biotine-3' Hybride Capture MWG Eurofins (HPLC)
Biotine 1-16 ss 22 5'-cagtgtggaaaatctctagcag-BiTEG-3' Hybride Capture MWG Eurofins (HPLC
Biotine tRNA + CTG 16 5'-cagtggcgcccgaaca-BITEG-3' Hybride Capture MWG Eurofins (HPLC)
MP1.0 + 22HIV 82 5'-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatctcactgctagagattttccacactg-3' PCR versterking MWG Eurofins (HPLC

Tabel 1: inhoudsopgave oligonucleotides waaronder lengte, reeksen en wijzigingen die worden gebruikt in het protocol beschreven. De tabel wordt aangepast van een eerdere publicatie6Gelieve Klik hier om deze tabel als een excel-bestand te downloaden.

Oligo-naam Lengte in nt Volgorde Fabrikant (zuivering)
HTP con lange C 120 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaagc-3' MWG Eurofins (HPLC)
HTP con lange G 119 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaag-3' MWG Eurofins (HPLC)
HTP con lange T 116 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggctt-3' MWG Eurofins (HPLC)
HTP con lange A 118 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaa-3' MWG Eurofins (HPLC)
HTP con medio C 76 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcac-3' MWG Eurofins (HPLC)
HTP con medio G (a) 71 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacg-3' MWG Eurofins (HPLC)
HTP con medio G (b) 72 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgg-3' MWG Eurofins (HPLC)
HTP con medio A 69 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacaga-3' MWG Eurofins (HPLC)
HTP con medio T 85 5'-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactt-3' MWG Eurofins (HPLC)
HTP con korte A 40 5'-ctgctagagattttccacactgactaaaagggtctgaggga-3' MWG Eurofins (HPLC)
HTP con korte T 33 5'-ctgctagagattttccacactgactaaaagggt-3' MWG Eurofins (HPLC)
HTP con korte G 41 5'-ctgctagagattttccacactgactaaaagggtctgaggg-3' MWG Eurofins (HPLC)
HTP con korte C 34 5'-ctgctagagattttccacactgactaaaagggtc-3' MWG Eurofins (HPLC)
HTP Con 46 (T) 46 5'-ctgctagagattttccacactg actaaaagggtctgagggatctct-3' MWG Eurofins (HPLC)
HTP Con 83 (C) 83 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactac-3' MWG Eurofins (HPLC)
HTP Con 103 (C) 103 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagc-3' MWG Eurofins (HPLC)
HTP Con 107 (A) 107 5'-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagcttta-3' MWG Eurofins (HPLC)

Tabel 2: tabel van 17 controle van synthetische oligonucleotides gebruikt als een positieve controlemonster. De top 13 oligonucleotides werden gekozen op basis van grootte [lange (116 tot en met 120 nt), mid (69 tot en met 85 nt), korte (33 tot en met 41 nt)] evenals hun 3'-termini. De tabel wordt aangepast van een eerdere publicatie6.  Gelieve Klik hier om deze tabel als een excel-bestand te downloaden.

Discussion

De beschikbaarheid van snelle, betrouwbare en kosteneffectieve diepe sequencing heeft een revolutie teweeggebracht in vele aspecten op het gebied van de biowetenschappen, waardoor grote diepte in sequencing gebaseerde analyses. Een resterende uitdaging ligt in het innovatieve ontwerp en de creatie van vertegenwoordiger sequencing bibliotheken. Hier beschrijven we een protocol om vast te leggen van de ontluikende virale cDNA moleculen, specifiek de tussenproducten van de HIV-1 omgekeerde transcriptie proces.

De meest kritische stap in deze strategie is de afbinding van een adapter naar de open 3'-termini kwantitatieve en onbevooroordeelde wijze. Efficiëntie van de ligations tussen twee ssDNA termini, zowel inter- en intramoleculaire, zijn onderzocht en geoptimaliseerd voor verschillende toepassingen11,26,27,28,29. De keuze van het gebruik van een adapter haarspeld met T4 DNA ligase onder de voorwaarden beschreven in stap 3.3 is het resultaat van empirische optimalisatie waarin we geëvalueerd verschillende ligases, adapters en reagentia voor de afbinding van synthetische oligonucleotides vertegenwoordigen HIV-1 sequenties (tabel 2) (gegevens niet worden weergegeven). In deze in vitro test reacties, we het bevestigd dat de T4 DNA-ligase Afbinding van de haarspeld adapter gemedieerde, zoals beschreven door Kwok et al.. 11, heeft een zeer lage vooroordeel, en bereikt in de buurt van volledige Afbinding van acceptor moleculen wanneer de adapter wordt gebruikt in een overschrijdingstolerantie. De efficiëntie van de afbinding werd niet beïnvloed door de toevoeging van nucleotide sequentie te maken van de adapter compatibel voor het multiplex primer-systeem (Zie Figuur 4). In vergelijking vonden we dat een thermostable 5' DNA/RNA ligase ("Ligase A", Zie Tabel van materialen voor exacte ligases in vergelijking hier), oftewel een gemanipuleerde RNA ligase die gedeeltelijk is ontwikkeld om te verbeteren op de efficiëntie van de afbinding met ssDNA als de acceptor 27, was inderdaad meer effectief in het ligating van twee ssDNA moleculen dan RNA ligase ("Ligase-B"), maar had een aanzienlijke vertekening, met sterke verschillen in de efficiëntie van de afbinding zelfs tussen oligonucleotides met enkele basis lengte verschillen [tabel 2 ; HTP con mid G (a) en (b)]. Bovendien vonden we alleen een minimale vertekening in de reacties met "Ligase C" gecombineerd met een adapter die een gerandomiseerde 5'-termini (een strategie gebruikt ter compensatie van de bekende nucleotide bias van "Ligase C"; Zie bijvoorbeeld Ding et al.. 30). toch de "Ligase C"-gemedieerde intermoleculaire ligations waren incompleet, waardoor de T4 DNA ligase systeem de superieure keuze.

Verschillende stappen van de kwaliteitscontrole over het verloop van het protocol en het opnemen van positieve en negatieve controles voldoende zijn voor de detectie van potentiële problemen voordat assay voortzetting en als leidraad voor het oplossen van de inspanningen. De qPCR ondermeer in stappen 2.2.2 en 2.3.12 zorgen ervoor dat de hoeveelheid van het uitgangsmateriaal voldoende is. Typische cDNA kopie getallen in het bereik van de elutie (uit stap 2.1) 200 µL van ongeveer 10.000 tot 300.000 per µL. De hybride opname stap kan resulteren in een verlies van totale HIV-1 cDNA hoeveelheid maar moet resulteren in een sterke verrijking van specifieke HIV-1 cDNA over cellulaire DNA, wat kan worden vastgesteld met behulp van passende inleidingen te kwantificeren genomic DNA vóór en na de verrijking door qPCR of door het meten van de totale concentratie van DNA. Herstelde cDNA van HIV-1 nadat de hybride vangen stappen moet ten minste 10% van de invoer. Lage grondstof kan anders verklaren een succesvolle oligonucleotide positieve controle (zie stap 3.3.2) maar beperkt leest bereikt in de monsters. Lage lezen nummers algemene kan ook worden verklaard door de overschatting van de concentratie van de bibliotheek als gevolg van de aanwezigheid van irrelevante DNA soorten zonder MiSeq adapters. Dit zou leiden tot lage cluster dichtheid en kan worden verbeterd door de bepaling van de concentratie van HIV-1 sequenties in de bibliotheek door qPCR naast het totaalbedrag van DNA door fluorimetrische analyses. Vanwege de gevoelige aard van de methode, moet speciale zorg worden genomen om zelfs low-level verontreiniging, zowel vanuit andere monsters (met name uit de hoge concentratie controle oligonucleotide voorraden) en uit laboratoriumapparatuur te voorkomen. Werken in een UV steriliseren van PCR werkstation is gunstig in dit opzicht. De geautomatiseerde gelelektroforese van de definitieve bibliotheek (stap 6.1.2) is een verdere maatregel van de kwaliteitscontrole. Het nucleïnezuur groottewaaier doorgaans waargenomen is tussen 150 tot 500 nt. inleidingen die kunnen worden ontdekt in de optionele controle na de PCR en voor de zuivering (zienoot in stap 5.2) moet nu afwezig. In een representatief resultaat, de steekproef intensiteit curve heeft een piek rond 160 tot 170 nt en een tweede scherper piek rond 320 tot 350 nt. Dit weerspiegelt waarschijnlijk de vaak gezien hogere overvloed in zowel relatief kort (1 tot en met 20 nt invoegen lengte) reverse afschriften en full-length sterke-stop (180 tot en met 182 nt invoegen lengte) (Figuur 3b).

Terwijl de gepresenteerde protocol en geselecteerde primers specifiek voor vroege HIV-1 omgekeerde transcriptie constructies zijn, is de methode in het algemeen toepasselijk voor onderzoek gericht op het bepalen van de open 3'-termini van DNA. De belangrijkste wijzigingen nodig zijn in een andere context zullen de methode voor hybride capture en de primer design strategie. Bijvoorbeeld, als het doel zich aan late HIV-1 afschriften worden aangepast, een groter aantal verschillende vastleggen biotinyleerd oligonucleotides gloeien over de lengte van de cDNA zou wenselijk zijn en het verlies in de hybride opname stap waarschijnlijk zal afnemen. Zoals vermeld in de inleiding, is het belangrijk dat beperkingen bij het ontwerpen van het bereik waarover 3'-termini zijn worden gedetecteerd om te voorkomen dat verschillende bronnen van bias. Ten eerste kan er een vertekening in de PCR reacties als de sjablonen met de adapter met enorm verschillende lengten. Ten tweede, de sequencing platform gebruikt hier (bijvoorbeeld MiSeq) heeft een bereik van de lengte voorkeur invoegen voor optimale clustering, en aanzienlijk kortere en langere producten kunnen niet worden sequenced met de dezelfde efficiëntie. Gedeeltelijk, dit kan worden aangepakt computationeel, zoals ook is gebeurd door te berekenen een correctiefactor voor lineaire lengte bias (Zie Figuur 4, onderste grafiek). Echter, als de provincie waar de 3'-termini mapping is gewenst lang is (> 1000 nt), het is meer aan te raden te splitsen van de reacties met de ligaturen transcripten en meerdere upstream inleidingen kunt beoordelen 3'-termini in secties.

De analyseprogramma is in-house geschreven voor het specifieke doel van het analyseren van zowel het laatste nucleotide van de HIV-1 reeks grenzend aan de volgorde van de vaste adapter evenals de basis variatie van alle rechtsgrondslagen voor het identificeren van alle mutaties. De afzonderlijke stappen omvatten het volgende: ten eerste, de adapter-sequenties zijn bijgesneden met de toolkit van de fastx-0.0.13; vervolgens worden alle sequenties die worden gedupliceerd (dat wil zeggen identiek sequenties, met inbegrip van de streepjescode) verwijderd. Alle resterende unieke leest zijn dan afgestemd op de volgorde van de HIV-1 Bowtie (http://bowtie-bio.sourceforge.net/index.shtml) met de maximale mismatch vastgesteldop van drie basen. De sjabloon-reeks bestaat uit de eerste 635 nt van HIV-1 cDNA (NL4.3-stam), waarin de volgorde - sss en het eerste strand overdracht product tot het nummer van de polypurine (U5-R-U3-PPT; Zie Figuur 1). Aldus, zijn de meegeleverde software en sjablonen alleen direct geschikt als de methode wordt gebruikt voor dezelfde toepassing (detectie van vroege omgekeerde afschriften van de HIV-1NL4.3). Aanpassingen zullen moeten worden gemaakt voor andere doel-sequenties. De posities van de 3'-termini voor elke lezen werden bepaald door de positie in de uitlijning. Basis gesprekken voor elke positie worden opgenomen en mutatie tarieven worden berekend op basis van de totale dekking van elke basis, die varieert, zoals leest van verschillende lengtes zijn en lange inzetstukken kunnen niet volledig worden gedekt door de sequencing van de 125-base in Read2.

Tot slot, wij geloven de beschreven methode om een waardevolle tool voor vele soorten studies. Voor de hand liggende toepassingen omvatten onderzoeken van de mechanismen die ten grondslag liggen aan de omgekeerde transcriptie remming door middel van antiretrovirale geneesmiddelen of cellulaire beperking factoren. Echter moet slechts relatief kleine aanpassingen nodig zijn om te passen het systeem aan de 3'-termini toewijzen binnen andere single-stranded DNA virale tussenproducten, die aanwezig zijn, bijvoorbeeld bij parvovirus-replicatie. Bovendien kan het uitgangspunt van de methode, met name de geoptimaliseerde afbinding stap, een fundamenteel onderdeel van bibliotheek voorbereiding ontwerp zorgen voor de karakterisatie van eventuele uitbreidingen van de 3'-DNA, met inbegrip van versnellingen gekatalyseerd door cellulaire double-stranded DNA polymerase.

Disclosures

De auteurs verklaren dat zij niets hebben te onthullen.

Acknowledgments

De auteurs erkennen de steun van leden van het Malim laboratorium, Luis Apolonia Jernej Ule en Rebecca Oakey. De auteurs bedanken Matt Arno op het King's College London Genomic Centre en Debbie Hughes op de University College London (UCL), Instituut voor neurologie Next Generation Sequencing faciliteit, voor hulp bij MiSeq sequencing loopt. Het werk werd gesteund door de Britse Medical Research Council (G1000196 en M.M. heer/M001199/1), de Wellcome Trust (106223/Z/14/Z tot M.M.), de Europese Commissie zevendekaderprogramma (KP7/2007-2013) onder de Subsidieovereenkomst geen. PIIF-GA-2012-329679 (tot D.P.) en het ministerie van volksgezondheid via een nationale instituten voor gezondheid onderzoek uitgebreide Biomedical Research Center award aan Guy's en St. Thomas' NHS Foundation Trust in samenwerking met King's College London en King's College Hospital NHS Foundation Trust.

Materials

Name Company Catalog Number Comments
293T cells ATCC CRL-3216
Dulbecco's Modified Eagle's Medium Gibco 31966-021
Penicillin/Streptomycin Gibco 15150-122
Fetal Bovine Serum Gibco 10270-106
HeraCell Vios 250i CO2 Incubator Thermo Scientific 51030966
Laminar flow hood - CAS BioMAT2 Wolflabs CAS001-C2R-1800
10mm TC-treated culture dish Corning 430167
TrypLE™ Express (1x), Stable Trypsin Replacement Enzyme Gibco 12605-010
OptiMEM® (Minimal Essential Medium) Gibco 31985-047
HIV-1 NL4-3 Infectious Molecular Clone (pNL4-3) NIH Aids reagent program 114
Polyethylenimine (PEI) - MW:25000 PolySciences Inc 23966-2 dissolved at 1mg/ml and adjusted to pH7
RQ1- Rnase free Dnase Promega M6101
Filter 0.22 μm Triple Red Limited FPE404025
15 mL polypropylene tubes Corning CLS430791
Sucrose Calbiochem 573113
Phosphate Buffered Saline (1x) Gibco 14190-094
Ultracentrifuge tubes Beckman Coulter 344060
Ultracentrifuge Sorval WX Ultra Series Th-641 Rotor
Alliance HIV-1 p24 antigen ELISA kit Perkin Elmer NEK050001KT
CEM-SS cells NIH Aids reagent program 776
Roswell Park Memorial Institute Medium Gibco 31870-025
CoStar® TC treated multiple well plates Corning CLS3513-50EA
Benchtop centrifuge: Heraus™ Multifuge™ X3 FR Thermo Scientific 75004536
TX-1000 Swinging Bucket Rotor Thermo Scientific 75003017
Microcentrifuge: 5424R Eppendorf 5404000060
Total DNA extraction kit (DNeasy Blood and Tissue kit) Qiagen 69504
Nuclease free H2O Ambion AM9937
Cutsmart buffer New England Biolabs (part of DpnI enzyme) R0176S
DpnI restriction enzyme New England Biolabs R0176S
Oligonucleotides for qPCR MWG Eurofins N/A HPSF purification
TaqMan PCR Universal Mastermix Thermo 4304437
LoBind Eppendorf® tubes Eppendorf 30108078
Axygen™ aerosol filter pipette tips, 1000 μL Fisher Scientific TF-000-R-S
Axygen™ aerosol filter pipette tips, 200 μL Fisher Scientific TF-200-R-S
Axygen™ aerosol filter pipette tips, 20 μL Fisher Scientific TF-20-R-S
Axygen™ aerosol filter pipette tips, 10 μL Fisher Scientific TF-10-R-S
PCR clean hood LabCaire Model PCR-62
DynaMag™2-magnet Thermo 12321D
Streptavidin MagneSphere® paramagnetic particles Promega Z5481
Casein Thermo Scientific 37582
End over end rotator, Revolver™ 360° Labnet H5600
Tris-Base Fisher Scientific BP152-5
Hydrochloric Acid Sigma H1758-100ML
EDTA disodium salt dihydrate Electran (VWR) 443885J
Sodium Chloride Sigma S3014
Dri-Block® Analog Block Heater Techne UY-36620-13
PCR tubes and domed caps Thermo Scientific AB0266
PCR machine Eppendorf Mastercycler® series
T4 DNA ligase New England Biolabs M0202M
40% Polyethylene glycol solution (PEG) in H2O, MW: 8000 Sigma P1458-25ML
Betaine solution, 5M Sigma B0300-1VL
Gel loading buffer II (formamide buffer) Thermo Scientific AM8546G
Precast 6% TBE urea gels Invitrogen EC6865BOX
Mini cell electrophoresis system Invitrogen, Novex XCell SureLock™
Tris/Borate/EDTA solution (10x) Fisher Scientific 10031223
Needle 21 G x1 1/2 VWR 613-2022
SYBR Gold nucleic acid stain (10000x) Life Technologies S11494
Dark Reader DR46B transilluminator Fisher Scientific NC9800797
Ammonium acetate Merck 101116
SDS solution 20% (w/v) Biorad 161-0418
Centrifuge tube filter Appleton Woods BC591
Filter Glass Fibre Gf/D 10mm Whatman (VWR) 512-0427
polyadenylic acid (polyA) RNA Sigma 10108626001
Glycogen, molecular biology grade Thermo Scientific R0561
Isopropanol (2-propanol) Fisher Scientific 15809665
Ethanol, molecular biology grade Fisher Scientific 10041814
Accuprime™ Supermix I (DNA polymerase premix) Life Technologies 12342-010
NEBNext® Multiplex Oligo for Illumina (Index Primer Set 1 and 2) New England Biolabs E7335S; E7500S
Tapestation D1000 Screentape High sensitivity Agilent Technologies 5067- 5584
Tapestation D1000 Reagents Agilent Technologies 5067- 5585
2200 Tapestation - automated gel electrophoresis system Agilent Technologies G2965AA
Agencourt® AMPure® beads XP Beckman Coulter A63880
Qubit™ dsDNA HS Assay Kit Invitrogen Q32851
Qubit™ 2.0 Fluorometer Invitrogen Q32866
Topo™ TA cloning Kit Invitrogen 450071
Sequencing platform: MiSeq System Illumina
Experiment Manager (Sample sheet software) Illumina Note: Use TruSeq LT as a template
Miseq™ Reagent kit V3 (150 cycle) Illumina MS-102-3001
Sequencing hub: Basespace Illumina https://basespace.illumina.com
Ligase A: Thermostable 5’ App DNA/RNA ligase NEB M0319S Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase B: T4 RNA ligase 1 NEB M0204 Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase C: CircLigase Epicentre CL4111K Not used in this protocol, but tested in optimization process with results described in the discussion.

DOWNLOAD MATERIALS LIST

References

  1. Herschhorn, A., Hizi, A. Retroviral reverse transcriptases. Cellular and Molecular Life Sciences. 67, (16), 2717-2747 (2010).
  2. Hu, W. S., Hughes, S. H. HIV-1 reverse transcription. Cold Spring Harbor Perspectives in Medicine. 2, (10), (2012).
  3. Levin, J. G., Mitra, M., Mascarenhas, A., Musier-Forsyth, K. Role of HIV-1 nucleocapsid protein in HIV-1 reverse transcription. RNA Biology. 7, (6), 754-774 (2010).
  4. Menendez-Arias, L., Sebastian-Martin, A., Alvarez, M. Viral reverse transcriptases. Virus Research. (2016).
  5. Telesnitsky, A., Goff, S. P. Retroviruses. Coffin, J. M., Hughes, S. H., Varmus, H. E. (1997).
  6. Pollpeter, D., et al. Deep sequencing of HIV-1 reverse transcripts reveals the multifaceted antiviral functions of APOBEC3G. Nature Microbiology. 3, (2), 220-233 (2018).
  7. Frohman, M. A., Dush, M. K., Martin, G. R. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proceedings of the National Academy of Sciences of the United States of America. 85, (23), 8998-9002 (1988).
  8. Liu, X., Gorovsky, M. A. Mapping the 5' and 3' ends of Tetrahymena thermophila mRNAs using RNA ligase mediated amplification of cDNA ends (RLM-RACE). Nucleic Acids Research. 21, (21), 4954-4960 (1993).
  9. Ince, I. A., Ozcan, K., Vlak, J. M., van Oers, M. M. Temporal classification and mapping of non-polyadenylated transcripts of an invertebrate iridovirus. Journal of General Virology. 94, Pt 1 187-192 (2013).
  10. Hafner, M., et al. RNA-ligase-dependent biases in miRNA representation in deep-sequenced small RNA cDNA libraries. RNA. 17, (9), 1697-1712 (2011).
  11. Kwok, C. K., Ding, Y., Sherlock, M. E., Assmann, S. M., Bevilacqua, P. C. A hybridization-based approach for quantitative and low-bias single-stranded DNA ligation. Analytical Biochemistry. 435, (2), 181-186 (2013).
  12. Abram, M. E., Tsiang, M., White, K. L., Callebaut, C., Miller, M. D. A cell-based strategy to assess intrinsic inhibition efficiencies of HIV-1 reverse transcriptase inhibitors. Antimicrobial Agents and Chemotherapy. 59, (2), 838-848 (2015).
  13. Bishop, K. N., Verma, M., Kim, E. Y., Wolinsky, S. M., Malim, M. H. APOBEC3G inhibits elongation of HIV-1 reverse transcripts. PLoS Pathogens. 4, (12), 1000231 (2008).
  14. Zack, J. A., Haislip, A. M., Krogstad, P., Chen, I. S. Incompletely reverse-transcribed human immunodeficiency virus type 1 genomes in quiescent cells can function as intermediates in the retroviral life cycle. Journal of Virology. 66, (3), 1717-1725 (1992).
  15. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of Virology. 59, (2), 284-291 (1986).
  16. Shah, V. B., Aiken, C. In vitro uncoating of HIV-1 cores. Journal of Visualized Experiments. (57), (2011).
  17. JoVE Science Education Database. Science Education Database: Basic Methods in Cellular and Molecular Biology: Passaging Cells. Journal of Visualized Experiments. (2018).
  18. JoVE Science Education Database. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology: Using a Hemocytometer to Count Cells. Journal of Visualized Experiments. (2018).
  19. Zhou, M. Y., Gomez-Sanchez, C. E. Universal TA cloning. Current Issues in Molecular Biology. 2, (1), 1-7 (2000).
  20. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  21. Mangeat, B., et al. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature. 424, (6944), 99-103 (2003).
  22. Gillick, K., et al. Suppression of HIV-1 infection by APOBEC3 proteins in primary human CD4(+) T cells is associated with inhibition of processive reverse transcription as well as excessive cytidine deamination. Journal of Virology. 87, (3), 1508-1517 (2013).
  23. Harris, R. S., et al. DNA deamination mediates innate immunity to retroviral infection. Cell. 113, (6), 803-809 (2003).
  24. Zhang, H., et al. The cytidine deaminase CEM15 induces hypermutation in newly synthesized HIV-1 DNA. Nature. 424, (6944), 94-98 (2003).
  25. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  26. Troutt, A. B., McHeyzer-Williams, M. G., Pulendran, B., Nossal, G. J. Ligation-anchored PCR: a simple amplification technique with single-sided specificity. Proceedings of the National Academy of Sciences of the United States of America. 89, (20), 9823-9825 (1992).
  27. Zhelkovsky, A. M., McReynolds, L. A. Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase - engineering a thermostable ATP independent enzyme. BMC Molecular Biology. 13, (24), (2012).
  28. Li, T. W., Weeks, K. M. Structure-independent and quantitative ligation of single-stranded DNA. Analytical Biochemistry. 349, (2), 242-246 (2006).
  29. Gansauge, M. T., et al. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase. Nucleic Acids Research. 45, (10), 79 (2017).
  30. Ding, Y., Kwok, C. K., Tang, Y., Bevilacqua, P. C., Assmann, S. M. Genome-wide profiling of in vivo RNA structure at single-nucleotide resolution using structure-seq. Nature Protocols. 10, (7), 1050-1066 (2015).
Bepalende 3'-Termini en sequenties van ontluikende Single-Stranded virale DNA moleculen tijdens HIV-1 Reverse transcriptie in geïnfecteerde cellen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).More

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter