Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Generation von Krebs Zellklonen Telomeric Repeat-haltigen RNA TERRA von einem einzigen Telomere in lebenden Zellen ausgedrückt zu visualisieren

doi: 10.3791/58790 Published: January 17, 2019

Summary

Hier präsentieren wir ein Protokoll, um Krebs Zellklonen mit einem MS2 Sequenz Beschriftung auf einer einzigen Produktlinie zu generieren. Dieser Ansatz, unter Berufung auf das MS2-GFP-System ermöglicht die Visualisierung der endogenen Abschriften der telomeric Repeat-haltigen RNA (TERRA) von einem einzigen Telomere in lebenden Zellen ausgedrückt.

Abstract

Telomere sind transkribiert telomeric Repeat-haltigen lange forensisches RNAs (TERRA), verursachend, die sind vorgeschlagen worden, eine wichtige Rolle in der Telomere Biologie, einschließlich Heterochromatin Bildung und Telomere Länge Homöostase spielen. Neue Erkenntnissen zufolge TERRA Moleküle auch mit inneren chromosomalen Regionen zur Regulierung der Genexpression in Mauszellen embryonaler Stammzellen (ES) interagieren. Im Einklang mit dieser Beweis RNA Fluoreszenz in Situ Hybridisierung (RNA-Fisch) Analysen haben gezeigt, dass nur eine Teilmenge von TERRA Abschriften an Chromosomenenden lokalisieren. Ein besseres Verständnis der Dynamik von Molekülen TERRA hilft, ihre Funktion und Wirkmechanismen zu definieren. Hier beschreiben wir eine Methode zum Beschriften und Single-Telomere TERRA Transkripte in Krebszellen mit dem MS2-GFP-System zu visualisieren. Zu diesem Zweck präsentieren wir ein Protokoll, um stabile Klone zu erzeugen mit Hilfe der AGS menschlichen Magen Krebs Zell-Linie mit MS2 Sequenzen zu einer einzigen Produktlinie integriert. Transkription von TERRA von MS2-Tags Telomere ergibt sich in der Expression von MS2-Tags TERRA-Moleküle, die durch live-Cell-Fluoreszenz-Mikroskopie auf Co Ausdruck ein MS2-RNA-bindende Protein mit GFP (MS2-GFP) verschmolzen visualisiert werden. Dieser Ansatz ermöglicht es Forschern, die Dynamik des Single-Telomere TERRA Moleküle in Krebszellen zu studieren, und es kann auf andere Zelllinien angewendet werden.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die lange nichtcodierender RNA-TERRA ist aus der Region subtelomerischen Chromosomen transkribiert und seine Transkription verläuft in Richtung der Chromosomenenden, beendet in der telomeric repeat Trakt1,2. Aus diesem Grund TERRA Abschriften bestehen aus subtelomeric stammenden Sequenzen an ihrem 5'-Ende und beenden mit telomeric Wiederholungen (UUAGGG bei Wirbeltieren)3. Wichtige Rollen vorgeschlagen worden für TERRA, einschließlich Heterochromatin Bildung Telomere4,5, DNA-Replikation6, Förderung der homologen Rekombination zwischen Chromosom7,8 endet , 9, Regulierung der Telomere Struktur10und Telomere Länge Homöostase2,11,12,13. Darüber hinaus interagieren TERRA Transkripte mit zahlreichen Extratelomeric Websites, weit verbreitete Genexpression in Maus embryonaler Stammzellen (ES) Zellen14zu regulieren. Im Einklang mit diesen Beweis, RNA Fluoreszenz in Situ Hybridisierung (RNA-Fisch) Analysen haben gezeigt, dass nur eine Teilmenge der TERRA Transkripte lokalisieren Telomere1,2,15. Darüber hinaus wurde TERRA Form nuklearen Aggregate Lokalisierung auf der X und Y Chromosomen in Maus Zellen2,16berichtet. Diese Ergebnisse zeigen, dass TERRA Transkripte komplexe Dynamik innerhalb des Zellkerns zu unterziehen. Verständnis der Dynamik von Molekülen TERRA wird dazu beitragen, ihre Funktion und Wirkmechanismen zu definieren.

Das MS2-GFP-System hat verbreitet, RNA-Moleküle in lebenden Zellen aus verschiedenen Organismen17,18zu visualisieren. Dieses System hat früher zu markieren und zu visualisieren Single-Telomere TERRA Moleküle in S. Cerevisiae12,19. Mit diesem System vor kurzem zeigte sich, dass Hefe TERRA Transkripte lokalisieren innerhalb des Zytoplasmas während der Phase der Post-Diauxic-Schicht darauf hindeutet, dass TERRA extranuclear Funktionen20ausüben kann. Wir haben vor kurzem MS2-GFP-System verwendet, um Single-Telomere TERRA Transkripte in Krebs Zellen21zu studieren. Zu diesem Zweck wir beschäftigt die CRISPR/Cas9-Genom-editing-Tool, MS2 Sequenzen an ein einzelnes Telomer (Telomere 15q, im folgenden Tel15q) zu integrieren und erhalten Klone MS2-Tags endogenen Tel15q TERRA (TERRA-MS2 Klone) zum Ausdruck zu bringen. Co Ausdruck ein GLP-verschmolzen MS2-RNA-bindende Protein (MS2-GFP), das erkennt und bindet MS2-RNA Sequenzen ermöglicht Visualisierung von Single-Telomere TERRA Transkripte in lebenden Zellen21. Das hier abgebildete Protokoll soll für die Generation von TERRA-MS2 Klonen erforderlichen Schritte im Detail zu beschreiben.

Um TERRA-MS2 Klone zu erzeugen, ist eine MS2 Kassette innerhalb der subtelomerischen Region der Telomere 15q, integriert der TERRA Promotor Region und Transkription Startsite nachgeschaltet. Die MS2-Kassette enthält eine Neomycin-Resistenz-Gen von Lox-p Seiten flankiert, und seine Integration in die Produktlinie 15q erfolgt über CRISPR/Cas9 System22. Nach Transfektion von der MS2 Kassette, einzelnen Klone ausgewählt sind und subtelomerischen Integration der Kassette wird verifiziert durch PCR, DNA Sequenzierung und Southern blot. Positive Klone sind mit einem Cre exprimierenden Adenovirus infiziert, um die Auswahlmarkierung in der Kassette entfernen nur MS2 Sequenzen und eine einzelne Lox-p vor Ort bei der Produktlinie 15q verlassen. Ausdruck der MS2-Tags TERRA Abschriften von Tel15q wird von RT-qPCR überprüft. Zu guter Letzt drückt sich die MS2-GFP Fusionsprotein in TERRA-MS2 Klone über retroviralen Infektion um MS2-TERRA Transkripte von Fluoreszenzmikroskopie sichtbar zu machen. TERRA Transkripte von RNA-Fisch leicht nachweisbar und live Cell Imaging mit telomeric Repeat-spezifische Sonden1,2,15,23. Diese Ansätze liefern wichtige Informationen über die Lokalisation der Gesamtbevölkerung von TERRA Moleküle in einzelne Zelle Auflösung. Die Generation der Klone mit MS2 Sequenzen zu einer einzigen Produktlinie ermöglicht es Forscher studieren die Dynamik des Single-Telomere TERRA Transkripte in lebenden Zellen, die helfen die Funktion und die Mechanismen der Wirkung von TERRA zu definieren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Auswahl von Neomycin resistente Klone

  1. Wachsen Sie AGS-Zellen in Ham es F-12_K (Kaighn) Medium ergänzt mit 10 % fetalen Bovine Serum (FBS), 2 mM L-Glutamin, Penicillin (0,5 Einheiten pro mL Medium) und Streptomycin (0,2 µg pro mL Medium) bei 37 ° C und 5 % CO2. Die Zellen mit einem 50-60 % Zusammenfluss mit dem SgRNA/Cas9 mit dem Ausdruck Vektor und der MS2-Kassette auf eine 01:10 transfizieren Molverhältnis21.
    Hinweis: In einer parallelen Programmierung überprüfen Sie Transfektion Effizienz durch transfecting einen GLP-mit dem Ausdruck Vektor (d. h. Cas9-GFP Vektor). Mindestens 60 %-70 % Transfektion Effizienz erreicht werden sollte.
  2. Ersetzen Sie am folgenden Tag, die Kultivierung Medium mit Neomycin bei 0,7 µg/mL Endkonzentration (selektive Mittel)-haltigem Medium.
    Hinweis: Die Zellen teilen und säen sie im selektiven Medium am Tag nach der Transfektion der Auswahlprozess beschleunigt wird. Alle nicht-transfizierten Zellen werden sofort sterben. Transfektion in 6-well-Platten erfolgt, wobei jedes gut 60 % würde Zusammenfluss ca. 0,7 x 106 Zellen am Folgetag enthalten, die die Zellen aus einem einzigen Brunnen zu einem 10 cm Schüssel mit selektiven Medium aufgeteilt werden können.
  3. Halten die Zellen im selektiven Medium für 7-10 Tage ändern jedes Mediums oder zwei Tage, bis einzelne Klone sind sichtbar.
  4. Kommissionierung von Zellklonen
    1. Bereiten Sie 96-well-Platte, mit 10 µL 0.25 % Trypsin in jedes gut vor.
      Hinweis: Bereiten Sie zwei 96 Platten auch für den Fall, dass mehr als 96 Klone abgeholt werden sollen.
    2. Markieren Sie mit dem Einsatz eines Mikroskops die Position jeder Klon sichtbar in die 10 cm Teller indem man einen Punkt am unteren Rand der Schale mit einem Marker. Jeder Punkt entspricht einer Kolonie abgeholt werden.
    3. Ersetzen Sie die Kultivierung Medium mit gerade genug Phosphat gepufferte Kochsalzlösung (PBS) bilden einen dünnen Film von Flüssigkeit auf die Klone und nicht die Zellen während der Klon-Kommissionierung trocknen lassen.
    4. Wählen Sie einzelne Kolonien mit einer 10 µL Pipette. Befestigen Sie die Spitze mit 5 µL von Trypsin in die Kolonie und lassen Sie langsam Trypsin die lokalisierte auf die Kolonie bleiben los. Lassen Sie Trypsin zu trennen, die Zellen für 1 min, dann kratzen die Kolonie mit der Spitze in der Spitze saugen.
      Hinweis: Während dieses Vorgangs spiegeln die Schüssel ein bisschen auf der einen Seite so um das Volumen der PBS rund um die Kolonie gepflückt zu verringern den Kommissioniervorgang durch Verdünnen der Trypsin um die Kolonie zu vermeiden hilft. Mit einem Klon-Ring kann auch helfen, einzelne Klone abholen.
    5. Platzieren Sie die Zellen aus der Kolonie in einen Brunnen mit 10 µL 0.25 % Trypsin 96-well-Platte.
    6. Inkubieren Sie 5 min bei Raumtemperatur, dann füllen Sie den Brunnen mit 150 µL des selektiven Medium (Hams F - 12K (Kaighn) Mittel enthalten Neomycin bei und ergänzt mit 10 % FBS, 2 mM L-Glutamin, Penicillin (0,5 Einheiten pro mL Medium), Streptomycin (0,2 µg pro mL Medium) eine Konzentration von 0,7 µg/mL.
      Hinweis: Während der Inkubationszeit können andere Klone abgeholt werden. Es empfiehlt sich, möglichst viele Klone wie möglich auszuwählen. Die weitere Klone werden gepflückt, desto höher die Chancen der Identifizierung von positiven zu sein.
    7. Sobald alle Klone sind gepflückt und in der 96-well-Platte übertragen, können Sie die Zellen weiter für ein paar Tage in selektiven Medium Hams F - 12 K (Kaighn) Medium ergänzt mit 10 % FBS, 2 mM L-Glutamin, Penicillin (0,5 Einheiten pro mL Medium), Streptomycin (0,2 µg pro mL des Mediums) und mit Neomycin in einer Konzentration von 0,7 µg/mL bei 37 ° C und 5 % CO2, bis zum Zusammenfluss von 90 % erreichen.
  5. Spaltung der Klone
    1. Bereiten Sie drei 96 well-Platten beschichtet mit Gelatine durch Hinzufügen von 100 µL der Gelatine pro Bohrloch, 30 min bei Raumtemperatur inkubieren, dann zweimal mit PBS waschen. Diese Platten werden für die DNA-Extraktion (DNA-Platte) und Klon Einfrieren (einfrierende Platten) verwendet werden.
      Hinweis: Gelatine wird die Anlage der Zellen und der DNA in die Vertiefungen fördern. Die Gelatine-Beschichtung ermöglichen insbesondere die DNA zu kleben an der Unterseite der Brunnen während der DNA-Extraktion und Verfahren (siehe unten) zu waschen. Während das Klon-splitting-Verfahren empfiehlt es sich, eine Mehrkanal-Pipette verwenden.
    2. Einmal Klone erreichen 90 % Zusammenfluss, Aspirieren Medium aus jeder Quelle des 96-well-Platte, waschen mit PBS, 30 µL 0.25 % Trypsin pro Bohrloch hinzufügen und 5 min bei 37 ° c inkubieren
      Hinweis: Klone wachsen unterschiedlich schnell, die auch von der Anzahl der Zellen pro Klon nahm abhängen. Somit wird dieser Schritt während der mehrere Tage durchgeführt werden, wenn die anderen Klone Zusammenfluss von 90 % erreichen.
    3. Fügen Sie 70 µL des selektiven Medium pro Bohrloch hinzu, stören Sie Zelle Klumpen von oben und unten in die Vertiefungen Pipettieren zu, dann 30 µL 100 µL auf die verkleisterte DNA Platte vorausgefüllt mit 120 µL des selektiven Medium pro gut und 30 µL, die verkleisterte Einfrieren Platten vorgefüllten Witz h 50 µL Medium (ohne Markierung).
    4. Die DNA-Platte im Inkubator und lassen Sie die Zellen bei 37 ° C und 5 % CO2 bis 90 % Zusammenfluss wachsen.
    5. Fügen Sie 80 µL eiskalte frisch 2 x Medium (80 % FBS und 20 % Dimethyl Sulfoxid (DMSO)) Einfrieren gemacht in jede Vertiefung der eiskalte Platte, fügen Sie Parafilm (gespritzt mit 70 % Ethanol) auf die Platte so zu jedem Bohrloch zu versiegeln, setzen Sie den Deckel an der Spitze und die Platte mit Alu-Folie wickeln. Legen Sie die eisigen Platten bei-80 ° C.
    6. Die ursprünglichen 96-well-Platte mit der Klone, die wurden aufgeteilt und halten es in der Kultur bis zum PCR-screening Ergebnisse fügen Sie 90 µL des selektiven Medium pro Bohrloch hinzu. Diese Platte wird als Platte zur Sicherung verwendet werden.

2. screening von Neomycin resistente Klone

  1. DNA-Extraktion aus 96 well DNA-Platte.
    1. Sobald die Klone kultiviert in der DNA-Platte 90 % Zusammenfluss erreichen, 2 Mal mit PBS waschen, dann mit 50 µL-Lyse-Puffer (10 mM Tris pH 7,5, 10 mM EDTA, 10 mM NaCl, 0,5 % SDS und 1 mg/mL Proteinase K) lösen. Decken Sie die Platte mit Parafilm ab, Abdichten jedes gut, setzen Sie den Deckel auf, mit Frischhaltefolie abdecken, und stellen Sie über Nacht bei 37 ° C.
    2. Hinzufügen von 100 µL von kaltem Ethanol (Et-OH) / NaCl-Lösung (0,75 M NaCl in 100 % igem Ethanol) zu jedem gut und Niederschlag für 6 Stunden oder über Nacht bei Raumtemperatur.
      Hinweis: Das Protokoll kann hier angehalten werden.
    3. Entfernen Sie die Et-OH/NaCl-Lösung durch Umdrehen der Plattenrandes und waschen Sie 3 Mal mit 200 µL 70 % Ethanol pro gut.
    4. Fügen Sie 25 µL RNAse A-Lösung in destilliertem Wasser und Inkubation bei 37 ° C für 1 h.
  2. Verwenden Sie 3 µL genomic DNA für PCR Verstärkung. Durchführen Sie PCR-Screening der ausgewählten Klone mit Zündkapseln Tempern innerhalb der Neomycin-Resistenz-Gen und Produktlinie 15q. PCR-Amplifikation erfolgt mit standard-Polymerase Enzyme und PCR Protokolle21.
    Hinweis: PCR-Bedingungen für die MS2 Primer (Primer als MS2-subtel15q-Grundierung-S und MS2) und CTR-Primer (CTR Prime S und CTR Grundierung als) sind die folgenden: 98 ° C für 20 s als Denaturierung Schritt und dann 34 Zyklen bei 98 ° C 10 s, 58° C 20 s, 72 ° C 15 s , mit Enzym Polymerase in 25 µL Reaktion mischen (siehe Tabelle der Materialien). Primer-Sequenzen sind in Tabelle 1angegeben.
  3. PCR-Reaktionen auf Agarosegel laufen und PCR Bands gewonnenen positiven Klone mit standard Gel Extraktionsverfahren (siehe Tabelle der Materialien für Gel Extraktion Reagenzien) zu extrahieren.
  4. Durchführen Sie DNA-Sequenzierung Analysen des PCR Produktes Gel extrahiert für Bestätigung der Anwesenheit der MS2 Sequenzen21.
    Hinweis: Die Sequenzierung Analysen können unter Verwendung der Zündkapseln benutzt für das PCR-Screening durchgeführt werden.
  5. Südlicher Fleck Screening PCR positive Klone
    1. Wachsen Sie die Klone mit PCR und Sequenzierung Screening von der ursprünglichen 96-well-Platte (die Platte zur Sicherung), 6-well-Platten in Hams F - 12K (Kaighn) Medium ergänzt mit 10 % FBS, 2 mM L-Glutamin, Penicillin (0,5 Einheiten pro mL Medium), Streptomycin (0,2 µg pro positiv mL Medium) und mit Neomycin in einer Konzentration von 0,7 µg/mL bei 37 ° C 5 % CO2.
      Hinweis: Alternativ, wenn einige dieser Klone verloren gegangen, tauen sie aus einem der eisigen Platten (siehe Protokoll 2.6).
    2. Sobald die Klone sind am Zusammenfluss von 90 % in der 6-well-Platte, die Zellen mit PBS waschen und fügen 250 µL Lyse Puffer mit 0,5 µg Proteinase K pro Bohrloch.
    3. Kratzen Sie die Zellen mit einem Schaber Zelle und übertragen Sie lysate in einem 1,5 mL Röhrchen zu.
    4. Inkubation bei 37 ° C 16 h.
    5. Fügen Sie 1 mL 100 % Ethanol, schütteln Sie kräftig und lassen Sie die DNA zu überstürzen sich mindestens 2 Stunden oder über Nacht bei-20 ° C.
      Hinweis: Das Protokoll kann hier angehalten werden.
    6. Drehen mit 13.400 x g bei 4 ° C für 10 min, überstand verwerfen, und waschen Sie die Pellets mit 70 % Ethanol. Lassen Sie die Pellets Luft bei Raumtemperatur trocknen. Alternativ können Sie einen Vakuum-Konzentrator.
    7. Die DNA-Pellets in 50 µL destilliertes Wasser mit RNAse A Aufschwemmen und 1 h bei 37 ° c inkubieren
    8. 5-10 µg genomische DNA mit Restriktionsenzymen NcoI und BamHI (zwei unabhängige Verdauung) in 100 µL Reaktionsvolumen durch Inkubation der Verdauung Reaktionen bei 37 ° C über Nacht zu verdauen.
    9. Führen Sie 4 µL der Verdauung auf Agarosegel (0,8 % Agarose) für die komplette Verdauung Bestätigung.
    10. Hinzufügen der Einschränkung Verdauung Reaktionen 1/10-bändige Natrium Acetat 3 M Lösung pH 5,2 und 2 Bände von 100 % Ethanol und inkubieren Sie mindestens 2 Stunden oder über Nacht bei-20 ° C, DNA auszufällen.
      Hinweis: Das Protokoll kann hier angehalten werden.
    11. Bei 13.400 x g bei 4 ° C für 20 min Zentrifugieren Sie, verwerfen Sie die Überstände und waschen Sie die Pellets mit 70 % Ethanol. Lassen Sie die Pellets an der Luft bei Raumtemperatur trocknen. Alternativ können Sie einen Vakuum-Konzentrator.
    12. Aufschwemmen Sie Pellets in 20 µL destilliertes Wasser und laden Sie die verdaute DNA auf einem 0,8 % Agarose-Gel.
      Hinweis: Für eine bessere Auflösung der verdauten DNA, bereiten Sie eine Gel mindestens 15 cm lang und bei niedriger Spannung (̴30 Volt) über Nacht laufen. Die Elektrophorese einrichten sollte optimiert werden.
    13. Am folgenden Tag, färben Sie das Gel mit einem DNA-Kennzeichnung Mittel, wie Interkalation Bromid in 1 µL/10 mL Endkonzentration für 30 min bei Raumtemperatur und nehmen Sie ein Bild mit einem Lineal in der Nähe von dem Gel auf einem Gel imaging Instrument.
    14. Den Transfer der DNA auf einer Nylon-Membran und durchführen Sie Membran Hybridisierung mit einer MS2 Sequenz-spezifische Sonde mit Standardverfahren21.
    15. Auftauen der Klone, die positiv auf PCR, DNA Sequenzierung und südlichen Fleck von einem der beiden Einfrieren Platten (siehe nächster Schritt).
  6. Auftauen von Klonen
    1. Bereiten Sie eine 15 mL Tube mit 5 mL der vorgewärmten Ham F - 12 K (Kaighn) Medium ergänzt mit 10 % FBS, 2 mM L-Glutamin, Penicillin (0,5 Einheiten pro mL Medium) und Streptomycin (0,2 µg pro mL Medium) für jeden Klon aufgetaut werden.
    2. Entfernen Sie eines eisigen Platten von-80 ° und 100 µL vorgewärmten F12K komplette Medium in die gut mit den positiven Klon aufgetaut werden.
      Hinweis: Dieses Verfahren sollte schnell ausgeführt werden und die 96-well-Platte auf Trockeneis gelegt werden sollte, nachdem jeder Klon aufgetaut ist, damit die anderen Klone, eingefroren bleiben können. Dies ist besonders wichtig, wenn mehrere Klone aus der gleichen 96-well-Platte aufgetaut werden müssen.
    3. Übertragen Sie die Zellen in der 15 mL Tube mit 5 mL Medium und Zentrifuge bei 800 X g für 5 min bei Raumtemperatur.
    4. Aspirieren Sie das Medium, Aufschwemmen der Zellen in 500 µL vorgewärmten komplette F12K Medium, und jeder Klon zu einem einzigen Brunnen von einem 12-well-Platte zu übertragen.
  7. Beseitigung von Neomycin-Resistenz-Gen aus der MS2 Kassette auf Produktlinie 15q integriert.
    1. Lassen Sie die Klone von einer 12-well-Platte auf eine 10 cm Teller in kompletten F12K Medium anwachsen.
      Hinweis: Neomycin sollten nicht in das Medium einbezogen werden, sofern nicht anders angegeben.
    2. Die kultivierten Zellen in einer 10 cm Petrischale mit 70 % Zusammenfluss in 10 mL des kompletten F12K Medium das Cre exprimierenden Adenovirus hinzufügen.
      Hinweis: Mit einem Cre-GLP mit dem Ausdruck ihrer Adenovirus Bewertung der Effizienz der Infektion, können 100 % nähern sollte. Das Adenovirus-Replikation-defekt verloren nach einige Passagen in der Kultur.
    3. Teilen Sie 48 Stunden nach der Infektion der Zellen in drei 10 cm Gerichte. Zwei Gerichte dienen zur Überprüfung der Neomycin gen Beseitigung durch negative Auslese, wachsen die Zellen in Neomycin-haltigen Medium (vor Gericht), und durch Southern blot (zweiten Gang).
    4. Die dritte Schale mit dem Klon für Zelle Einfrieren und RNA-Extraktion-Kultur.

3. Überprüfung der TERRA-MS2 Transkript Ausdruck von RT-qPCR

  1. Führen Sie nach der Überprüfung von Neomycin gen entfernen total RNA-Extraktion aus TERRA-MS2 Klone mit organischen Lösungsmitteln (Phenol und Guanidin Isothiocynate Lösung)21.
    1. Aufschwemmen der RNS aus einer 10 cm Teller in 100 µL Diethyl Pyrocarbonate (DEPC) Wasser extrahiert.
    2. Laufen Sie 3 µL RNA auf ein Denaturating (1 % Formaldehyd-haltige) 1 X 3-(N-Morpholino) Propanesulfonic Säure (MOPS) Gel, um Konzentration und Integrität der RNA zu überprüfen. Analysieren Sie auch RNA-Konzentration mit einem Spektralphotometer.
    3. Ich benutze 1 Einheit der DNAse 3 µg RNA mit DNAse zu behandeln ich Enzym in 60 µL endgültige Reaktionsvolumen.
    4. Inkubieren Sie die Reaktion für 1 h bei 37 ° c
  2. Reverse Transkription Reaktion und qPCR Analysen
    1. Fügen Sie die folgenden Komponenten zu einem Nuklease-freie Microcentrifuge Schlauch: 2 µL einer 1 µM TERRA spezifischen Primer, 1 µL dNTPs Mix (10 mM), 6 µL DNAse-behandelten RNA (entsprechend ̴300ng RNA). Stellen Sie die Lautstärke auf 13 µL mit 4 µL DEPC-Wasser.
      Hinweis: Für jede RNA untersucht werden, sollte eine zweite Röhre, enthält die gleichen Reagenzien, sondern eine Referenz spezifischen Primer, anstelle von TERRA spezifischen Primer, vorbereitet werden.
    2. Erhitzen Sie die Mischung auf 65 ° C für 5 min und im Eis für mindestens 1 min inkubieren.
    3. Den Inhalt der Röhren durch kurzen Zentrifugation sammeln und fügen 4 µL 5 X RT Enzyms Puffer, 1 µL 0.1 M Dithiothreitol (DTT), 1 µL RNAse-Inhibitor (4 Stück) und 1 µL Reverse Transkriptase (siehe Tabelle der Materialien).
    4. Die Proben bei 42 ° C für 60 min inkubieren und 2 µL RT-Reaktion für qPCR Analysen verwenden können.
  3. Bereiten Sie qPCR-Reaktion-Mix in einem Endvolumen von 20 µL bestehend aus 10 µL 2 X qPCR-master-Mix, 2 µL cDNA-Vorlage, 1 µL vorwärts Primer (10 µM) 1 µL des rückwärts-Primer (10 µM) und 6 µL Wasser vor.
  4. Durchführen Sie qPCR Reaktion in einem Thermocycler mit Standardprotokollen21.

4. Herstellung von ein MS2-GLP mit dem Ausdruck Retrovirus

  1. MS2-GLP mit dem Ausdruck ihrer Retrovirus generieren, transfizieren Sie 80 % konfluierende Phoenix Verpackungszellen mit einem MS2-GFP Fusionsprotein Ausdruck Retrovirus-Vektor (pBabe-MS2-GFP PURO) und ein Env -gen mit dem Ausdruck Vektor (z. B. pCMV-VSVG) mit einem Molverhältnis 4:1 von die beiden Vektoren.
  2. Am Folgetag ersetzen Sie die Kultivierung Medium (DMEM mit 10 % ergänzt, FBS, 2 mM L-Glutamin und Pen/Strep) mit frischem Medium mit 10mM Natrium Butyrat.
  3. Inkubieren Sie 8 h bei 37 ° C, 5 % CO2, dann ersetzen Sie das Medium mit frischen Kultivierung Medium, aus dem das Virus gesammelt werden.
  4. Entfernen Sie nach 48 h das Retrovirus-haltigen Medium aus den Phoenix-Zellen. Dieses Medium kann direkt für die Infektion von TERRA-MS2 Klonen verwendet werden, in diesem Fall das Medium durch einen 0,45 µm-Filter filtern, Polybrene (30 µg/mL Endkonzentration) hinzufügen und Zellen (in diesem Fall ist das Protokoll weiter bei Schritt 5) hinzufügen. Alternativ kann Retrovirus in ein 50 mL Falcon-Röhrchen durch Zugabe von 1/5-th -Volumen von 50 % PEG-8000/900 mM NaCl-Lösung und Inkubation über Nacht bei 4 ° C auf einem Rotator Rad ausgefällt werden.
  5. Am folgenden Tag, Pellet Retrovirus Partikel durch Zentrifugation bei 2.000 x g für 30 min, überstand entfernen und das Pellet in F12K Medium ohne Serum aufzuwirbeln.
    Hinweis: Die Viruspartikel können in 1/100th des ursprünglichen Volumens überstand Nukleinsäuretablette. Ein Infektion Test sollte durchgeführt werden, um zu überprüfen, das Mindestvolumen von Retroviren benötigt, um effizient die Zellen infizieren.

(5) Visualisierung von TERRA-MS2 Transkripte in lebenden Zellen

  1. Platte TERRA-MS2 Klone und WT AGS Zellen im Glasboden-Gerichte. Am Tag der Infektion hinzu kommen Polybrene das Medium (30 µg/mL Endkonzentration) und die MS2-GLP mit dem Ausdruck ihrer Retrovirus.
  2. Verwerfen Sie nach 24 Stunden die Virus-haltigen Medium zu und fügen Sie frisches Medium ohne Phenol-rot.
  3. Analysieren Sie die Zellen in einem inversen Mikroskop mit dem entsprechenden Mikroskop-Einstellung. Das Bild der Zellen mit 100 X oder 60 X Objektiv mit großen numerische Apertur (1.4 X) und mit einem sensiblen Kamera (EMCCD). Verwenden Sie ein Umwelt-Kontrollsystem, um die Proben bei 37 ° C und 5 % CO2 während der Bildgebung beizubehalten.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Abbildung 1 stellt einen Überblick über die experimentelle Strategie. Die wichtigsten Schritte des Protokolls und einer indikativen Zeitlinie zur Erzeugung von TERRA-MS2 Klone in AGS Zellen werden (Abb. 1A) angezeigt. Am 1. Tag sind mehrere Brunnen von einem 6-well-Platte mit der MS2 Kassette und SgRNA/Cas9 zum Ausdruck zu bringen (siehe Abbildung 1B) Vektoren transfiziert. Zwei verschiedene Produktlinie 15q-spezifische Anleitung RNA-Sequenzen werden in der Cas9 Nickase exprimierenden geklont pX335 Vektor, Generierung von zwei SgRNA-pX335-Vektoren, die gemeinsam mit der MS2 Kassette transfizierten sind. Einen Brunnen der Platte kann mit einer GLP mit dem Ausdruck Vektor die Transfektion Effizienz überprüfen transfiziert. Am 2. Tag die Zellen sind trypsiniert und aus einem einzigen Brunnen auf eine 10 cm Schale mit selektiven Medium übertragen. Am 3. Tag sollte Medium geändert werden, da die meisten untransfected Zellen tot zu sein. Zellen wachsen im Auswahl bis Klone sichtbar und abholbereit sind. Während dieser Zeit sollten keine Zellen trypsinized und Kultivierung Medium sollte geändert werden, alle 1-2 Tage für die erste Woche und dann alle 2-3 Tage danach. Sobald einzelne Klone sichtbar sind, sind sie abgeholt und in eine 96-well-Platte übertragen, wo dürfen sie bis zu 80-90 % der Zusammenfluss wachsen. An dieser Stelle sind Klone in 4 verschiedenen 96-well-Platten, aufgeteilt, die in Abbildung 1 mit einem Farbcode gekennzeichnet sind. Sobald die Klone kultiviert in der DNA-Platte (grün) 80 % Zusammenfluss erreichen, sie sind lysiert und genomischer DNA extrahiert für PCR-screening; die Klone in der Platte zur Sicherung (blau) werden werden in Kultur gehalten bis die Ergebnisse der PCR-screening, während die roten Einfrieren Platten bei-80 ° c eingefroren werden Abbildung 2 B zeigt repräsentative Ergebnisse eines PCR-Screening von Neomycin-resistente Klone. Für dieses Screening sind zwei Sätze von Primer verwendet: ein Primerpaar (MS2 Primer) innerhalb der Neomycin gen und Produktlinie 15q Sequenz glühen wird verwendet, um das Vorhandensein der MS2 Kassette zu überprüfen (ein repräsentatives Bild der Zündkapseln Lokalisierung ist dargestellt in Abbildung 2A). Eine zweite Grundierung paar (CTR Primer) Glühen bei einer internen chromosomalen Region wird verwendet, um das Vorhandensein von falsch negativen Klone zu überprüfen (Primer-Sequenzen sind in Tabelle 1angegeben). Negativen Klone für die Integration der Kassette sollte die MS2 Primer Verstärkung negativ und positiv auf die CTR Primer Verstärkung. Technische Probleme bei genomischen DNA-Extraktion führt das Fehlen von genomischer DNA oder die Kontamination würden PCR Verstärkung von MS2 und CTR Grundierung Reaktionen ausschließen. In diesen Fällen können die Klone beteiligt durch PCR bei der Extraktion von genomischer DNA aus der Platte zur Sicherung erneut gezeigt. Bänder aus MS2 Primer Verstärkung der positiven Klone gewonnen kann Gel extrahiert und sequenzierte unter Verwendung der MS2 Zündkapseln, um das Vorhandensein von zehn MS2 Sequenzen bestätigen.

Die Klone, die positiv auf PCR-Screening sind sind kultivierte aus der 96 auch backup-Platte (die blaue Platte in Abbildung 1), ein 6-well-Platte, dann für genomische DNA-Extraktion und Southern Blot Analysen lysiert. Abbildung 2 D zeigt repräsentative Bilder eines Gel (links) und die Membran mit einer radioaktiv markierten MS2 Sequenz Sonde (rechts) eines Southern Blot Screening PCR positive Klone hybridisiert. Zur Bestätigung der MS2 Sequenzen Integration bei Produktlinie 15q sollte genomischer DNA extrahiert aus jeder Klon mit zwei verschiedenen Restriktionsenzymen (NcoI und BamHI) in zwei getrennten Verdauung Reaktionen verdaut werden. NcoI und BamHI Restriktionsenzyme eignen sich zur Überprüfung der MS2 Kassette Integration bei Produktlinie 15q. Andere Enzyme können auch verwendet werden. Das Gel zeigt eine komplette Verdauung genomic DNA mit der BamHI Restriktionsenzym, wie durch das Vorhandensein von einem Abstrich. Die Ergebnisse aus südlicher Fleck zeigen, dass ein Klon für die Integration der MS2 Kassette bei Produktlinie 15q positiv ist, während einige Klone mehrere Integrationsveranstaltungen der Kassette, zeigen, wie durch die Anwesenheit von mehreren Bands. Ein positiver Klon sollte durch eine zweite südlicher Fleck auf NcoI Verdauung der genomischen DNA21analysiert werden. Ein repräsentatives Bild einer Produktlinie 15q mit der MS2-Kassette und die Position der BamHI und NcoI Beschränkungsenzymsites ist in Abbildung 2Cgezeigt.

Die Klone Positive PCR und Southern-Blot Analysen um das Neomycin-gen, die in der MS2 Kassette entfernen mit eine Cre-GLP mit dem Ausdruck ihrer Adenovirus infiziert sind. Abbildung 3 A zeigt ein MS2-Tags Produktlinie 15q vor und nach Cre-Expression. Ein Bild eines Klons positiv für die MS2 Kassette Integration am Produktlinie 15q infiziert mit einer Cre-GLP mit dem Ausdruck ihrer Adenovirus in Abbildung 3Bangezeigt wird. Für eine vollständige Entfernung des Gens Neomycin in allen Zellen sollte die Infektion Effizienz ca. 100 % erreichen. Wie in Abbildung 3Cdargestellt, sind um zu überprüfen, die Beseitigung des Gens Neomycin Cre-GFP infiziert Zellen in drei Platten nach 48 Stunden nach der Infektion geteilt werden. Eine Platte wird im Beisein von Neomycin kultiviert werden. Alle Zellen in dieser Platte sollte innerhalb von 6-7-Tage sterben. In einer zweiten Platte Zellen dürfen bis auf 80-90 % Zusammenfluss in kompletten Medium ohne Auswahl wachsen. An dieser Stelle wird genomischer DNA extrahiert und durch Southern Blot analysiert. Die dritte Platte ist im kompletten Medium ermöglicht die Erstellung von gefrorenen Vorräte des Klons und für die RNA-Extraktion und RT-qPCR Analysen der TERRA-MS2 Transkript Ausdruck kultiviert. Abbildung 3 D zeigt repräsentative Bilder von Southern Blot Analysen eines positiven Klons vor und nach der Cre-GFP-Infektion. DNA-Agarose-Gel (Bild links) bestätigt die komplette Verdauung der genomic DNA mit Hilfe der NcoI Restriktionsenzym. Südlicher Fleckanalyse erfolgte mittels einer radioaktiv-markierten MS2-Sequenz Sonde (Bild rechts). Diese Analyse bestätigt die Entfernung des Neomycin-Gens. Die Anwesenheit von ein Abstrich in der Cre-GFP infiziert-Probe bestätigt die telomeric Integration der MS2 Sequenzen. Die Position der NcoI Restriktionsschnittstellen innerhalb der Produktlinie 15q ist in Abbildung 3gezeigt.

Sobald die Beseitigung von Neomycin-Resistenz-Gen bestätigt wird, können die Klone für den Ausdruck von TERRA-MS2 Transkripte getestet werden. Zu diesem Zweck wird Gesamt-RNS aus jeder Klon extrahiert und laufen auf einem Denaturating MOPS Gel, seine Integrität (Abb. 4A) zu bestätigen. Ribosomale RNA Bands an 4.700 Stützpunkten (28 s rRNA) sichtbar sein soll und 1.900 Basen (18 s rRNA). Retrotranscription Reaktion erfolgt mittels telomeric Repeat-spezifische Primer und Referenz-gen-spezifische Primer (Abbildung 4B, oben) während qPCR Analysen von TERRA Ausdruck erfolgt mit zwei Sätzen von Primer: eine Grundierung paar Glühen in der MS2-Sequenz und der Produktlinie 15q Sequenz; ein zweites paar Zündkapseln Tempern innerhalb der Produktlinie 15q. Primer-Sequenzen sind in Tabelle 1angegeben. Das Diagramm in Abbildung 4B präsentiert zeigt RT-qPCR Analysen von TERRA Ausdruck von AGS WT-Zellen und zwei verschiedene TERRA-MS2-Klone. Diese Analysen bestätigen die Expression von TERRA-MS2 Transkripte in die beiden Klone auf Ebenen, die TERRA Transkripte von Produktlinie 15q in WT-Zellen ausgedrückt vergleichbar sind. Diese Daten deuten darauf hin, dass die zwei TERRA-MS2 Klone ausgewählt für die Analysen der TERRA-MS2 Transkripte von live Cell Imaging eignen.

Um TERRA-MS2 Transkripte in lebenden Zellen sichtbar zu machen, sind die ausgewählten Klone eines Retrovirus mit dem Ausdruck der MS2-GFP Fusionsprotein infiziert. Abbildung 5 A zeigt das Verfahren MS2-GLP mit dem Ausdruck ihrer Retrovirus, erzeugen, wie im Protokoll Schritt 4 beschrieben. AGS-WT-Zellen und TERRA-MS2 Klone sind im Glasbodenboot Gerichte infiziert. Nach 24 Stunden von der Infektion werden Zellen von Fluoreszenzmikroskopie analysiert. Die Besonderheit des Signals wird durch die Anwesenheit von TERRA-MS2-GFP Brennpunkte erkannt in den Kern der TERRA-MS2 Klone und nicht in AGS WT-Zellen (Abb. 5B) bestätigt. In einer Population von MS2-GLP erwartet ist mit dem Ausdruck Zellen, Heterogenität in Bezug auf die MS2-GFP Ebenen zwischen den Zellen und Zellen Ausdruck geringer gewählt werden, für die bildgebenden Untersuchungen. Alternativ können FACS vorherige Mikroskopie Analysen die MS2-GLP mit dem Ausdruck ihrer Zellen sortiert werden, um die Subpopulation von Zellen mit dem niedrigen Niveau der GLP Ausdruck zu sammeln. Wir haben bereits festgestellt, TERRA-MS2-GFP Brennpunkte in 40-60 % der Zellen des AGS TERRA-MS2 Klone21. In diesen Zellen wurden bis zu vier TERRA-MS2-GFP Herde pro Zelle abgebildet. TERRA-MS2-GFP Herde zeigen unterschiedliche Größen und Dynamik können erkannten21sein. TERRA-MS2 Klone können verwendet werden, um die Dynamik des Single-Telomere TERRA Transkripte in lebenden Zellen zu studieren. Als ein Beispiel für diese Anwendung zeigt Abbildung 5C repräsentative Bilder von Mikroskopie Analysen eines TERRA-MS2-Klons mit dem Ausdruck der MS2-GFP Fusionsprotein und die Telomer-Bindeprotein, die TRF2 an mCherry zur fusioniert MS2-Tags TERRA Transkripte und Telomere in lebenden Zellen zu visualisieren. Mit diesem Ansatz haben wir zuvor beobachtet, dass TERRA-MS2-GFP Brennpunkte Co lokalisieren mit Telomere in 44 % der Zellen, darauf hinweist, dass TERRA Abschriften nur vorübergehend mit Chromosomenenden AGS Zellen21Co zu lokalisieren.

Figure 1
Abbildung 1 . Übersicht der experimentelle Strategie und der vorläufige Zeitplan für die Erzeugung von TERRA-MS2 Klone in AGS Zellen. (A) die Anweisungen in das Protokoll und eine indikative Zeitleiste für die Auswahl der TERRA-MS2 Klone werden angezeigt. Zellen sind in einem 6-well-Platte mit linearisierten MS2 Kassette und SgRNA/Cas9 mit dem Ausdruck Vektoren transfiziert. Ein Farbcode wird verwendet, um die DNA-Platte zu unterscheiden, die Platte zur Sicherung und die eisigen Platten im Abschnitt Protokoll angegeben. B) der MS2 Kassette besteht aus einer 800 nt lange Produktlinie 15q Sequenz, gefolgt von 10 Wiederholungen der MS2 Sequenzen und einer Neomycin-Resistenz-Gen, flankiert von Lox-p Seiten und endet mit einem 300 nt lange telomeric wiederholen Trakt an seinem 3'-Ende. SgRNA/Cas9 mit dem Ausdruck ihrer Vektoren wurden durch Klonen Produktlinie 15q-spezifische Anleitung RNA-Sequenzen in pX335 Vektor mit der BbsI Einschränkung Seite21,22erzeugt. Zwei verschiedene SgRNA-pX335-Vektoren erzeugt wurden und eine 1:1-Mischung der beiden Vektoren für die Transfektion verwendet wurde. Die Sequenzen der SgRNAs sind in Tabelle 1angegeben. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 . Repräsentative Bilder von PCR und Southern blot Screening von Neomycin resistente Klone. A) repräsentatives Bild der Produktlinie 15q mit der MS2-Kassette. Die Position der MS2 Primer (Primer als MS2-subtel15q-Grundierung-S und MS2) für PCR-Screening verwendet wird angezeigt. Die LoxP-Seiten präsentieren in der Kassette sind in rot dargestellt. B) repräsentatives Bild der PCR-Screening von Neomycin resistente Klone mit zwei Zündkapseln, MS2 Grundierungen und Primer CTR (Klickrate Prime S und CTR Grundierung als). C) repräsentatives Bild der Produktlinie 15q mit der MS2-Kassette. BamHI und NcoI Restriktionsschnittstellen und die MS2 Sonde für die Southern Blot Screening werden angezeigt. D) Links: 10 µg genomische DNA pro Klon mit BamHI und Lauf auf einem Agarosegel verdaut wurden. Das Bild wurde nach einer Übernachtung bei 30 Volt laufen erworben. Rechts: genomischer DNA mit BamHI Restriktionsenzym verdaut wurde auf einer positiv geladenen Nylon-Membran übertragen und mit einer radioaktiv-markierten MS2 Sequenz-spezifische Sonde hybridisiert. Das rote Feld zeigt die erwartete Größe der positiven Band. Der rote Pfeil zeigt einen positiven Klon. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3 . Beseitigung von Neomycin Resistenz-Gen und Validierung Experimente. (A) repräsentatives Bild der Produktlinie 15q mit der MS2 Kassette vor und nach Cre-Expression. Die MS2 bestimmte Sonde für Southern Blot Analysen und NcoI Beschränkungsenzymsites werden angezeigt. Die LoxP-Seiten präsentieren in der Kassette sind in rot dargestellt. B) Fluoreszenz-Mikroskopie-Analyse der ein TERRA-MS2-Klon mit Cre-GLP mit dem Ausdruck ihrer Adenovirus infiziert. Repräsentatives Bild bei einer fokalen Ebene erworben wird angezeigt. MOI, Multiplizität der Infektion, ist das Verhältnis zwischen der Anzahl von Viren verwendet für die Infektion und die Anzahl der Wirtszellen. Maßstabsleiste: 30 µm C) Überblick über die experimentelle Strategie verwendet, um die Beseitigung des Gens Neomycin zu überprüfen. Cre-GFP infizierte Zellen werden nach 48 Stunden nach der Infektion (i) negative Auslese, Ii) Southern Blot Analysen und Iii) Vorbereitung der gefrorenen Zelle Aktien und RNA-Extraktion in drei Platten aufgeteilt. D) südlicher Fleck Analyse von TERRA-MS2 Klonen vor und nach der Cre-GFP-Adenovirus-Infektion. 10 µg genomische DNA wurden mit dem Restriktionsenzym NcoI verdaut. Agarosegel bestätigt, dass die komplette Verdauung in beiden Klone (links) erreicht wird. Die verdaute genomische DNA wurde in einer positiv geladenen Nylon-Membran übertragen und mittels MS2 Sequenz-spezifische Sonde hybridisiert. Vollständige Beseitigung des Neomycin-Gens wird durch das Fehlen der spezifischen Band bestätigt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4 . RT-qPCR Analysen von Tel15Q-TERRA und Tel15Q-TERRA-MS2 Abschriften Ausdruck. (A) repräsentatives Bild eines MOPS-Gels zeigt Gesamt-RNS von AGS WT-Zellen und TERRA-MS2 Klone extrahiert. Bands, die entsprechend der ribosomalen RNAs sind 28 s und 18 s angegeben. B) oben: eine schematische Darstellung der MS2-Tags Produktlinie 15q TERRA Transkripte zum Ausdruck zu bringen. Primer für TERRA Retrotranscription (gelb) und qPCR Analysen der Tel15q-TERRA (blau) und Tel15q-MS2 TERRA (rot) verwendet werden angezeigt. Die LoxP-Website wird in rot angezeigt. Unten: RT-qPCR Analysen der Tel15q-TERRA und Tel15q-MS2 TERRA Transkripte Ausdruck in AGS WT-Zellen und TERRA-MS2 klont. p < 0,05, ungepaarten t-test. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 5
Abbildung 5 . Live Cell imaging Analysen von TERRA-MS2 -Klone. (A) einen Überblick über das Verfahren, einen MS2-GLP mit dem Ausdruck ihrer Retrovirus zu produzieren, wie im Protokoll Schritt 4 beschrieben. Eine schematische Darstellung des MS2-Tags Produktlinie 15q und TERRA Transkripte von der MS2-GFP Fusionsprotein erkannt wird auf der rechten Seite angezeigt. B) repräsentative Fluoreszenz Mikroskopie Bild des AGS WT und zwei TERRA-MS2 Klone MS2-GFP zum Ausdruck zu bringen. TERRA-MS2-GFP Brennpunkte sind durch Pfeile angedeutet. Bilder wurden aufgenommen mit einer drehenden Scheibe confocal Mikroskop ausgestattet mit einer EMCCD Kamera. Die Bilder wurden aufgenommen mit einer 100 X / 1,46 Apochromat Ziel in einer bildgebenden Kammer aufrechterhalten bei 37 ° C mit 5 % CO2. Als Lichtquelle diente eine 488 Laser. Maßstab: 5 µm. C) Live Cell imaging Analysen der TERRA-MS2-GFP Brennpunkte und TRF2-mCherry mit der Bezeichnung Telomere. Ein Co Lokalisierung Ereignis zwischen einem TERRA-MS2-GFP-Fokus und ein einzelnes Telomer wird angezeigt. Bilder wurden wie in B, mit 488 und 520 Laser als Lichtquelle erworben. Eine maximale Projektion eines Z-Stapel-Experiments durchgeführt zu einem einzigen Zeitpunkt, den Punkt des Time-Lapse imaging Experiment gezeigt wird. Maßstab: 5 µm. Bitte klicken Sie hier für eine größere Version dieser Figur.

Primer-name Primer Sequenz Anwendung
MS2-subtel15q-Grundierung-S TGCATTAAAGGGTCCAGTTG MS2-Grundierung nach vorn für PCR-Screening von Neomycin resistente Klone verwendet
MS2-Grundierung als CCTAACTGACACACATTCCACAGA Umgekehrte MS2 Grundierung verwendet für PCR-Screening von Neomycin resistente Klone
CTR Grundierung S TGT ACG CCA ACA CAG TGC TG CTR-Grundierung nach vorn in PCR-Screening von Neomycin resistente Klone verwendet
CTR-Grundierung als GCT GGA AGG TGG ACA GCG A CTR Grundierung reverse in PCR-Screening von Neomycin resistente Klone verwendet
Tel15q-S1 GCAGCGAGATTCTCCCAAGC Sinn-Grundierung, Tel15q und Tel15q-MS2 TERRA Ausdruck zu erkennen von qPCR verwendet
hTel15q-AS TAACCACATGAGCAATGTGGGTG Antisense Primer verwendet, um Tel15q und Tel15q-MS2 TERRA Ausdruck erkennen von qPCR
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG Antisense Primer verwendet, um Tel15q-MS2 TERRA Ausdruck erkennen von qPCR
TERRA-RT-Grundierung CCCTAACCCTAACCCTAACCCTAACCCTAA Grundierung für Retrotranscription TERRA Transkripte verwendet
sgRNA1 TTGGGAGAATCTCGCTGGCC Sequenz von der Kurzführer RNA 1 in pX335 Vektor kloniert und verwendet, um Cas9 Nickase enzymatische Aktivität zur Produktlinie 15q direkt
sgRNA2 TGCATTAAAGGGTCCAGTTG Sequenz von der Kurzführer RNA 2 in pX335 Vektor kloniert und verwendet, um Cas9 Nickase enzymatische Aktivität zur Produktlinie 15q direkt

Tabelle 1 : Liste der in dieser Studie verwendeten Primer. Eine Liste der Primer und die Sequenzen von SgRNAs, die in diesem Protokoll verwendeten stehen zur Verfügung. Sequenzen sind 5', 3'.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In diesem Artikel präsentieren wir Ihnen eine Methode, um Krebserkrankungen Zellklonen mit MS2 Sequenzen innerhalb Produktlinie 15q integriert zu generieren. Diese Klone verwenden, werden die MS2-Tags TERRA-Moleküle aus der Produktlinie 15q transkribiert durch Fluoreszenz-Mikroskopie von Co Ausdruck ein MS2-GFP Fusionsprotein erkannt. Dieser Ansatz ermöglicht es Forschern, die Dynamik der TERRA von einem einzigen ausgedrückt zu studieren Telomere in lebenden Zellen21. In diesem Protokoll werden TERRA-MS2 Klone in der AGS-Zell-Linie ein interessantes Modellsystem stellt, TERRA, zu studieren, da TERRA Expression hochreguliert im menschlichen Magen Krebs Proben24ist ausgewählt. Jedoch kann das hier beschriebene Protokoll für die Auswahl der TERRA-MS2 Klone in anderen Zelllinien angepasst werden. Die Integration der MS2 Sequenzen kann im Prinzip auf eine Produktlinie von Telomer 15q gefördert werden, mithilfe einer speziellen MS2 Kassette und CRISPR-Strategie. Bei der hier vorgestellten Methode sind ein Cas9 Nickase Enzym und doppelte Guide RNAs eingesetzt, um die Spezifität der Integration22erhöhen. Bei dieser Strategie sollen eine insgesamt 2 % positive Klone in AGS Zellen identifiziert werden. Andere Versionen des Cas9 Enzyms können bei dem Versuch, die Erfolgsquote der Klone Auswahl25steigern getestet werden. Darüber hinaus sind die folgenden Schritte des Protokolls kritisch, zu berücksichtigen, um die Effizienz der Klon-Auswahl zu maximieren:

I) um die Chancen des Vorwählens der TERRA-MS2-Klone, es ist wichtig, eine hohe Transfektion Effizienz der MS2-Kassette und CRISPR-Vektoren zu erreichen. Schlecht transfizierte Zelllinien benötigen höchstwahrscheinlich mehrere Runden der Transfektion, Klon-Auswahl und Screening, um positive Klone auszuwählen.

(II) Es ist wichtig zu bestimmen, die genaue Konzentration von Neomycin, für die Auswahl der Klone zu verwenden. In der Tat wird mit einer niedrigen Konzentration des Medikaments falsch positive Klone führen, während eine hohe Konzentration die Identifizierung von positive Klone ausschließen kann. Die Neomycin Konzentration angegeben in diesem Protokoll ist tödlich zu den AGS Zellen innerhalb von 6-7 Tagen aus der Addition der Kultivierung Medium.

(III) Klon Kommissionierung ist ein entscheidender Schritt. In der Tat, während dieses Vorgangs ist es erforderlich, dass nur einzelne Klone geholt werden. Für die Kolonien, die zu nah an einander mischen zur Vermeidung vermieden werden sollten deshalb aus verschiedenen Klonen Zellen, integriert was bei der Auswahl eine gemischte Bevölkerung von Klonen die MS2 Sequenzen enthalten können an mehreren Standorten genomische. Diese Veranstaltungen sollten während der Southern Blot Screening identifiziert werden.

(IV) der Betrag von genomischer DNA aus einem Zusammenfluss 96 well DNA-Platte (Protokoll Nr. 2) extrahiert wird geschätzt, dass ca. 5 µg und sollte ausreichen, um jeden Klon von PCR und Southern blotting mit einem einzigen Beschränkung Enzym Verdauung Bildschirm. Um die Integration der Kassette auf die erwarteten Telomere zu bestätigen, werden es jedoch wichtig, jeder Klon durch Southern Blot Bildschirm durch die genomische DNA mit zwei verschiedenen Restriktionsenzymen verdaut. Zu diesem Zweck sollte gemäß dem Protokoll der Klone mit PCR-Screening positiv kultiviert in 6-well-Platten werden. Die Höhe der genomischen DNA extrahiert aus einem Brunnen von einem 6-well-Platte wird für mindestens zwei Einschränkung Verdauung benötigt für die Southern Blot Analysen ausreichend sein.

In dem hier beschriebenen Protokoll fließen die MS2 Sequenzen innerhalb Produktlinie 15q für eine Reihe von Gründen: ich) Promotorregion TERRA und TERRA Transkription Start Seiten wurden auf dieser Produktlinie26,27; (II) TERRA Ausdruck von Produktlinie 15q wurde mithilfe von in-vitro- Techniken4,27,28,29,30validiert; (III) die subtelomerischen-Region von Chromosom 15q wurden sequenziert und es enthält eine einzigartige Region angrenzend an die telomeric wiederholen-Darm-Trakt, der für die Integration der MS2-Kassette21ausgerichtet werden kann. PCR und Southern Blot Ansätze wurden entwickelt, um die einzelnen Integration der MS2-Sequenz im Produktlinie 15q in der TERRA-MS2-Klone zu bestätigen. Es wäre interessant, auch DNA-Fisch auf Chromosom Spreads Experimente um die chromosomale Lokalisation der MS2 Sequenzen in festen Metaphase Chromosomen sichtbar zu machen. Jedoch die Länge der 10xMS2 Sequenzen (450 bp) erzwingt die Verwendung von sehr kurzen Sonden im Vergleich zu der Sonden, die im allgemeinen verwendeten DNA-Fisch auf Chromosom Spreads (bakterielle künstliche Chromosomen (Bac), Cosmids oder Plasmide)31. Diese technische Herausforderung hat uns daran gehindert, visualisieren die MS2 Sequenzen auf Chromosom Spreads, die eine Einschränkung des Protokolls darstellt. Eine weitere Einschränkung des Verfahrens ist die Zeit und den Aufwand für die Auswahl der TERRA-MS2-Klone. Darüber hinaus sind spezifische Labor einrichten und Ausrüstung für den Einsatz von Viren, radioaktives Material und Mikroskopie Analysen erforderlich.

Die hier beschriebene Methode kann zur Erzeugung von TERRA-MS2 Klone in verschiedenen Zelllinien implementiert werden, um die Dynamik der TERRA in verschiedenen biologischen zusammenhängen, wie z. B. während der Telomere Dysfunktion oder zelluläre Seneszenz, hilft uns zu verstehen, definieren die Funktion der TERRA in diesen Prozessen. Eine interessante Entwicklung dieses Ansatzes wird sein, dass die Generation der TERRA-MS2 Klone TetO mit integrierten an eine bestimmte Produktlinie, einschließlich die MS2-Tags Telomere wiederholt. Der Ausdruck eines TetR Proteins verschmolzen zu einem fluoreszierenden Protein (d. h. mCherry) ermöglicht Visualisierung dieses bestimmten Telomere in lebenden Zellen32. Dieses Vorgehen ermöglicht Untersuchung der ob menschliche TERRA Transkripte zu lokalisieren und in GUS-Staaten an der TERRA Transkription Telomere und Chromosom oder in Trans durch die Verlagerung in andere Chromosomen zu handeln. Diese Frage in der Biologie von TERRA bleibt um zu klären.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären keine finanzielle Interessenkonflikte

Acknowledgments

Wir sind dankbar für das Personal der die erweiterte Bildgebung von CIBIO an der Universität Trient und BioOptics Licht Mikroskopie Facility bei Max F. Perutz Laboratories (MFPL) in Wien. Die Forschung führt zu diesen Ergebnissen wird finanziell von der Mahlke-Obermann-Stiftung und der Europäischen Union siebten Rahmenprogramms für Forschung, technologische Entwicklung und Demonstration unter Finanzhilfevereinbarung keine 609431 EG EG wird unterstützt durch ein Rita Levi Montalcini-Stipendium vom italienischen Ministerium für Bildung, Universität und Forschung (MIUR).

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
Generation von Krebs Zellklonen Telomeric Repeat-haltigen RNA TERRA von einem einzigen Telomere in lebenden Zellen ausgedrückt zu visualisieren
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter