Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Genetics

Bestemme 3-Termini og sekvenser av begynnende Single-strandet virus-DNA molekyler i HIV-1 reversere transkripsjon i infiserte celler

doi: 10.3791/58715 Published: January 30, 2019

Summary

Her presenterer vi en dyp sekvensering tilnærming som gir en objektiv bestemmelse av begynnende 3-termini samt mutational profiler av enkelt-strandet DNA molekyler. Hovedprogrammet er karakterisering av begynnende retroviral komplementære DNAs (cDNAs), intermediates generert under prosessen med retroviral omvendt transkripsjon.

Abstract

Overvåking av nukleinsyre mellomprodukter under virus replikering gir innsikt i effekter og virkningsmekanismer av antivirale forbindelser og verten celle proteiner i viral DNA-syntese. Her adresse vi mangel på en cellebasert, høy-dekning og høy oppløsning analysen som kan definere retroviral omvendt transkripsjon mellomprodukter fysiologiske kontekst av smitte. Metoden beskrevet fanger de 3-termini begynnende komplementære DNA (cDNA) molekyler i HIV-1-infiserte celler single nukleotid oppløsning. Protokollen innebærer høsting av hele celle DNA, målrettet anriking av viral DNA via hybrid fange, adapter hemorroider, størrelse fraksjoneres av gel rensing, PCR forsterkning, dyp sekvensering og dataanalyse. Avgjørende er effektiv og upartiske ligation av adapter molekyler å åpne 3-DNA termini. Beskrevet påføringsmetode bestemmer overflod av omvendt transkripsjoner av hver bestemt lengde i et gitt utvalg. Det gir også informasjon om (intern) sekvens variasjon i omvendt utskrifter og dermed alle potensielle mutasjoner. Generelt er analysen egnet for spørsmål knyttet til DNA 3-utvidelse, forutsatt at malen sekvensen er kjent.

Introduction

Det kreves mellomprodukter for å analysere og forstå viral replikasjon fullt, stadig mer raffinerte teknikker som fange replikering. Spesielt den nøyaktige definisjonen av viral nukleinsyre arter innen rammen av infiserte celler kan gi ny innsikt, siden mange viral replikasjon mekanismer har hittil vært undersøkt i isolert i vitro reaksjoner. Et godt eksempel er prosessen omvendt transkripsjon i retroviruses, som humant immunsviktvirus 1 (HIV-1). De ulike trinnene av HIV-1 omvendt transkripsjon, der viral enzymet revers transkriptase (RT) kopierer én-strandet RNA genomet til double-strandet DNA, har vært studert i primer forlengelsen analyser med renset proteiner og nukleinsyre syrer1,2,3,4,5. Mens grunnleggende prinsipper ble etablert slike analyser inkorporere ikke alle virus og cellulære komponenter og gjenspeiler kanskje ikke biologisk relevante stoichiometries involvert faktorer. Derfor designet vi en kraftfull teknikk for å bestemme spektra av omvendt transkripsjon mellomprodukter med presise cDNA 3-termini (dvs. å bestemme sin nøyaktige lengder) og nukleotid sekvenser i sammenheng med infeksjoner av levende celler6. Innsamling av data fra tid kurs eksperimenter kan brukes til å sammenligne profilen til transkripsjoner under ulike tilstander, som antivirale molekyler eller proteiner, som kan påvirke effektiviteten og processivity av DNA-syntese og akkumulering. Dette gir en mer detaljert forståelse av naturlige patogen levetid, som ofte er grunnlaget for målrettet narkotika design og vellykket terapeutisk intervensjon.

HIV-1 omvendt transkripsjon består av en rekke påfølgende hendelser initiert av avspenning av en tRNA primer genomisk RNA malen, som deretter utvidet av RT å produsere en kort enkelt-strandet cDNA transkripsjon kalt en sterk minus-strand stopp (-sss) (se Figur 1). Deretter - sss cDNA overføres fra 5'-lang terminalen gjenta (VTH) til den 3-LITERS av den genomisk der det anneals og serverer som primer for fortsatt RT mediert forlengelse av minus strand DNA (se anmeldelser på omvendt transkripsjon1 , 2 , 3 , 4). denne første strand overføringen er ett av trinnene hastighetsbegrensning omvendt transkripsjon; Derfor er - sss cDNA kjent for å akkumulere. Grunnleggende arbeidsflyt og biblioteket design å fange omvendt transkripsjon produktene i infiserte celler er skissert i figur 2a. Den spesifikke primere og analyse innstillinger som brukes i protokollen og oppført i tabell 1 målrette alle tidlig reversere transkripsjon cDNA mellomprodukter innen lengden av 23 til ~ 650 nt, som inkluderer 180-182 nt - sss DNA. Imidlertid kan riktig mindre tilpasninger til strategi ikke bare sent omvendt transkripsjon produkter, men også andre virus og systemer, der målet er å oppdage 3-OH inneholder DNA ender. Viktige begrensninger å inkludere lengdeintervall på sluttproduktet PCR i biblioteket; spesielt vil maler som avstanden mellom adapteren på den åpne 3-terminalen og oppstrøms primer området overskrider ~ 1000 nt trolig være mindre effektivt sekvensert, potensielt innføre villedende tekniske biases under bibliotek forberedelse ( se diskusjon om mere detaljene og tilpasning forslag).

Tidligere har rapporterte teknikker for systematisk fastsettelse av 3-termini av nukleinsyre tråder fokusert på RNA, ikke DNA, molekyler. Et eksempel er 3 rase (rask forsterkning av cDNA slutter)7, som baserer seg på polyadenylation av mRNA. I tillegg ble adapter hemorroider-baserte strategier ansette RNA ligases utviklet, som har inkludert RLM-løp (RNA ligase-mediert rase)8 eller BLONDER (hemorroider-baserte forsterkning av cDNA slutter)9. Det er viktig å understreke at hemorroider-baserte amplifications er følsomme for skjevheter introdusert av hemorroider reaksjonen selv. For eksempel kan hemorroider være mer eller mindre effektivt avhengig av en bestemt nucleotide i 3 posisjon, sekvens, totalt molekyl lengde eller lokale struktur. Slike ligase innstillinger føre til ufullstendig erobringen av molekyler og feilaktig fremstilling i avlesning, som vi og andre har observert9,10. For å minimere ligation bias under adapter tillegg trinnene i protokollen beskrevet her, vi testet en rekke ligation strategier og funnet ut bruk av T4 DNA ligase med en hairpin single-strandet DNA adapter (som beskrevet av Kwok et al. 11) være den eneste prosedyren med nær kvantitative ligation som ikke har resultert i betydelige forskjeller i ligation effektivitet når vurderes med en spesielt valgt kontroll oligonucleotides6. Valg av denne ligation strategien er derfor en viktig funksjon i suksessen til denne protokollen.

Hittil overvåking av HIV-1 RT progresjon i infiserte celler er primært oppnådd ved å måle omvendt transkripsjon produkter av ulike lengde med kvantitative PCR (qPCR) med primer-sonden sett som unikt måle kortere eller lengre (tidlig og sent, henholdsvis) cDNA produkter12,13,14. Denne qPCR er riktig å bestemme iboende effektivitet av omvendt transkripsjon cellulær systemer, er utgangen relativt lav oppløsning, med ingen oppstartsrekkefølgen er avledet. Vår nye tilnærming, basert på optimalisert adapter hemorroider, PCR-mediert biblioteket generasjon og dyp sekvensering adresser teknologigapet og en mulighet til å overvåke omvendt transkripsjon i HIV-1 smitte kvantitativt og single nukleotid oppløsning.

Vi har illustrert nytten av denne metoden i en studie som skilles mellom to foreslåtte modeller for kapasiteten av HIV-1 begrensning faktor APOBEC3G (apolipoprotein B mRNA redigering enzym katalytisk polypeptid-lignende 3G) å forstyrre med den produksjon av viral omvendt transkripsjoner6.

Protocol

Merk: Se Tabell for materiale for bestemte reagenser og utstyr som brukes i denne protokollen.

1. virus produksjon og celle infeksjon

FORSIKTIG: Smittsomme HIV-1 bør bare behandles i godkjent biosikkerhet containment laboratorier.

Merk: Produksjon av HIV-1 partikler av forbigående transfection av menneskelige embryonale nyre (HEK) 293T celler, som beskrevet i trinn 1.1, er en standard prosedyre og har vært beskrevet tidligere15,16. De generelle cellekultur prosedyrer er beskrevet tidligere17.

  1. HIV-1 virus produksjon.
    1. Opprettholde 293T celler i Dulbeccos endret Eagle medium (DMEM) med 10% fosterets bovin serum (FBS) og 1% penicillin/streptomycin (full DMEM) i en standard celle kultur inkubator på 37 ° C og 5% CO2 som beskrevet tidligere17.
    2. I en standard laminær strømning vev kultur hette fjerne veksten mediet og legge 3 mL forvarmes (37 ° C) trypsin til en nær confluent 10 cm celle kultur parabol (~1.2 x 107 celler) av 293T celler. Sett rett tilbake i inkubator for 2-3 minutter.
    3. Ta parabolen settefiskanlegg tilbake vev kultur panseret og legge 7 mL av full medium. Pipetter opp og ned i parabolen flere ganger til resuspend cellene. Dele cellene 1:4 legger til 2,5 mL av cellen suspensjon i en ny 10 cm rett og fyll den med 7,5 mL av full medium.
    4. Neste dag, bland 10 µg av proviral HIV-1 plasmider DNA (som pNL4.3) med 1 mL av serum-free minimal viktig middels og legge polyethylenimine (PEI) løsning (25 000 mW, 1 mg/mL pH 7) på 4,5 µL per 1 µg DNA. Inkuber i 10 min på RT og legge dropwise til 293T cellene.
    5. 24 timer etter transfection, fjerne mediet og erstatte den med 6 mL av full DMEM som inneholder RNase-gratis DNase på 20 U/mL medium. Etter 6 h og erstatt medium med 10 mL av hele DMEM.
    6. 48 timer etter transfection, høste nedbryting og filtrere det gjennom 0.22 µm filter, bruker en 10 mL sprøyte, inn i et 15 mL polypropylen rør.
    7. Legg 2 mL steril 20% sukrose i 1 x fosfat bufret saltvann (PBS) til en åpen tynnvegget ultracentrifuge tube. Sakte overlegg sukrose med filtrerte cellen supernatant.
    8. Sentrifuge for 1t 15 min 134,000 x g på 4 ° C ved hjelp av en ultracentrifuge.
    9. Fjern rørene fra ultracentrifuge nøye. Sakte tar av både nedbryting og sukrose bruker en sugekraft eller en pipette. Bruke en mindre pipette og tilt røret når du tar den siste sucrose løsningen ut. La pelleted viruset i bunnen av røret.
      Merk: Pellet vil ikke være synlig.
    10. Legge til 200 µL av 1 x PBS, la i kjøleskapet i 4 til 12 h, resuspend og fryse i 20 µL dele på-80 ° C.
    11. Avgjøre p24kneble innhold bruker den en p24 HIV-1 antigen ELISA kit (følgende produsentens instruksjoner).
  2. T-celle linje infeksjon.
    1. Kultur en udødeliggjort T-celle linje (f.eks., CEM-SS celler) i Roswell Park Memorial Institute (RPMI) 1640 medium med 10% FBS og 1% penicillin/streptomycin (full RPMI). Telle celler med en hemocytometer18 og frø 1 per eksempel 1 mL av full RPMI med 2 x 106 celler/mL i en 12-vel format celle kultur plate.
    2. Legge til HIV-1 partikler tilsvarende 150 ng p24kneble og Plasser platen i en svingende sentrifuge bøtte med biocontainment lokk spin-infisere med sentrifugering i en Borstemmaskin centrifuge for 2t 2000 x g på 30 ° C.
    3. Fjern plate fra sentrifuge og la den hvile 1t i en standard vev kultur inkubator på 37 ° C og 5% CO2.
    4. For å vaske av input virus, samle celler ved overføring av cellen suspensjon til microcentrifuge rør og sentrifugering i en microcentrifuge på RT (RT) på 500 x g i 2 minutter. Ta av nedbryting uten å forstyrre det cellen pellet.
    5. Resuspend celle pellets i 1 mL av forvarmes (37 ° C), sterile 1 x PBS. Gjenta sentrifugering, supernatant fjerning og rørets trinn to ganger.
    6. Sentrifuge igjen, fjerne nedbryting og resuspend celle pellets i 1 mL av hele RPMI. Legge til hver suspensjon i en brønn i en ny 12 godt plate.
    7. På 6 h etter første tillegg av virus (4 h etter sentrifugering), høste celler med sentrifugering som gjort i trinn 1.2.4. Fjerne og slette nedbryting. Cellen pellets kan fryses på-80 ° C eller behandlet direkte for DNA utvinning.

2. DNA utvinning, HIV-1 DNA kvantifisering og berikelse av Hybrid fange

  1. Pakk ut hele celle DNA med en blod og vev totale DNA utvinning kit etter kit manualen for vev kultur celler. Den eneste forandringen er elueringsrør i 200 µL nuclease-gratis t2O i stedet for den angitte elueringsbufferen.
    Merk: Etter tillegg av chaotropic lyseringsbuffer (utstyrets "AL buffer") og proteinasen, prøver kan fjernes fra biosikkerhet containment laboratoriet og håndteres i et standard sikkerhet nivå laboratorium for resten av protokollen.
  2. Bestemme kopien antall HIV-1 cDNA ved qPCR.
    1. Ta 17 µL av eluate fra trinn 2.1 og legge 2 µL 10 x begrensning enzym bufferen med 1 µL av DpnI begrensning enzym. Inkuber 1t på 37 ° C fjerne alle potensielle gjenværende input plasmider DNA fra transfection.
    2. Utføre qPCR for minus-strand sterk-stop cDNA med følgende primer sonde sett: oHC64 (5 '-taactagggaacccactgc-3) og oHC65 (5 '-gctagagattttccacactg-3) og sonde oHC66 (5 '-FAM-acacaacagacgggcacacacta-TAMRA-3). qPCR oppsett og eksakte forholdene kan finnes i referanser6,13. Bære med prøver med en seriell fortynning av pNL4.3 proviral plasmider som en standard kurve å bestemme kopi antall cDNA molekyler.
      Merk: Se diskusjon for forventet antall.
  3. HIV-1 DNA berikelse av hybrid fange.
    Merk: Dette trinnet frem er det best å bruke microcentrifuge rør med lav nukleinsyre bindingsegenskapene samt aerosol filter pipette tips for alle DNA prøver. Hvis mulig, arbeide i et PCR-arbeidsstasjon. Alle trinnene og reagenser er på RT (RT) med mindre annet er oppgitt.
    1. Pipetter 100 µL perler per prøve for å forberede en master blanding av magnetiske streptavidin perler, i en enkelt microcentrifuge tube. Sett røret på en magnet egnet for microcentrifuge rør.
    2. Etter perlene har utlignet mot magnet røret (~ 1 min), ta av lagring buffer, fjerne røret fra magneten og resuspend perler i 500 µL av bind og vaske bufferen (BW buffer, 5 mM Tris-HCL pH 7.5 0,5 mM EDTA 1 M NaCl) å vaske.
    3. Sett røret på magnet, fjerne nedbryting og legge til 500 µL kasein løsning. Ta av magneten, resuspend og ruge i 10 min på RT, deretter vaske med BW buffer.
      Merk: En vask refererer til å plassere røret på magnet, tar av nedbryting, tar røret av magneten, legge til bufferen og resuspending.
    4. Plassere rør tilbake på magnet, ta av nedbryting og resuspend perler i 500 µL BW bufferen. Legge til 50 pmol av hver fange biotinylated oligonucleotides (se tabell 1, tre oligos i dette tilfellet) per prøve. (For eksempel hvis 5 DNA-prøver skal behandles, bruk 500 µL av magnetiske perler fra trinn 2.3.1 og 250 pmol av hver oligonucleotide).
    5. Inkuber i 30 min på RT mens rock i en over-gjennomgående mikser.
    6. Vask perler med de immobilisert oligonucleotides to ganger med 500 µL 1 x ti bufferen (10 mM Tris HCl pH 8.0, 1 mM EDTA, 100 mM NaCl).
    7. Resuspend perler i 10 µL av 1 x ti buffer per prøve.
    8. For hver prøve merke en microcentrifuge tube og tilsett 10 µL av perler suspensjon, 170 µL av DNA (fra trinn 2.1) og 90 µL av 3 x ti buffer. Inkuber i en tørr blokk ved 92 ° C i 2 minutter å denature DNA.
    9. Flytte rør i et annet tørr varme, som er satt til 52 ° C, og Inkuber for 1 h. Inverter å blande regelmessig (~ hvert 10 min) under denne inkubasjon.
    10. Vask en gang med 500 µL av 1 x ti buffer og resuspend i 35 µL nuclease-fri H2O.
    11. For å elute, ruge rør ved 92 ° C i en tørr blokk i 2 minutter. Deretter flytter raskt rør på magnet (en tube samtidig). Når perler er bundet ved siden av røret, overføre nedbryting med HIV-1 DNA slik frisk.
    12. Valgfritt: Gjenta qPCR (som gjort i trinn 2.2.2) til å fastslå den gjenopprettede HIV-1-cDNA.
      Merk: Se diskusjon for forventet antall.

3. adapter Ligation

  1. Forbereder adapteren
    1. Resuspend lyofilisert adapter (se tabell 1 "full Kwok + MiSeq") på 100 µM i nuclease-fri H2O.
    2. Per eksempel pluss én kontroll prøven, kombinere 0,45 µL av 10 x T4 DNA ligase buffer, 4 µL av adapter og 0,05 µL nuclease-gratis t2O. varme 92 ° c i 2 minutter og la hver kjøle ned sakte.
      Merk: Hvis alternativet er tilgjengelig bruke en PCR-maskin med justerbar kjøling rente (bruk 2% rente). Dette tar ca 30 min fra 92 ° C til 16 ° C. Alternativt kan du bruke en tørr blokk ved 92 ° C og slå. Ta adapter mastermix ut når den varme er tilbake på RT. Dette er å la adapteren danne en hårnål struktur (se figur 2b).
  2. Forberede en kontroll reaksjon med en rekke syntetisk oligonucleotides (se tabell 2) i stedet for DNA utvunnet fra celler.
    1. Gjøre bestander av 100 µM av hver oligonucleotide. Bland 1 µL av hver av de 17 oligonucelotides og tilsett 8 µL av H2O for et ekvimolare forhold i et siste volum på 25 µL.
    2. Fortynne blanding 1:2,500 i nuclease-fri H2O i en seriell fortynning. Kombiner 1 µL av miksen med 17.3 µL nuclease-gratis t2O til bruk i kontroll prøven hemorroider i trinn 3.3.1 slik at hver oligonucleotide finnes på 1,6 fmol (tilsvarende 0.026 nM i 60 µL reaksjonen).
  3. Definere ligations
    1. For 60 µL siste bindet reaksjoner i PCR rør kombinere 6 µL av 10 x T4 DNA ligase buffer, 24 µL av 40% PEG, 6 µL av 5 M betaine, 4,5 µL (400 pmol) av adapter (pre-annelead som i trinn 3.1.2), 1,2 µL av T4 DNA ligase (2.000.000 enheter/mL) og 18.3 µL av DNA (fra Trinn 2.3.11)
      Merk: Ta spesiell bekymre med tyktflytende løsninger som 40% PEG å opprettholde nøyaktig volumer. Gjør ikke en mastermix.
    2. Definere samme reaksjon som utført i trinn 3.3.1 men med kontroll oligonucleotide blandingen i trinn 3.2.2.
    3. Bland reaksjoner godt og ruge i en PCR maskin på 16 ° C over natten.

4. adapter fjerning og størrelse separasjon

  1. Denaturing gel geleelektroforese
    1. Legge til 30 µL av formamide inneholder DNA gel lasting hver ligatur reaksjon-buffer. Bland godt av pipettering.
    2. Varme i 2 minutter på 94 ° C i PCR maskin, deretter umiddelbart lagt på is.
    3. Plass en precast 6% Tris/borate/EDTA (TBE) denaturing urea polyakrylamid gel (10-og kam) i en passende gel tank. Legge til 1 x TBE (89 mM Tris-base, 89 mM borsyre, 2 mM EDTA) kjører buffer og pre kjøre gel for 20 min på 250 V/max konstant.
    4. Bleke gel lommer med kjører buffer med en sprøyte og 21G pinnen.
    5. Last hver 90 µL prøve i tre brønner (30 µL per brønn) og kjører for 20 min (250 V/maks) til mørk blå farge foran er halvveis gjennom gel.
  2. Beising og kutte nukleinsyrer fra gel
    1. Klargjør 3 små microcentrifuge rør (0,5 mL) per prøve ved poking hull i bunnen med en 21 G sprøyte nål (ta forsiktig mens du arbeider med kryss). Hver av de forberedt rør inn en 2.0 mL microcentrifuge rør og merke dem med eksempel navn plus "lavt", "midten" eller "høy".
    2. Ta ut og lirke åpne gel kassetten. Kuttet gel vertikalt med et barberblad til sjenerøst avgiftsdirektoratet strip med 3 brønnene lastet prøvene. Legg gel stripen til en beholder med 1 x TBE (ca 30 mL) og 5 µL av cyanine nukleinsyre flekken. Inkuber for 3-5 minutter.
      NOTE Det gel utvinning trinnet er spesielt følsomme for kryssforurensning. Det anbefales å bare kjøre 1 vareprøve per gel og bruke en separat, ren beholder for hver gel flekker. Hansker må endres hvis gelépartikler kontakter hansker fingre.
    3. Rengjøre overflaten på et blått lys transilluminator grundig med ddH2O. Gel brikken ut av beholderen flekker og legge den til lyset boksen.
    4. Slå på lyset boksen og inspisere farget nucleic syrer gjennom oransje filteret.
      Merk: Adapteren vanligvis vises overbelastet og kjører som store "blob" med samskrevet HIV-1 DNA kjører over som en strek.
    5. Bruke en ny barberblad, kuttet bort sidene av gel hvis det er områder med ingen prøve lastet fremdeles. Deretter skjær like over adapteren fjerne adapteren og lavere gel deler. Til slutt kuttet bort toppen av gel inkludert ca 1 mm av gel lommer, som ofte har en skarp intens signal av høyere molekylvekt DNA.
    6. Deles den gjenstående gel inneholder utvalget, er vanligvis ~ 2 x 3 cm i størrelse, horisontalt i tre selv biter: "lavt", "midten" og "høy" molekylvekt områder.
      Merk: Hver nå håndteres separat [dvs., det blir tre rør (lav, midt og høy)] per opprinnelige prøven.
    7. Skjær hver av de tre gel i mindre biter (~ 2 x 2 mm partikler) og overføre dem til prepped 0,5 mL microcentrifuge rør (trinn 4.2.1).
    8. Spinne i full fart med åpne lokk for 1 min å presse gel bitene gjennom hullet i 2 mL røret for å opprette en gel slaps. Hvis gelépartikler forblir i bunnen av 0,5 mL tube, overføre dem til 2 mL røret manuelt med en nål eller pipette tips.
  3. DNA utvinning
    1. Legge til 1 mL av urea gel utvinning buffer (0,5 M NH4lm3CO2, 1 mM EDTA, 0,2% SDS) gel slaps. Rotere rør for minimum 3 h (over natten er akseptabelt) på RT med en over-gjennomgående mikser.
    2. Bruke ren pinsett legge ett lite runde glass fiber filter til sentrifuge kolonner med celluloseacetat membran filtre (0,2 µm), som forhindrer membran tilstopping. Sette filteret på plass med en invertert pipette tips.
    3. Kort spinn 2 mL rør med gel slaps og utvinning buffer i en microcentrifuge og overføre 700 µL nedbryting av til kolonnene forberedt filter. Holde gel slaps og gjenværende nedbryting.
    4. Virvel filter kolonnene i en microcentrifuge i full fart i 1 overføring av flowthrough til en ny 2.0 mL microcentrifuge tube.
    5. Reload kolonnene med gjenværende nedbryting. Prøv å få så mye som mulig fra utvinning slaps. Overføring av gel er ikke en bekymring. Spinn igjen og kombinerer flowthroughs av samme utvinning prøvene.
  4. DNA nedbør
    1. Legge 3 µL av polyA RNA (1 µg/µL; som bærer), 1 µL av glykogen og 0,7 mL isopropanol til flowthrough fra trinn 4.3.5. Vortex kort og Frys på-80 ° C over natten.
    2. Ta prøver av-80 ° C fryseren og la dem tine kort. Sett dem i en avkjølt (4 ° C) microcentrifuge og spinn for 30 min i full fart.
    3. Fjerne og slette nedbryting. Vær svært forsiktig ikke for å fjerne pellet. La 30 til 50 µL av hvis det er usikkert at pellet fjernes ellers.
      Merk: Vanligvis alle "høy" prøver viser mer synlig pellets enn "midten" og "lav".
    4. Legge til 800 µL av 80% etanol. Invertere rør og spinn igjen for 1 min i full fart. Fjerne meste av etanol med en pipette, kort spin rør igjen og fjerne mer etanol med en mindre volum pipette.
    5. La noen gjenværende etanol fordampe ved å plassere rør med en åpne lokket til en 55 ° C tørr. Når prøvene er tørr (2-4 min) legge til 20 µL nuclease-gratis t2O og spredt rundt bunnen av røret for å sikre DNA-pellets er oppløst. DNA-prøve kan lagres på 20 ° C.

5. PCR forsterkning og biblioteket forberedelse

  1. Sette opp en 40 µL PCR reaksjon med 20 µL av DNA polymerase pre-mix, 18 µL av politi og redissolved DNA fra trinn 4.4.5, 1 µL av fremover primer "MP1.0 + 22HIV" (10µM) (se tabell 1), og 1 µL av multiplex oligo primere (indeks primere 1 til 24) (se tabell av Ma materialer).
    Merk: Kjøre tre reaksjoner (lav, mid, high) av hvert utvalg i separate PCR reaksjoner, men med samme indeksert primer. Bruk en annen indeks for hver av det opprinnelige infeksjon prøvene.
    1. Kjøre PCR reaksjoner under følgende betingelser: 2 min på 94 ° C rødsprit, så 18 sykluser av 3-trinns PCR; 15 er på 94 ° C rødsprit, 15 s annealing 55 ° C og 30 s utvidelse på 68 ° C.
  2. Som et alternativ for kvalitetskontroll, analysere PCR reaksjoner med høy følsomhet automatisert gel geleelektroforese system. Ta 2 µL av en lav, midt og høy prøve på produsentens instruksjoner.
    Merk: To primere skal være synlige og ofte kjøres i en beregnet lengde på om 45 og 95 nt (faktiske lengden varierer). I tillegg DNA skal oppdages mellom 150 til 500 nt. Hvis det ikke er noe signal anbefales det å legge til ekstra PCR sykluser, mellom 2 og 10 flere sykluser. Ikke Legg til ekstra sykluser for oligonucleotide kontroll prøvene opprettet i trinn 3.3.2.
  3. Hvis du vil fjerne bruker primerne et spinn perle-baserte PCR rydde opp system.
    1. Ta 20 µL av hver PCR reaksjon og basseng prøvene sammen (blande alle prøvene på dette punktet). Fryse resterende 20 µL reaksjonene som sikkerhetskopier på 20 ° C.
    2. La spinn perlene kommer til RT og bland gruppert PCR reaksjonene med 1,8 x volumet av perle løsningen. Blande av pipettering og ruge i 5 min.
      Merk: Som et eksempel, hvis 4 prøver var forberedt og hver har lav, midt og høy reaksjoner, volumet ville være 4 x 3 x 20 µL = 240 µL PCR reaksjoner med en 432 µL perle løsning.
    3. Satte rørene på en microcentrifuge tube magnet, la perlene binder i ~ 1 min, og ta av nedbryting forkaste. La rørene på magneten og legge 500 µL av 80% etanol.
    4. La etanol for 30 s, deretter ta av grundig og la perler airdry for ~ 5 min. legge 40 µL nuclease-gratis t2O, ta rør av magneten og Pipetter opp og ned flere ganger.
    5. La suspensjon for 5 min. sette tuben tilbake på magnet, la perlene avgjøre til side, og overføre nedbryting til en ny tube. Dette er biblioteket. Ta en 10 µL aliquot for kvalitetskontroll og fryse resten på 20 ° C.

6. vurdere biblioteket

  1. Bestemme biblioteket kvaliteten, konsentrasjon og molarity.
    1. Bruke en fluorometric kvantifisering metode. Mål 1 µL og 3 µL av biblioteket med en høy følsomhet dsDNA analysen kit henhold til produsentens instruksjoner.
      Merk: Typisk konsentrasjoner er mellom 1 og 10 ng/µL.
    2. Mål biblioteket DNA molekylvekt spekteret av høy følsomhet automatisert gel geleelektroforese som beskrevet ovenfor (trinn 5.2).
    3. Bruk den automatiserte gel geleelektroforese analyse for å fastslå den gjennomsnittlige Molekylvekten av biblioteket og beregne for å fortynne biblioteket i nuclease-fri H2O til 4 nM. Flere biblioteker kan kombineres som alle indekser er unike.
  2. Valgfri lav overføringshastighet kvalitetskontroll
    1. Utsett DNET bibliotek for TA kloning19 å sette inn biblioteket molekyler i vektorer for forsterkning. Følg instruksjonene for utstyrets, vokser ut ~ 10-20 kolonier og ekstrakt DNA via miniprep protokoller, som beskrevet her20.
    2. Sekvensen vektor bruker lokale sekvensering tjenester og sjekk at skivene inneholder den ønskede HIV-1 avledet sekvenser og bibliotekspesifikke adaptere.

7. høy gjennomstrømming sekvensering kjøre

  1. Opprette en sekvensering sample ark med kommersielle programvaren med sekvensering plattformen.
    1. Angi den valgte sekvensering kit. Vanligvis velge en 150-syklus kit, men andre er egnet avhengig av ønsket Les lengden.
    2. Velg "Fastq" som programmet arbeidsflyten. Velg én av malene som inneholder 24 indeksene i den multiplex oligonucleotide kits (angitt i kit manuell).
    3. Velg "25 nt" for Read1 og "125 nt" for Read2. Behold 6 nt enkelt indeksen lese.
      Merk: Bare Read2 brukes i interne analyse i analysen. Holde Read1 på et minimum av 25 nt for sekvensering plattform algoritmen formål.
  2. Følg produsentens instruksjoner nøyaktig pre kjøre biblioteket forberedelser og oppsett. Velge maksimalt 20 pM konsentrasjon og bruk en 15% PhiX topp, som biblioteket er av svært lav kompleksitet.

8. analyse

  1. Sjekk Hvis pass filter prosent og gjennomsnittlig Q30 kvalitetspoeng aksepteres som sekvensering plattform produsentens retningslinjer.
    Merk: Pass filter er vanligvis > 90% Q30 score er vanligvis > 80%.
  2. Last ned den. fastq.gz filer fra produsentens sekvensering hub.
  3. Definere sekvensering skriptet
    1. Opprett en ny mappe kalt "AnalysisXYZ" og gå til https://github.com/malimlab/seqparse å laste ned alle kildekodefiler (parse_sam.pl, rc_extract.pl, parse.sh) i denne mappen.
    2. Last ned kort-lese aligner Bowtie, versjon 1.1.2, fra http://bowtie-bio.sourceforge.net/index.shtml i samme mappe.
    3. Nedlastingen oppretter en undermappe i "AnalysisXYZ" navnet "Bowtie-1.1.2". I denne katalogen åpne underkatalogen "indekser" og laste ned den angitte mal sekvenser som består av 6 filer med .ebwt.
    4. Last ned den FASTQ/A korte lest forhåndsbehandle toolkit fastx-0.0.13 fra http://hannonlab.cshl.edu/fastx_toolkit/download.html i mappen "AnalysisXYZ".
    5. Last ned både Samtools (https://sourceforge.net/projects/samtools/files/) og bam-readcount (https://github.com/genome/bam-readcount) til mappen "Dokumenter".
  4. Flytte den. fastq.gz filer lastet ned i trinn 8.2, alle lese 2s (slutter på... _R2_001.fastq.gz) i mappen "AnalysisXYZ".
  5. Åpne kommandoen konsollen/terminal. Gå til "AnalysisXYZ" som standardmappe bruke cd-kommandoer. Skriv "./parse.sh." for å kjøre skript.
  6. Finn CSV-filene med Sammendrag for alle utvalg på totalt Les teller, lengde justeres lese teller, og normaliserer Les teller, samt filer med base variasjonen, for hvert utvalg i en mappe kalt parse_results i mappen "Analyse XYZ".
    Merk: Se diskusjonen for ytterligere informasjon om analyseprosessen. Skriptet returnerer csv-filer med totalt leser for hver nucleotide langs HIV-1NL4.3 sterk-stop sekvenser og første strand overføring til nukleotid 635. Som en veiledning, er 50.000 til 100.000 unike leser vanligvis observert i utvalg fra infeksjoner med angitte cellen tallene og viral inocula og uten antiviral proteiner eller forbindelser. Oligonucleotide kontroll prøven produserer vanligvis 100.000 til 200.000 leser.

Representative Results

Teknikken er beskrevet i denne artikkelen ble brukt til en større studie å ta mekanismene bak hemming av HIV-1 omvendt transkripsjon av antiretroviral menneskelige protein APOBEC3G (A3G)6. Figur 3 viser representant resultatene etter ansette protokollen i prøver fra CEM-SS T-celler infisert med vif-mangelfull HIV-1 i fravær eller tilstedeværelse av A3G. Totalt antall unike leser innhentet fra hver prøve etter filtrere ut PCR like poster som har de samme 6 nt strekkoden og samme lengde (spilt av analyse programvaren) tegnes i Figur 3et. Økende nivåer av A3G redusere Les antall reflekterer den hemmende effekten av A3G på RT mediert cDNA syntese tidligere beskrevet og målt ved qPCR6,13,21,22. I Figur 3b, brøkdel av molekyler på hver mulig lengde i de første 182 nt vises. HIV-1 smitte i fravær av A3G, den mest tallrike arten er viktigste 180 nt sterk-stop molekyl, med noen akkumulering av lyder i kortere rekkevidde (23 til 40 nt) (topp grafen, blå histogrammer). Tillegg av A3G endringer denne profilen som en kraftig økning av kortere, avkortet cDNA molekyler på noen svært spesifikke, reproduserbare posisjoner er oppdaget (midterste og nedre grafer). Siden A3G er en cytidine deaminase, cytosine til uridine (identifisert som C-til-T) oppstår mutasjoner i cDNA når A3G finnes i infisere virions21,23,24. Bruke informasjon innhentet sekvensering, prosenten av C-til-T mutasjoner var tegnet inn i samme diagram (rød stiplet linje). Det bør bemerkes at mutational profilen er avledet fra alle unike leser kombinert og dekning av hver nucleotide vil variere. Men hvis oppstartsrekkefølgen kan være knyttet til hvert molekyl og korrelert med en bestemt 3-terminus. Oppgitt ble tatt fra Pollpeter et al. 6 og sammenhengen mellom mutational og cDNA lengde profiler ble vist for å være gjenkjenning og spalting av deaminated cDNA av mobilnettet DNA-reparasjon maskiner.

En positiv kontroll for 3-kartlegging tilnærming kan lett bli produsert av en pool av syntetisk oligonucleotides kjente sekvens, lengde og konsentrasjon. Denne kontrollen er lagt på adapter hemorroider i trinn 3.3.2 og rådet skal inkluderes i alle multiplex biblioteker. Data fra en kontroll prøven burde ha alle oligonucleotides til de forventede input prosenter, med bare svært små bakgrunn leser. Figur 4 viser resultatene av positiv kontroll 17 kjemisk syntetisk oligonucleotides (se tabell 2for sekvenser,), som ble blandet på ekvimolare prosenter. Som forventet, vises alle molekyler i nærheten lik overflod med kun små variasjoner (øverste diagram). Mens de fleste stillinger innen - sss DNA sekvensen som ikke er representert med en oligonucleotide returnerer null Les teller, observerte vi mindre arter som er 1 eller 2 nt kortere enn de faktiske kontrollen oligonucleotides. Vi har ikke videre undersøkt disse mindre arter, men antar at de representerer degradert eller ufullstendig produkter potensielt tilstede i de angitte oligonucleotide på kjøp (oligonucleotides bestilt som HPLC renset, som den produsenten angir > 80% renhet). Bunnen grafen viser kontroll prøven fra et annet bibliotek kjører, der variasjon er litt høyere mellom 17 oligonucleotides og korrelerer med lengde i at lengre kontroll molekyler oppdages mer effektivt og kortere seg. Dette kan skyldes en mindre bias i PCR reaksjoner eller i klynger under MiSeq sekvenser, som har en sett inn størrelse optimal oppstå med biblioteker bærer spesielt bred sett inn områder. En enkel måte å takle denne skjevhet er anvendelsen av en normalisering faktor basert på skråningen som indikerer partiskhet samkjøre molekyl lengde (rosa linje). De nødvendige beregningene er inkludert i analyseprogrammet (se trinn 8.3 i protokollen).

Figure 1
Figur 1: Diagram som viser de første trinnene i HIV-1 reversere transkripsjon. Prosessen starter med annealing av tRNA(Lys,3) (oransje) til primer binding området (PBS) i den genomisk viral RNA (trinn 1), som tillater initiering og forlengelse av viral cDNA (blå, trinn 2). Samtidig, er mal genomisk RNA nedverdiget ved RNaseH aktivitet RT (trinn 3). Det første full mellomliggende under omvendt transkripsjon er minus-strand sterk-stopp (-) sss cDNA, som er komplett når RT katalysert polymerisasjon når 5'-endestasjonen til gRNA gjenta (R) regionen (trinn 3). (-) Sss mellomliggende overføres til 3-endestasjonen til malen for genomisk RNA av avspenning til utfyllende terminal 3-lang gjenta (VTH) R regionen. Herfra fortsetter polymerisasjon (trinn 4). I metoden beskrevet bestemmes omvendt transkripsjon progresjon ved å tilordne den nøyaktige lengden på den gryende viral cDNA (blå). PPT, polypurine skrift; U5, unike 5-sekvens; U3, unike 3-sekvens. Dette tallet er publiseres fra en tidligere publikasjon6. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Arbeidsflyt disposisjon og skjematisk av kortet ligatur og PCR forsterkning strategi. (a) arbeidsflyt skisserte hovedtrinn av beskrevet teknikken å finne 3-termini i HIV-1 omvendt utskrifter i infiserte celler. Figuren er tilpasset fra en tidligere publikasjon6. (b) skjematisk adapter ligatur og PCR forsterkning strategi. Begynnende cDNA molekyler av varierende lengde som har blitt renset i trinnene er samskrevet til en enkelt-strandet DNA adapter med T4 DNA ligase. Hårnål-adapter (kalt "full Kwok + MiSeq", se tabell 1) design var inspirert av Kwok et al. 11. adapteren bærer en tilfeldig 6 nt strekkode rekkefølge, som gir base-sammenkobling for å lette ligatur og samtidig fungerer som en identifikator for unike lyder. 3-jernbanestasjonen termini av adapteren bærer en avstand (SpC3) for å hindre selv hemorroider. Samskrevet produkter er separert fra overflødig adapter denaturing polyakrylamid gel geleelektroforese (side). Nukleinsyrer i gel er farget og kuttet i tre separate, like store gel biter i området ovenfra adapteren til brønnen som i25. Etter elueringsrør, nedbør og rørets, produktene er PCR forsterket med primere annealing til den kjente serie av adapteren (primer 1, multiplex oligonucleotide kit, se Tabellen for materiale) og en primer bærer de første 22 nt av HIV-1 5'-LTR sekvens umiddelbart etter tRNA (primer 2, MP1.0 + 22HIV). 5'-jernbanestasjonen termini valgte primerne bære adaptere for valgte sekvensering plattformen (P5 og P7) samt en indeks sekvens å skille enkelte eksempler i samme bibliotek. Startpunkt for sekvensering lese primere angis. Den blå boksen angir regionen rundt å bestemme de opprinnelige 3-termini i fanget molekylet. Dette tallet er tilpasset fra en tidligere publikasjon6. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Representant resultater. (a) Les antallet representative utvalg behandlet med beskrevet protokollen. Dette inkluderer alle sekvenser som ble identifisert som unik leser av HIV-1 molekyler med deres 3-termini innen de første 635 nt av minus tråd cDNA (opp til PPT, se figur 1). Infeksjon med HIV-1 ikke bærer A3G gir flest leser, mens A3G hemmer cDNA syntese og dermed reduserer totalen antall leste. Infisert celler var en negativ kontroll, mens en rekke syntetisk oligonucleotides gir en positiv kontroll. b) den relative overfloden av cDNAs for hver lengde mellom nt posisjoner 23 og 182 (full lengde - sss cDNA er 180 til 182 nt) av HIV-1-NL4.3 sekvens (x-aksen) vises i blå histogrammer (skala på den venstre y-aksen). Den relative overfloden av cDNA ble beregnet fra absolutte antallet sekvenser avslutning på en gitt nucleotide i - sss cDNA sekvensen delt på summen av alle leser måle 182nt eller mindre. Stiplede røde linjer vises prosentandelene av lyder bærer C-til-T/U mutasjoner i respektive posisjon (skala på høyre y--aksen). Figur 3 b publiseres fra en tidligere publikasjon6. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 : Representant resultatene av kontroll prøver. Vises to profiler for bassenger som inneholder ekvimolare mengder 17 forskjellig lengde syntetiske oligonucleotides. Disse oligonucleotides har sekvenser fra HIV-1NL4.3 og ble valgt til å dekke ulike lengder og presentere alle 4 baser som en 3-nukleotid (se tabell 2). Den øverste grafen viser positive kontroll prøven fra Figur 3et. Det registreres ingen betydelig fordommer mot molekyl lengde eller åpne 3-jernbanestasjonen termini. Bunnen grafen viser et annet bibliotek kjører, som produserte en mindre lengde skjevhet i sekvenser. I dette tilfellet anbefales det å bruke en normalisering faktor, som er avledet fra bakken (vist i rosa) som representerer størrelsen bias. Dette tallet er publiseres fra en tidligere publikasjon6. Klikk her for å se en større versjon av dette tallet.

Oligo navn Lengde i nt Sekvens Formål Produsent (rensing)
full Kwok + MiSeq 61 5'-PHO-tgaagagcctagtcgctgttcannnnnnctgcccatagagagatcggaagagcacacgtct-SpC3-3 " Adapter IDT DNA teknologier (HPLC)
2xBiotin SS agn 40 5'-biotin-cagtgtggaaaatctctagcagtggcgcccgaacagggac-biotin-3 " Hybrid fange MWG Eurofins (HPLC)
Biotin 1-16 ss 22 5-cagtgtggaaaatctctagcag-BiTEG-3 " Hybrid fange MWG Eurofins (HPLC
Biotin tRNA + CTG 16 5-cagtggcgcccgaaca-BITEG-3 " Hybrid fange MWG Eurofins (HPLC)
MP1.0 + 22HIV 82 5-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatctcactgctagagattttccacactg-3 " PCR forsterkning MWG Eurofins (HPLC

Tabell 1: tabell med oligonucleotides inkludert lengde, sekvenser og endringer som benyttes i beskrevet protokollen. Tabellen er tilpasset fra en tidligere publikasjon6Klikk her for å laste ned denne tabellen som en excel-fil.

Oligo navn Lengde i nt Sekvens Produsent (rensing)
HTP con lang C 120 5-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaagc-3 " MWG Eurofins (HPLC)
HTP con lang G 119 5-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaag-3 " MWG Eurofins (HPLC)
HTP con lang T 116 5-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggctt-3 " MWG Eurofins (HPLC)
HTP con lang A 118 5-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagctttattgaggcttaa-3 " MWG Eurofins (HPLC)
HTP con midt C 76 5-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcac-3 " MWG Eurofins (HPLC)
HTP con midt G (a) 71 5-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacg-3 " MWG Eurofins (HPLC)
HTP con midt G (b) 72 5-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgg-3 " MWG Eurofins (HPLC)
HTP con midt A 69 5-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacaga-3 " MWG Eurofins (HPLC)
HTP con midt T 85 5-ctgctagagattttccacactgactaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactt-3 " MWG Eurofins (HPLC)
HTP con kort A 40 5-ctgctagagattttccacactgactaaaagggtctgaggga-3 " MWG Eurofins (HPLC)
HTP con kort T 33 5-ctgctagagattttccacactgactaaaagggt-3 " MWG Eurofins (HPLC)
HTP con kort G 41 5-ctgctagagattttccacactgactaaaagggtctgaggg-3 " MWG Eurofins (HPLC)
HTP con kort C 34 5-ctgctagagattttccacactgactaaaagggtc-3 " MWG Eurofins (HPLC)
HTP Con 46 (T) 46 5-ctgctagagattttccacactg actaaaagggtctgagggatctct-3 " MWG Eurofins (HPLC)
HTP Con 83 (C) 83 5-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactac-3 " MWG Eurofins (HPLC)
HTP Con 103 (C) 103 5-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagc-3 " MWG Eurofins (HPLC)
HTP Con 107 (A) 107 5-ctgctagagattttccacactg actaaaagggtctgagggatctctagttaccagagtcacacaacagacgggcacacactactttgagcactcaaggcaagcttta-3 " MWG Eurofins (HPLC)

Tabell 2: tabell med 17 syntetiske kontroll oligonucleotides som en positiv kontroll prøven. Top 13 oligonucleotides ble valgt basert på størrelse [lang (116 til 120 nt), mid (69 til 85 nt), kort (33 til 41 nt)] og deres 3-termini. Tabellen er tilpasset fra en tidligere publikasjon6.  Klikk her for å laste ned denne tabellen som en excel-fil.

Discussion

Tilgjengeligheten av rask, pålitelig og kostnadseffektiv dyp sekvensering har revolusjonert mange aspekter innen biovitenskap, slik at stor dybde i sekvensering-baserte analyser. En gjenværende utfordring ligger innovative design og etablering av representant sekvensering biblioteker. Her beskriver vi en protokoll for å fange nye viral cDNA molekyler, spesielt intermediates av HIV-1 omvendt transkripsjon prosessen.

Det viktigste trinnet i denne strategien er ligation av en adapter til åpne 3-jernbanestasjonen termini i en kvantitativ og objektiv måte. Effektiviteten av ligations mellom to ssDNA termini, både blant- og intramolekylære, har blitt undersøkt og optimalisert for ulike programmer11,26,27,28,29. Valget mellom å bruke en hårnål adapter med T4 DNA ligase under forholdene som er beskrevet i trinn 3.3 er empirisk optimeringen der vi vurdert forskjellige ligases, adaptere og reagensene ligation av syntetisk oligonucleotides representerer HIV-1 sekvenser (tabell 2) (data ikke vist). I disse i vitro test reaksjoner bekreftet vi at T4 DNA ligase mediert ligation av hårnål-adapter, som beskrevet av Kwok et al. 11, har en svært lav bias, og oppnår nær fullstendig ligation av acceptor molekyler når adapteren brukes i overkant. Hemorroider effektiviteten var upåvirket av tillegg av nukleotid sekvens gjengi adapteren kompatibel for multiplex primer systemet (se Figur 4). I sammenligning fant vi at en thermostable 5' DNA/RNA ligase ("Ligase A", se Tabellen for materiale for nøyaktig ligases forhold her), som er en konstruert RNA-ligase som ble utviklet i en del å forbedre ligation effektivitet med ssDNA som acceptor 27, var faktisk mer effektiv på ligating to ssDNA molekyler enn RNA ligase (Ligase B"), men hadde en betydelig skjevhet, med sterk forskjeller i ligation effektivitet mellom oligonucleotides med enkelt base lengde forskjeller [tabell 2 ; HTP con midt G (a) og (b)]. Videre vi fant bare en minimal skjevhet i reaksjoner med "Ligase C" kombinert med en adapter bærer en randomisert 5'-termini (en strategi brukes til offset kjent nukleotid skjevhet av "Ligase C", se for eksempel Ding et al. 30). imidlertid "Ligase C"-mediert intermolekylære ligations var ufullstendig, rendering T4 DNA ligase systemet et bedre valg.

Flere kvalitetskontroll trinn over kurset av protokollen og inkludering av positive og negative kontroller tillater påvisning av potensielle problemer før analysen videreføring og gir retningslinjer for feilsøking. QPCR quantifications i trinn 2.2.2 og 2.3.12 Kontroller at mengden materiale som inndata er tilstrekkelig. Typisk cDNA kopi tall i 200 µL elueringsrør (fra trinn 2.1) varierer fra rundt 10.000 til 300.000 per µL. Hybrid fange trinnet kan resultere i tap av generelle HIV-1 cDNA antall men skal resultere i en sterk anriking av bestemte HIV-1 cDNA over mobilnettet DNA, som kan bestemmes ved hjelp av riktig primer for å kvantifisere genomisk DNA før og etter berikelse av qPCR eller ved å måle totale DNA konsentrasjon. Gjenopprettede HIV-1 cDNA når hybrid tatt skritt bør være minst 10% av input. Lav starter materiale kan ellers forklare en vellykket oligonucleotide positive kontroll (se trinn 3.3.2) men bare begrenset leser i prøvene. Lav lese tall samlet kan også forklares med overvurdering av biblioteket konsentrasjonen på grunn av tilstedeværelsen av irrelevante DNA uten MiSeq adaptere. Dette resulterer i lav klynge tetthet kan forbedres ved å bestemme konsentrasjonen av HIV-1 sekvenser i biblioteket av qPCR i tillegg til totalbeløpet DNA av fluorometric analyser. På grunn av svært følsomme natur metoden, bør forsiktighet tas å unngå selv lavnivå forurensning, både fra andre prøver (spesielt fra høy konsentrasjon kontroll oligonucleotide aksjer) samt fra laboratorieutstyr. Arbeider i en UV sterilisering PCR arbeidsstasjon er gunstig i denne forbindelse. Den automatiserte gel geleelektroforese av siste biblioteket (trinn 6.1.2) er et ytterligere kvalitetskontroll mål. Nukleinsyre størrelse området vanligvis observert er mellom 150 til 500 nt. primer som kan oppdages i valgfri kontrollen etter at PCR og før rensing (se merknad i trinn 5.2) skal nå være borte. Representant følge eksemplet intensitet kurven har en topp rundt 160-170 nt og en andre skarpere topp rundt 320-350 nt. Dette sannsynligvis gjenspeiler ofte sett høyere overflod både relativt kort (1 til 20 nt sett inn lengde) omvendt utskrifter og full lengde sterk-stop (180 til 182 nt sett inn lengde) (Figur 3b).

Mens presentert protokollen og valgte primere er spesifikke for tidlig HIV-1 omvendt transkripsjon konstruksjoner, er metoden generelt gjelder noen studier å bestemme åpne 3-termini DNA. De viktigste endringene som kreves i andre sammenhenger blir metoden for hybrid fangst og primer utformingen strategi. For eksempel hvis målet skal tilpasses slutten HIV-1 transkripsjoner, et større antall forskjellige fange biotinylated oligonucleotides annealing over lengden på cDNA ville være tilrådelig og vil trolig redusere tap i hybrid fange trinn. Som nevnt i innledningen, er det viktig å vurdere begrensninger når du utformer området som 3-termini skal oppdages for å unngå forskjellige kilder skjevhet. Først kan det være en skjevhet i PCR reaksjonene, hvis malene med adapteren er svært varierende lengde. Andre sekvensering plattformen brukes her (f.eks MiSeq) har en foretrukket sett inn lengdeintervall for optimal klynger, og betydelig kortere og lengre produkter kan ikke være sekvensielt med samme effektivitet. Delvis dette kan rettes beregningsmessig, som ble gjort ved å beregne en korrigeringsfaktoren for lineær lengde bias (se Figur 4nederste diagram). Men hvis området der 3-termini kartlegging er ønsket er lang (> 1000 nt), det er mer fornuftig å dele reaksjonene med ligated utskrifter og bruke flere oppstrøms primere for å vurdere 3-termini i deler.

Analyseprogrammet ble skrevet internt for spesifikke formål å analysere både den siste nukleotid av HIV-1 sekvensen ved fast adapter sekvensen og base variasjonen av alle baser for å identifisere eventuelle mutasjoner. De individuelle trinnene omfatter følgende: først adapter sekvensene er trimmet med fastx-0.0.13-toolkit; så, noen sekvenser dupliserte (som betyr identiske sekvenser inkludert strekkoden) er fjernet. Alle gjenværende unike leser justeres deretter til HIV-1 sekvensen med Bowtie (http://bowtie-bio.sourceforge.net/index.shtml) maksimal misforholdet satt på tre baser. Malen sekvensen består av de første 635 nt av HIV-1 cDNA (NL4.3 press), som inkluderer - sss sekvensen og det første strand overføre produktet til polypurine spor (U5-R-U3-PPT, se figur 1). Dermed er den medfølgende programvaren og maler bare egnet hvis metoden brukes til det samme programmet (gjenkjenning av tidlig omvendt transkripsjoner av HIV-1NL4.3). Justeringer må gjøres for andre målet sekvenser. Plasseringen av de 3-termini for hver leseoperasjon ble fastsatt av plasseringen i justeringen. Base samtaler for hver posisjon registreres og mutasjon priser beregnes fra totale dekningen av hver base, som varierer, leser er forskjellige lengder og lange innlegg kan ikke være helt dekket av 125-base-sekvenser i Read2.

For å konkludere, tror vi metoden beskrevet å være et verdifullt verktøy for mange typer studier. Åpenbare programmer omfatter undersøkelser av mekanismene bak omvendt transkripsjon hemming gjennom antiretrovirale medisiner eller cellular begrensning faktorer. Bare relativt mindre justeringer bør imidlertid være nødvendig å tilpasse systemet til 3-termini kartlegging i andre single-strandet DNA viral mellomprodukter, som er til stede, for eksempel i parvovirus replikering. Videre, prinsippet om metoden spesielt sin optimalisert ligation skritt, kan gi en sentral del av biblioteket forberedelse design for karakterisering av noen 3-DNA utvidelser, inkludert videreutvikling katalysert av mobilnettet double-strandet DNA polymerases.

Disclosures

Forfatterne erklærer at de ikke har noe å avsløre.

Acknowledgments

Forfatterne bekrefter støtte fra medlemmer av Malim laboratorium, Luis Apolonia, Jernej Ule og Rebecca Oakey. Forfatterne takker Matt Arno ved King's College London Genomic Centre og Debbie Hughes ved University College London (UCL), Institutt for Nevrologi neste generasjons sekvensering anlegget, hjelp med MiSeq sekvensering kjører. Arbeidet ble støttet av den britiske Medical Research Council (G1000196 og MR/M001199/1 mm), Wellcome Trust (106223/Z/14/Z til mm), EU-kommisjonens syvende rammeprogram (FP7/2007-2013) gi avtalen ingen. PIIF-GA-2012-329679 (til DP), og Department of Health via en nasjonale institutter for helse forskning omfattende Biomedical Research Center prisen til guys og St. Thomas' NHS Foundation Trust i samarbeid med King's College London og kongens College Hospital NHS Foundation Trust.

Materials

Name Company Catalog Number Comments
293T cells ATCC CRL-3216
Dulbecco's Modified Eagle's Medium Gibco 31966-021
Penicillin/Streptomycin Gibco 15150-122
Fetal Bovine Serum Gibco 10270-106
HeraCell Vios 250i CO2 Incubator Thermo Scientific 51030966
Laminar flow hood - CAS BioMAT2 Wolflabs CAS001-C2R-1800
10mm TC-treated culture dish Corning 430167
TrypLE™ Express (1x), Stable Trypsin Replacement Enzyme Gibco 12605-010
OptiMEM® (Minimal Essential Medium) Gibco 31985-047
HIV-1 NL4-3 Infectious Molecular Clone (pNL4-3) NIH Aids reagent program 114
Polyethylenimine (PEI) - MW:25000 PolySciences Inc 23966-2 dissolved at 1mg/ml and adjusted to pH7
RQ1- Rnase free Dnase Promega M6101
Filter 0.22 μm Triple Red Limited FPE404025
15 mL polypropylene tubes Corning CLS430791
Sucrose Calbiochem 573113
Phosphate Buffered Saline (1x) Gibco 14190-094
Ultracentrifuge tubes Beckman Coulter 344060
Ultracentrifuge Sorval WX Ultra Series Th-641 Rotor
Alliance HIV-1 p24 antigen ELISA kit Perkin Elmer NEK050001KT
CEM-SS cells NIH Aids reagent program 776
Roswell Park Memorial Institute Medium Gibco 31870-025
CoStar® TC treated multiple well plates Corning CLS3513-50EA
Benchtop centrifuge: Heraus™ Multifuge™ X3 FR Thermo Scientific 75004536
TX-1000 Swinging Bucket Rotor Thermo Scientific 75003017
Microcentrifuge: 5424R Eppendorf 5404000060
Total DNA extraction kit (DNeasy Blood and Tissue kit) Qiagen 69504
Nuclease free H2O Ambion AM9937
Cutsmart buffer New England Biolabs (part of DpnI enzyme) R0176S
DpnI restriction enzyme New England Biolabs R0176S
Oligonucleotides for qPCR MWG Eurofins N/A HPSF purification
TaqMan PCR Universal Mastermix Thermo 4304437
LoBind Eppendorf® tubes Eppendorf 30108078
Axygen™ aerosol filter pipette tips, 1000 μL Fisher Scientific TF-000-R-S
Axygen™ aerosol filter pipette tips, 200 μL Fisher Scientific TF-200-R-S
Axygen™ aerosol filter pipette tips, 20 μL Fisher Scientific TF-20-R-S
Axygen™ aerosol filter pipette tips, 10 μL Fisher Scientific TF-10-R-S
PCR clean hood LabCaire Model PCR-62
DynaMag™2-magnet Thermo 12321D
Streptavidin MagneSphere® paramagnetic particles Promega Z5481
Casein Thermo Scientific 37582
End over end rotator, Revolver™ 360° Labnet H5600
Tris-Base Fisher Scientific BP152-5
Hydrochloric Acid Sigma H1758-100ML
EDTA disodium salt dihydrate Electran (VWR) 443885J
Sodium Chloride Sigma S3014
Dri-Block® Analog Block Heater Techne UY-36620-13
PCR tubes and domed caps Thermo Scientific AB0266
PCR machine Eppendorf Mastercycler® series
T4 DNA ligase New England Biolabs M0202M
40% Polyethylene glycol solution (PEG) in H2O, MW: 8000 Sigma P1458-25ML
Betaine solution, 5M Sigma B0300-1VL
Gel loading buffer II (formamide buffer) Thermo Scientific AM8546G
Precast 6% TBE urea gels Invitrogen EC6865BOX
Mini cell electrophoresis system Invitrogen, Novex XCell SureLock™
Tris/Borate/EDTA solution (10x) Fisher Scientific 10031223
Needle 21 G x1 1/2 VWR 613-2022
SYBR Gold nucleic acid stain (10000x) Life Technologies S11494
Dark Reader DR46B transilluminator Fisher Scientific NC9800797
Ammonium acetate Merck 101116
SDS solution 20% (w/v) Biorad 161-0418
Centrifuge tube filter Appleton Woods BC591
Filter Glass Fibre Gf/D 10mm Whatman (VWR) 512-0427
polyadenylic acid (polyA) RNA Sigma 10108626001
Glycogen, molecular biology grade Thermo Scientific R0561
Isopropanol (2-propanol) Fisher Scientific 15809665
Ethanol, molecular biology grade Fisher Scientific 10041814
Accuprime™ Supermix I (DNA polymerase premix) Life Technologies 12342-010
NEBNext® Multiplex Oligo for Illumina (Index Primer Set 1 and 2) New England Biolabs E7335S; E7500S
Tapestation D1000 Screentape High sensitivity Agilent Technologies 5067- 5584
Tapestation D1000 Reagents Agilent Technologies 5067- 5585
2200 Tapestation - automated gel electrophoresis system Agilent Technologies G2965AA
Agencourt® AMPure® beads XP Beckman Coulter A63880
Qubit™ dsDNA HS Assay Kit Invitrogen Q32851
Qubit™ 2.0 Fluorometer Invitrogen Q32866
Topo™ TA cloning Kit Invitrogen 450071
Sequencing platform: MiSeq System Illumina
Experiment Manager (Sample sheet software) Illumina Note: Use TruSeq LT as a template
Miseq™ Reagent kit V3 (150 cycle) Illumina MS-102-3001
Sequencing hub: Basespace Illumina https://basespace.illumina.com
Ligase A: Thermostable 5’ App DNA/RNA ligase NEB M0319S Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase B: T4 RNA ligase 1 NEB M0204 Not used in this protocol, but tested in optimization process with results described in the discussion.
Ligase C: CircLigase Epicentre CL4111K Not used in this protocol, but tested in optimization process with results described in the discussion.

DOWNLOAD MATERIALS LIST

References

  1. Herschhorn, A., Hizi, A. Retroviral reverse transcriptases. Cellular and Molecular Life Sciences. 67, (16), 2717-2747 (2010).
  2. Hu, W. S., Hughes, S. H. HIV-1 reverse transcription. Cold Spring Harbor Perspectives in Medicine. 2, (10), (2012).
  3. Levin, J. G., Mitra, M., Mascarenhas, A., Musier-Forsyth, K. Role of HIV-1 nucleocapsid protein in HIV-1 reverse transcription. RNA Biology. 7, (6), 754-774 (2010).
  4. Menendez-Arias, L., Sebastian-Martin, A., Alvarez, M. Viral reverse transcriptases. Virus Research. (2016).
  5. Telesnitsky, A., Goff, S. P. Retroviruses. Coffin, J. M., Hughes, S. H., Varmus, H. E. (1997).
  6. Pollpeter, D., et al. Deep sequencing of HIV-1 reverse transcripts reveals the multifaceted antiviral functions of APOBEC3G. Nature Microbiology. 3, (2), 220-233 (2018).
  7. Frohman, M. A., Dush, M. K., Martin, G. R. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proceedings of the National Academy of Sciences of the United States of America. 85, (23), 8998-9002 (1988).
  8. Liu, X., Gorovsky, M. A. Mapping the 5' and 3' ends of Tetrahymena thermophila mRNAs using RNA ligase mediated amplification of cDNA ends (RLM-RACE). Nucleic Acids Research. 21, (21), 4954-4960 (1993).
  9. Ince, I. A., Ozcan, K., Vlak, J. M., van Oers, M. M. Temporal classification and mapping of non-polyadenylated transcripts of an invertebrate iridovirus. Journal of General Virology. 94, Pt 1 187-192 (2013).
  10. Hafner, M., et al. RNA-ligase-dependent biases in miRNA representation in deep-sequenced small RNA cDNA libraries. RNA. 17, (9), 1697-1712 (2011).
  11. Kwok, C. K., Ding, Y., Sherlock, M. E., Assmann, S. M., Bevilacqua, P. C. A hybridization-based approach for quantitative and low-bias single-stranded DNA ligation. Analytical Biochemistry. 435, (2), 181-186 (2013).
  12. Abram, M. E., Tsiang, M., White, K. L., Callebaut, C., Miller, M. D. A cell-based strategy to assess intrinsic inhibition efficiencies of HIV-1 reverse transcriptase inhibitors. Antimicrobial Agents and Chemotherapy. 59, (2), 838-848 (2015).
  13. Bishop, K. N., Verma, M., Kim, E. Y., Wolinsky, S. M., Malim, M. H. APOBEC3G inhibits elongation of HIV-1 reverse transcripts. PLoS Pathogens. 4, (12), 1000231 (2008).
  14. Zack, J. A., Haislip, A. M., Krogstad, P., Chen, I. S. Incompletely reverse-transcribed human immunodeficiency virus type 1 genomes in quiescent cells can function as intermediates in the retroviral life cycle. Journal of Virology. 66, (3), 1717-1725 (1992).
  15. Adachi, A., et al. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of Virology. 59, (2), 284-291 (1986).
  16. Shah, V. B., Aiken, C. In vitro uncoating of HIV-1 cores. Journal of Visualized Experiments. (57), (2011).
  17. JoVE Science Education Database. Science Education Database: Basic Methods in Cellular and Molecular Biology: Passaging Cells. Journal of Visualized Experiments. (2018).
  18. JoVE Science Education Database. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology: Using a Hemocytometer to Count Cells. Journal of Visualized Experiments. (2018).
  19. Zhou, M. Y., Gomez-Sanchez, C. E. Universal TA cloning. Current Issues in Molecular Biology. 2, (1), 1-7 (2000).
  20. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  21. Mangeat, B., et al. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts. Nature. 424, (6944), 99-103 (2003).
  22. Gillick, K., et al. Suppression of HIV-1 infection by APOBEC3 proteins in primary human CD4(+) T cells is associated with inhibition of processive reverse transcription as well as excessive cytidine deamination. Journal of Virology. 87, (3), 1508-1517 (2013).
  23. Harris, R. S., et al. DNA deamination mediates innate immunity to retroviral infection. Cell. 113, (6), 803-809 (2003).
  24. Zhang, H., et al. The cytidine deaminase CEM15 induces hypermutation in newly synthesized HIV-1 DNA. Nature. 424, (6944), 94-98 (2003).
  25. Konig, J., et al. iCLIP--transcriptome-wide mapping of protein-RNA interactions with individual nucleotide resolution. Journal of Visualized Experiments. (50), (2011).
  26. Troutt, A. B., McHeyzer-Williams, M. G., Pulendran, B., Nossal, G. J. Ligation-anchored PCR: a simple amplification technique with single-sided specificity. Proceedings of the National Academy of Sciences of the United States of America. 89, (20), 9823-9825 (1992).
  27. Zhelkovsky, A. M., McReynolds, L. A. Structure-function analysis of Methanobacterium thermoautotrophicum RNA ligase - engineering a thermostable ATP independent enzyme. BMC Molecular Biology. 13, (24), (2012).
  28. Li, T. W., Weeks, K. M. Structure-independent and quantitative ligation of single-stranded DNA. Analytical Biochemistry. 349, (2), 242-246 (2006).
  29. Gansauge, M. T., et al. Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase. Nucleic Acids Research. 45, (10), 79 (2017).
  30. Ding, Y., Kwok, C. K., Tang, Y., Bevilacqua, P. C., Assmann, S. M. Genome-wide profiling of in vivo RNA structure at single-nucleotide resolution using structure-seq. Nature Protocols. 10, (7), 1050-1066 (2015).
Bestemme 3-Termini og sekvenser av begynnende Single-strandet virus-DNA molekyler i HIV-1 reversere transkripsjon i infiserte celler
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).More

Pollpeter, D., Sobala, A., Malim, M. H. Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells. J. Vis. Exp. (143), e58715, doi:10.3791/58715 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter