Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

הדור של סרטן התא שיבוטים כדי להמחיש Telomeric המכילים חוזר RNA טרה הביע מ טלומר יחיד בתאים חיים

doi: 10.3791/58790 Published: January 17, 2019

Summary

כאן, אנו מציגים פרוטוקול ליצירת סרטן התא שיבוטים המכיל תגית רצף MS2 ב subtelomere יחיד. גישה זו, בהסתמך על מערכת MS2-GFP, מאפשרת הדמיה של התרשימים אנדוגני של telomeric המכילים חוזר RNA (TERRA) הביע מ טלומר יחיד בתאים חיים.

Abstract

טלומרים משוקלטים, והוליד telomeric המכילים חוזר זמן noncoding RNAs (TERRA), אשר הוצעו כדי לשחק תפקידים חשובים בביולוגיה טלומר, כולל היווצרות הטרוכרומטין טלומר אורך הומאוסטזיס. הממצאים האחרונים גילה כי מולקולות טרה גם לקיים אינטראקציה עם אזורים פנימיים כרומוזומלית להסדיר ביטוי גנים בתאי גזע עובריים (ES) העכבר. בקנה אחד עם הראיות, קרינה פלואורסצנטית RNA ניתוחים בחיי עיר הכלאה (RNA-דג) הראו כי רק תת-ערכה של טרה תעתיקים לשפה קצותיו כרומוזום. הבנה טובה יותר של הדינמיקה של מולקולות טרה נעזור להגדיר פונקציה ואת מנגנוני הפעולה שלהם. כאן, אנו מתארים שיטה כדי לתייג והמחש יחיד-טלומר תעתיקים טרה בתאי סרטן באמצעות מערכת MS2-GFP. לכוונה זו, אנו מציגים פרוטוקול כדי ליצור שיבוטים יציב, באמצעות AGS שהבטן האנושית סרטן תא קו, המכיל רצפי MS2 משולב ב subtelomere יחיד. תמלול של טרה מ טלומר מתויג MS2 תוצאות הביטוי של מולקולות מתויג MS2 טרה הם דמיינו ידי קרינה פלואורסצנטית לחיות תאים במיקרוסקופ על ביטוי משותף של חלבון מחייב MS2 RNA דבוקה GFP (MS2-GFP). גישה זו מאפשרת לחוקרים ללמוד את הדינמיקה של יחיד-טלומר טרה מולקולות בתאים סרטניים, ניתן להחיל אותה על שורות תאים אחרים.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

טרה RNA noncoding זמן הוא עיבד מאזור subtelomeric של כרומוזומים, שעתוק שלה ההכנסות לכיוון הקצוות כרומוזום, הפסקת בתוך בדרכי. אני חוזר telomeric1,2. מסיבה זו, טרה תעתיקים מורכב subtelomeric, נגזר רצפים בסוף 5' ולסיים עם telomeric חזרה (UUAGGG גולגולת)3. חשוב תפקידי הוצעו על TERRA, כולל הטרוכרומטין היווצרות-טלומרים4,5, ה-DNA שכפול6, קידום רקומבינציה הומולוגית בין כרומוזום מסתיים7,8 , 9, ויסות טלומר מבנה10ו טלומר אורך הומאוסטזיס2,11,12,13. יתר על כן, טרה תעתיקים אינטראקציה עם אתרים רבים extratelomeric להסדיר ביטוי גנים נרחבת תאי גזע עובריים (ES) העכבר14. בקנה אחד עם אלה ראיות, קרינה פלואורסצנטית RNA בחיי עיר הכלאה ניתוחים (RNA-דג) הראו כי רק תת-ערכה של טרה הפרוטוקולים לשפה טלומרים1,2,15. בנוסף, טרה דווח טופס גרעיני אגרגטים לוקליזציה על הכרומוזומים X ו- Y העכבר תאים2,16. ממצאים אלה מצביעים על TERRA תעתיקים לעבור דינמיקה מורכבת בתוך הגרעין. הבנת הדינמיקה של מולקולות טרה תסייע להגדיר פונקציה ואת מנגנוני הפעולה שלהם.

מערכת MS2-GFP כבר בשימוש נרחב כדי להמחיש מולקולות RNA בתאים חיים של אורגניזמים שונים17,18. מערכת זו שימש בעבר כדי לתייג והמחש יחיד-טלומר מולקולות טרה cerevisiae ס12,19. באמצעות מערכת זו, זה היה לאחרונה הוכיח כי שמרים טרה תעתיקים בתרגום בתוך הציטופלסמה במהלך שלב shift פוסט-diauxic, רומז כי טרה לנצל פונקציות extranuclear20. השתמשנו לאחרונה מערכת MS2-GFP ללמוד יחיד-טלומר תעתיקים טרה סרטן תאים21. לכוונה זו, אנחנו מועסקים CRISPR/Cas9 הגנום כלי עריכה כדי לשלב את רצפי MS2 ב טלומר יחיד (טלומר 15q, להלן Tel15q) וקיבלתי שיבוטים ביטוי מתויג MS2 אנדוגני Tel15q טרה (TERRA-MS2 שיבוטים). ביטוי שיתוף התמזגו-GFP MS2 RNA מחייב חלבון (MS2-GFP) מזהה ומאגד רצפי MS2 RNA מאפשר החזיית יחיד-טלומר טרה תעתיקים חי תאים21. המטרה של פרוטוקול מאויר כאן היא לתאר בפירוט את הפעולות הדרושות עבור הדור של טרה-MS2 שיבוטים.

כדי ליצור שיבוטים טרה-MS2, קלטת MS2 משולב בתוך האזור subtelomeric של טלומר 15q, במורד הזרם של טרה יזם האזור ואת שעתוק התחלה האתר. בקלטת MS2 מכילה גן עמידות neomycin ולצדו אתרי סלומון-p, בהיותה אינטגרטיבית-subtelomere 15q מתבצעת באמצעות מערכת CRISPR/Cas922. לאחר תקנים של MS2 קלטת, יחיד שיבוטים שנבחרו subtelomeric שילוב של הקלטת מאומת על ידי ה-PCR, כתם DNA רצף ובדרום. שיבוטים חיובי נגוע אדנו לבטא-Cre למען הסר סמן הבחירה בקלטת, עוזב רק רצפי MS2 ואתר לקס יחיד-p-subtelomere 15q. הביטוי של טרה מתויג MS2 הפרוטוקולים מ Tel15q מאומתת על ידי RT-qPCR. בסופו של דבר, בא לידי ביטוי החלבון פיוז'ן MS2-GFP ב- TERRA-MS2 שיבוטים דרך זיהום retroviral כדי להמחיש תעתיקים MS2-טרה על-ידי קרינה פלואורסצנטית מיקרוסקופ. טרה תעתיקים אפשר לזהות בקלות בעזרת RNA-דג, הדמיה לחיות תאים באמצעות telomeric חוזר ספציפי רגשים1,2,15,23. גישות אלה לספק מידע חשוב על הלוקליזציה של מכלל האוכלוסייה של טרה מולקולות ברזולוציה תא בודד. הדור של שיבוטים המכיל רצפי MS2 ב subtelomere יחיד יאפשר לחוקרים ללמוד את הדינמיקה של יחיד-טלומר תעתיקים טרה בתאים חיים, אשר יסייע להגדיר את תפקוד ואת מנגנוני הפעולה של טרה.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. הבחירה של שיבוטים Neomycin עמיד

  1. לגדל תאים AGS במדיום F-12_K של חזיר (Kaighn), בתוספת 10% עוברית שור סרום (FBS), 2 מ מגלוטמין פניצילין (0.5 יחידות לכל מיליליטר בינוני), סטרפטומיצין (0.2 µg לכל מיליליטר בינונית)-CO 37 ° C ו-5%2. Transfect התאים ב- 50-60% בשילוב עם sgRNA/Cas9 להביע וקטור, בקלטת MS2 בעשר: 1 יחס טוחנת21.
    הערה: בניסוי מקביל, לאמת תרביות תאים יעילות על ידי transfecting GFP-להביע וקטור (קרי, Cas9-GFP וקטורית). לפחות צריך להיות מושגת יעילות תרביות תאים 60-70%.
  2. למחרת, החלף את המדיום culturing בינוני המכיל neomycin-µg/mL 0.7 הסופי ריכוז (סלקטיבית בינוני).
    הערה: פיצול התאים, זריעה אותם אמצעי סלקטיבי יום אחרי תרביות תאים יזרז את תהליך הבחירה. כל התאים שאינם transfected ימותו מיד. אם תרביות תאים מבוצע ב 6 צלחות טוב, ובמקרה מכל קידוח ב 60% הנהרות יכיל כ 0.7 x 106 תאים, למחרת היום שניתן לפצל את התאים מבאר יחיד למדיום 10 ס מ מאכל המכיל סלקטיבי.
  3. לשמור את התאים במדיום סלקטיבי במשך 7-10 ימים, שינוי בינוני כל אחד או יומיים, עד יחיד שיבוטים גלויים.
  4. איסוף של שיבוטים תא
    1. להכין צלחת טוב 96 המכיל 10 µL של 0.25% טריפסין כל היטב.
      הערה: להכין שני 96 צלחות טוב למקרה שיבוטים יותר מ 96 צפויים להיבחר.
    2. עם השימוש של מיקרוסקופ, לסמן את המיקום של כל המשובטים גלוי בצלחת 10 ס מ על-ידי הפיכת נקודה בחלק התחתון של המנה באמצעות סמן. כל נקודה יתאים למושבת לאסוף אותם.
    3. החלף את המדיום culturing עם מספיק פוספט Buffered מלוחים (PBS) יוצרים סרט דק של נוזל על השיבוטים ולתת לא התאים יבש במהלך האיסוף שיבוט.
    4. לבחור אחת המושבות באמצעות פיפטה של 10 µL. לצרף את הטיפ המכיל 5 µL של טריפסין למושבה ולשחרר לאט טריפסין אשר יישאר מקומי על המושבה. לאפשר טריפסין לנתק את התאים עבור 1 דקות, ואז לגרד את המושבה עם הקצה תתמודד לתוך הקצה.
      הערה: במהלך הליך זה, היפוך המנה קצת בצד אחד אז כדי להקטין את הנפח של PBS סביב המושבה להיבחר יעזור בתהליך איסוף על ידי הימנעות דילול של טריפסין סביב המושבה. באמצעות טבעת גומי עשוי גם לסייע לאסוף שיבוטים יחיד.
    5. מקם את התאים מהמושבה לבאר של צלחת טוב 96 המכיל 10 µL של טריפסין 0.25%.
    6. דגירה 5 דקות בטמפרטורת החדר, ואז למלא את הבאר µL 150 סלקטיבי בינוני (F - 12K של חזיר (Kaighn) בינוני בתוספת 10% FBS, 2 מ מגלוטמין, פניצילין (0.5 יחידות לכל מיליליטר בינוני), סטרפטומיצין (0.2 µg לכל מיליליטר בינוני), המכיל neomycin ב ריכוז של 0.7 µg/mL.
      הערה: במהלך זמן הדגירה שיבוטים אחרים יכולים לבחור בהם. מומלץ לבחור שיבוטים רבים ככל האפשר. עוד שיבוטים נאספות יהיה גבוה יותר הסיכויים לזיהוי אלה חיובית.
    7. ברגע השיכפולים בחרה והעבירו בצלחת טוב 96, מאפשרים לתאים לגדול לכמה ימים סלקטיבי בינוני בינוני F - 12K של חזיר (Kaighn) בתוספת 10% FBS, 2 מ מגלוטמין, פניצילין (0.5 יחידות לכל מיליליטר בינוני), סטרפטומיצין (0.2 µg לכל mL בינוני), המכיל neomycin-ריכוז של µg/mL 0.7-37 מעלות צלזיוס ו-5% CO2, עד שהגיע למפגש 90%.
  5. פיצול של שיבוטים
    1. להכין שלוש צלחות טוב 96 מצופה עם ג'לטין על-ידי הוספת 100 µL של ג'לטין לכל טוב, תקופת דגירה של 30 דקות בטמפרטורת החדר, ולאחר מכן לשטוף פעמיים עם PBS. הצלחות האלה ישמש להפקת DNA (DNA צלחת) ועבור שיבוט קפוא (צלחות ההקפאה).
      הערה: ג'לטין תקדם את הקובץ המצורף של התאים ושל ה-DNA הבארות. בפרט, ציפוי הג'לטין יאפשר את ה-DNA מקל בתחתית הבארות במהלך הפקת דנ א. ולשטוף הליכים (נדון להלן). במהלך ההליך פיצול-שיבוט, מומלץ להשתמש עם פיפטה רב-ערוצי.
    2. ברגע שיבוטים להגיע למפגש 90%, תשאף בינוני מכל קידוח של צלחת טוב 96 לשטוף עם PBS, להוסיף 30 µL של 0.25% טריפסין לכל טוב, תקופת דגירה של 5 דקות ב 37 º C.
      הערה: יגדל בקצב שונה, אשר גם תלוי מספר התאים בחרה לכל שיבוט שיבוטים. לפיכך, צעד זה יבוצעו במהלך מספר ימים כאשר שיבוטים שונות להגיע למפגש 90%.
    3. להוסיף µL 70 סלקטיבי בינוני לכל טוב, לשבש גושים תא על-ידי pipetting למעלה ולמטה בתוך הבארות, ואז להעביר 30 µL של µL 100 הצלחת ה-DNA gelatinized שמולאו מראש עם 120 µL סלקטיבית בינוני לכל µL טוב ו-30 כדי gelatinized מקפיא צלחות שמולאו מראש העד h 50 µL בינונית (ללא בחירה).
    4. מקם את הצלחת ה-DNA בחממה ולאפשר לתאים לגדול ב 37 ° C ו 5% CO2 עד 90% הנהרות.
    5. להוסיף µL 80 של קרח טריות 2 x קפוא בינוני (80% FBS ו-20% דימתיל סולפוקסיד (דימתיל סולפוקסיד)) כל טוב של צלחת קופא, להוסיף מצלמות-מיקרוסקופים (ריסס עם 70% אתנול) על גבי הלוח כדי לאטום כל טוב, למקם את המכסה העליון, לעטוף את הצלחת עם רדיד אלומיניום. המקום הקפאת צלחות ב-80 מעלות צלזיוס.
    6. הוסף µL 90 סלקטיבי בינוני לכל טוב טוב המקורי 96 לצלחת המכילה שיבוטים פוצלו ולהשאיר אותה בתרבות עד ה-PCR הקרנת תוצאות. הצלחת הזו תשמש כמו צלחת גיבוי.

2. הקרנת שיבוטים Neomycin עמיד

  1. מיצוי DNA מהצלחת דנ א טוב 96.
    1. ברגע שיבוטים תרבותי בצלחת דנ א להגיע למפגש 90%, לשטוף 2 פעמים עם PBS, ולאחר מכן lyse עם מאגר פירוק µL 50 (10 מ מ טריס pH 7.5, 10 מ מ EDTA, 10 מ מ NaCl מרחביות 0.5%, 1 מ"ג/מ"ל proteinase K). כיסוי לצלחת עם מצלמות-מיקרוסקופים, איטום אחד טוב, שים את המכסה, לכסות עם הניילון הנצמד, במקום בגיל 37 º C למשך הלילה.
    2. להוסיף 100 µL קר אתנול (Et-OH) / פתרון NaCl (0.75 מ' NaCl ב- 100% אתנול) לכל אחד טוב לזרז במשך 6 שעות או ללילה בטמפרטורת החדר.
      הערה: הפרוטוקול אפשר לעצור כאן.
    3. להסיר את הפתרון Et-הו/NaCl על-ידי היפוך את הצלחת ולשטוף 3 פעמים עם 200 µL של 70% אתנול לכל טוב.
    4. להוסיף 25 µL של פתרון RNAse A במים מזוקקים, דגירה ב 37 ° C עבור 1 h.
  2. השתמש µL 3 של ה-DNA גנומי PCR הגברה. לבצע PCR הקרנת שיבוטים שנבחרו באמצעות תחל חישול בתוך גן עמידות neomycin, subtelomere 15q. PCR-הגברה מתבצעת באמצעות אנזימים פולימראז רגיל ו- PCR פרוטוקולים21.
    הערה: תנאים PCR MS2 צבעי יסוד (פריימר MS2-subtel15q-פריימר-S ו- MS2 בתור), תחל CTR (CTR ראש S ו- CTR פריימר כמו) הן הבאות: 98 ° C עבור 20 s שלב דנטורציה, ואז 34 מחזורים ב 98 ° C 10 s, 58 מעלות 20 s, s ° 72 ג 15 , באמצעות האנזים פולימראז µL 25 תגובה לערבב (ראה טבלה של חומרים). פריימר רצפים מסומנים בטבלה1.
  3. להפעיל תגובות PCR agarose ג'ל ולחלץ להקות PCR המתקבלים שיבוטים חיובי באמצעות ג'ל רגיל מיצוי הליכים (ראו טבלה של חומרים ג'ל החילוץ ריאגנטים).
  4. לבצע ניתוח רצפי ה-DNA של המוצר PCR ג'ל, חילוץ לאישור נוכחות של רצפי MS221.
    הערה: רצף הבדיקות ניתן לבצע באמצעות תחל את המשמש ההקרנה PCR.
  5. תספיג דנ א ההקרנה של PCR חיובית שיבוטים
    1. לגדול השיבוטים חיובי ב- PCR והקרנה רצף מהצלחת המקורית 96 היטב (את הצלחת גיבוי) כדי 6 צלחות היטב במדיום F - 12K של חזיר (Kaighn), בתוספת 10% FBS, 2 מ מגלוטמין, פניצילין (0.5 יחידות לכל מיליליטר בינוני), סטרפטומיצין (0.2 µg לכל mL בינוני), המכיל neomycin-ריכוז של µg/mL 0.7-37 ° C 5% CO2.
      הערה: לחלופין, אם חלק שיבוטים אלה אבדו, להפשיר אותם באחד הלוחות קפוא (ראה פרוטוקול 2.6).
    2. ברגע השיבוטים נמצאים 90% זרימה בתוך הצלחת טוב 6, לשטוף את התאים עם PBS ולהוסיף µL 250 פירוק מאגר המכיל proteinase µg 0.5 K לכל טוב.
    3. לגרד את התאים באמצעות מגרד תא ולהעביר את lysate צינור 1.5 מ.
    4. דגירה ב 37 מעלות צלזיוס במשך 16 שעות.
    5. להוסיף 1 מ"ל של 100% אתנול, לנער נמרצות, ולאפשר את ה-DNA לזרז לפחות 2 h או למשך הלילה ב-20 ° C.
      הערה: הפרוטוקול אפשר לעצור כאן.
    6. ספין-13,400 x ג'י ב- 4 מעלות צלזיוס למשך 10 דקות, למחוק את תגובת שיקוע, לשטוף את כדורי עם 70% אתנול. תנו לאוויר כדורי יבש בטמפרטורת החדר. לחלופין, השתמש concentrator ואקום.
    7. Resuspend את כדורי ה-DNA ב- 50 µL של מים מזוקקים המכילים RNAse A ואת תקופת דגירה של h 1-37 מעלות צלזיוס.
    8. לעכל µg 5-10 של ה-DNA גנומי באמצעות אנזימי הגבלה NcoI ו- BamHI (שני digestions עצמאית) בכרך התגובה µL 100 על ידי המקננת עיכול תגובות ב 37 מעלות צלזיוס למשך הלילה.
    9. הרץ 4 µL של העיכול agarose ג'ל (0.8% agarose) לאישור עיכול מלאה.
    10. להוסיף 1/10 נפח של סודיום אצטט פתרון 3 מ' pH 5.2 ו- 2 כרכים של 100% אתנול לתגובות עיכול הגבלה, דגירה לפחות 2 h או למשך הלילה ב-20 ° C, כדי לזרז את הדנ א.
      הערה: הפרוטוקול אפשר לעצור כאן.
    11. צנטריפוגה ב g x 13,400 ב 4 מעלות צלזיוס למשך 20 דקות, למחוק את supernatants, לשטוף את כדורי עם 70% אתנול. לאפשר את כדורי מהאוויר יבש בטמפרטורת החדר. לחלופין, השתמש concentrator ואקום.
    12. Resuspend כדורי ב 20 µL של מים מזוקקים, לטעון את ה-DNA מתעכל על ג'ל agarose 0.8%.
      הערה: עבור רזולוציה טובה יותר של ה-DNA מעוכל, להכין ג'ל לפחות 15 ס"מ זמן ולרוץ בין לילה מתח נמוך (̴30 וולט). צריך להיות מותאם אלקטרופורזה הגדר.
    13. למחרת, מכתים את הג'ל עם סוכן labelling דנ א, כגון אתידיום ברומיד-ריכוז סופי 1 מ"ל µL/10, למשך 30 דקות בטמפרטורת החדר, להצטלם עם סרגל קרוב הג'ל על ג'ל הדמיה כלי נגינה.
    14. הגדר את ההעברה של ה-DNA קרום ניילון ולבצע ממברנה הכלאה גשש רצף ספציפי MS2 באמצעות הליכים סטנדרטיים21.
    15. הפשרת שיבוטים הם חיוביים ב- PCR, DNA רצף ובדרום חשופה מאחד שתי צלחות קפוא (ראה שלב הבא).
  6. הפשרתו של שיבוטים
    1. להכין אחד 15 מ"ל שפופרת המכילה 5 מ"ל F - 12 K של חזיר מראש ומחוממת בינוני (Kaighn) בתוספת 10% FBS, 2 מ מגלוטמין פניצילין (0.5 יחידות לכל מיליליטר בינוני), סטרפטומיצין (0.2 µg לכל מיליליטר בינוני) עבור כל המשובטים להיות הקרת.
    2. הסר באחד הלוחות מקפיא-80 ° ולהוסיף µL 100 F12K מראש ומחוממת בינוני מלא טוב המכיל השיבוט חיובי כדי להיות הקרת.
      הערה: הליך זה צריך להתבצע במהירות, הצלחת היטב 96 להניחה על קרח יבש לאחר כל המשובטים מופשר הוא, על מנת לאפשר שיבוטים אחרים להישאר קפואה. הדבר חשוב במיוחד אם מספר שיבוטים צריך להיות הקרת מ באותה צלחת טוב 96.
    3. העבר את התאים הצינור 15 מ"ל המכיל 5 מיליליטר בינונית, צנטריפוגה ב 800 x g עבור 5 דקות בטמפרטורת החדר.
    4. האחות של המדיום, resuspend תאי µL 500 מראש ומחוממת בינוני F12K מלאה, להעביר כל המשובטים טוב יחיד של צלחת טוב 12.
  7. חיסול של הגן ההתנגדות neomycin מ בקלטת MS2 משולב ב subtelomere 15q.
    1. לאפשר שיבוטים לגדול מצלחת טוב 12 צלחת 10 ס מ בינוני F12K מלאה.
      הערה: Neomycin לא ייכללו בטווח הבינוני אלא אם צוין אחרת.
    2. להוסיף את הבעת-Cre אדנו התאים בתרבית בקערה 10 ס מ- 70% זרימה של 10 מ"ל של מדיום F12K מלאה.
      הערה: שימוש אדנו לביטוי של Cre-GFP תאפשר הערכה של היעילות של זיהום, אשר צריך לגשת 100%. אדנו שכפול תקינה יאבדו לאחר כמה קטעים בתרבות.
    3. 48 שעות לאחר ההדבקה, לפצל את התאים במנות 10 ס מ 3. שתי מנות ישמש עבור אימות של הסרת ג'ין neomycin לפי בחירה שלילי, גדל התאים המכילים neomycin בינוני (צלחת קודם), ולא על ידי הדרומי כתם (תבשיל השני).
    4. תרבות המנה השלישית המכיל שיבוט תא הקפאה, החילוץ-RNA.

3. אימות של טרה-MS2 ביטוי התעתיק לפי RT-qPCR

  1. עם האימות של הסרת ג'ין neomycin, מבצע החילוץ-RNA הכולל של טרה-MS2 שיבוטים שימוש בממסים אורגניים (פתרון פנול, guanidine isothiocynate)21.
    1. Resuspend את הרנ א מופק צלחת 10 ס מ ב- 100 µL diethyl pyrocarbonate (DEPC) מים.
    2. הרץ 3 µL של RNA denaturating (1% פורמלדהיד המכילות) 1 x 3-(N-Morpholino) propanesulfonic חומצה (MOPS) ג'ל על מנת לוודא ריכוז והתקינות של הרנ א. גם לנתח את ריכוז ה-RNA באמצעות ספקטרופוטומטרים.
    3. לטפל µg 3 של RNA עם DNAse אני משתמש 1 יחידה של DNAse אני האנזים בנפח 60 של התגובה האחרונה µL.
    4. דגירה התגובה עבור h 1-37 מעלות צלזיוס.
  2. הפוך ניתוחים התגובה ואת qPCR שעתוק
    1. הוספת הרכיבים הבאים צינור ללא נוקלאז microcentrifuge: µL 2 מיקרומטר 1 טרה פריימר ספציפי, µL 1 של dNTPs מיקס (10 מ מ כל אחד), µL 6 של RNA התייחסתי DNAse (תואם ל̴300ng RNA). לכוון את עוצמת הקול כדי µL 13 עם 4 µL DEPC מים.
      הערה: עבור כל RNA להיות מנותח, צינור השני המכיל את ריאגנטים אותו אבל פריימר ספציפי הפניה, במקום תחל ספציפי טרה, צריך להיות מוכן.
    2. מחממים את התערובת עד 65 מעלות צלזיוס למשך 5 דקות, דגירה קרח לפחות 1 דקות.
    3. לאסוף את התוכן של הצינורות על ידי צנטריפוגה קצר ולהוסיף 4 µL של 5 X RT האנזים מאגר, dithiothreitol 0.1 M 1 µL (DTT), µL 1 (4 יחידות) של מעכב RNAse ולאחר µL 1 של רוורס טרנסקריפטאז (ראה טבלה של חומרים).
    4. דגירה בדגימות ב 42 מעלות צלזיוס למשך 60 דקות, ולאחר מכן להשתמש µL 2 התגובה RT עבור ניתוחים qPCR.
  3. להכין תערובת התגובה qPCR באמצעי אחסון הסופי של 20 µL המורכב µL 10 מיקס מאסטר 2 x qPCR, 2 µL של תבנית cDNA, µL 1 של פריימר לפנים (10 מיקרומטר), µL 1 של פריימר הפוכה (10 מיקרומטר), ו 6 µL של מים.
  4. ביצוע qPCR התגובה thermocycler באמצעות פרוטוקולים סטנדרטיים21.

4. הייצור של רטרווירוס לבטא MS2-GFP

  1. כדי להפיק הרטרווירוס לביטוי MS2-GFP, transfect 80% confluent פיניקס אריזה תאים עם חלבון פיוז'ן MS2-GFP לבטא הרטרווירוס וקטור (pBabe-MS2-GFP PURO) וג'ין env להביע וקטור (כגון pCMV-VSVG) באמצעות יחס טוחנת 4:1 של שני וקטורים.
  2. למחרת, החלף המדיום culturing (DMEM בתוספת 10% FBS, 2 מ מגלוטמין ו עט/דלקת) טרי בינוני המכיל 10 מ מ נתרן butyrate.
  3. תקופת דגירה של 8 שעות ב 37 מעלות צלזיוס, 5% CO2, ולאחר מכן להחליף את המדיום טרי בינוני culturing שממנו ייאספו הוירוס.
  4. לאחר 48 שעות, הסר המדיום המכיל הרטרווירוס התאים פיניקס. בינוני ניתן להשתמש ישירות על זיהום של טרה-MS2 שיבוטים, ובמקרה לסנן המדיום דרך מסנן מיקרומטר 0.45, להוסיף polybrene (30 ריכוז סופי µg/mL) ולהוסיף אותו התאים (במקרה זה הפרוטוקול ממשיך בשלב 5). לחלופין, הרטרו וירוס יכול להיות זירז בשפופרת בז 50 מ על-ידי הוספת 1/5ה נפח של 50% פג-8000/900 מ מ פתרון NaCl המקננת בן לילה ב 4 ° C על גלגל מסובב.
  5. למחרת, גלולה חלקיקים הרטרווירוס על ידי צנטריפוגה ב g x 2,000 למשך 30 דקות, הסר את תגובת שיקוע ולאחר resuspend בגדר F12K בינוני ללא סרום.
    הערה: יכול להיות resuspended חלקיקי וירוס ב- 1/100th של אמצעי האחסון supernatant המקורי. בדיקת זיהום יש לבצעו על מנת לוודא נפח מינימלי של רטרווירוס נדרשים ביעילות להדביק את התאים.

5. ויזואליזציה של טרה-MS2 תעתיקים בתאים חיים

  1. צלחת טרה-MS2 שיבוטים ותאים WT AGS במנות עם תחתית זכוכית. ביום של זיהום, להוסיף polybrene את המדיום (30 ריכוז סופי µg/mL) ולהבין את הרטרווירוס לביטוי MS2-GFP.
  2. לאחר 24 שעות, למחוק את המדיום המכיל וירוס ולהוסיף בינוני טריים ללא פנול אדום.
  3. לנתח את התאים במיקרוסקופ הפוך הגדרה זו מיקרוסקופ המתאים. תמונה של התאים עם 100 X או המטרה X 60 עם מפתח נומרי גדול (1.4 X), בעזרת מצלמה רגישה (EMCCD). השתמש מערכת בקרת איכות הסביבה כדי לשמור את הדוגמאות-37 מעלות צלזיוס ו-5% CO2 במהלך דימות.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

איור 1 מייצג סקירה כללית של האסטרטגיה ניסיוני. השלבים העיקריים של הפרוטוקול, ציר מעיד לדור של טרה-MS2 שיבוטים בתאים AGS מוצגים (איור 1א'). יום 1, בארות מרובים של צלחת טוב 6 הם transfected עם קלטת MS2, sgRNA/Cas9 לבטא וקטורים (המוצג באיור 1B). שני רצפים ספציפיים 15q מדריך RNA subtelomere שונים הם משובטים בלהביע Cas9 nickase-pX335 וקטורית, יצירת שני וקטורים sgRNA-pX335 כי הם שיתוף transfected בקלטת MS2. יכול להיות transfected באר אחת של הצלחת עם GFP להביע וקטור כדי לוודא את יעילות תרביות תאים. יום 2, התאים trypsinized, הועבר מבאר יחיד צלחת 10 ס מ המכיל בינוני סלקטיבי. יום 3, יש לשנות בינוני כפי ביותר untransfected תאים ימותו. התאים גדלים בבחירה עד משובטים יהיו גלויים ולא מוכן לאסוף אותם. במהלך תקופה זו, תאים צריך לא להיות trypsinized ולא בינוני culturing צריך להיות שונה כל 1-2 ימים בשבוע הראשון, ואז כל 2-3 ימים לאחר מכן. ברגע שיבוטים יחיד גלויים, הם בחרו, הועבר לתוך צלחת טוב 96 איפה מותר להם לגדול עד שהגיע 80-90% של הנהרות. בשלב זה, שיבוטים הם נפרדו 4 שונה 96 טוב צלחות, אשר מסומנות באיור 1 עם קוד צבע. ברגע שיבוטים תרבותי בצלחת דנ א (ירוק) להגיע למפגש 80%, הם הם lysed ו DNA גנומי שחולצו עבור ה-PCR ההקרנה; השיבוטים בצלחת גיבוי (כחול) יישמר בתרבות עד בתוצאות ה-PCR הקרנה, ואילו הלוחות מקפיא אדום מוקפאים ב-80 מעלות צלזיוס. איור 2 B מראה תוצאות נציג של הקרנה PCR של שיבוטים neomycin עמידים. להקרנה הזה, משמשות שתי ערכות של צבעי יסוד: זוג אחד פריימר (MS2 תחל) חישול בתוך רצף 15q neomycin ג'ין, subtelomere משמש לאימות הנוכחות של קלטת MS2 (תמונת הנציגה של ההתאמה תחל מוצג איור 2א). השנייה תחל זוג (CTR primers) חישול-אזור כרומוזומלית הפנימי משמש לאימות הנוכחות של שיבוטים שלילי כוזב (פריימר רצפים הם הצביעו על טבלה 1). שיבוטים שלילי לשילוב של הקלטת צריך להיות שלילית ההגברה תחל MS2 חיוביים ההגברה תחל CTR. בעיות טכניות ב החילוץ דנ א גנומי והתוצאה היא העדר של הדנ א או זיהום שלה למנוע PCR הגברה של תגובות MS2 פריימר CTR. במקרים אלה, שיבוטים מעורבים יכולים להיות מחדש מוקרן על ידי ה-PCR על הפקת דנ א גנומי מהצלחת גיבוי. להקות המתקבל MS2 תחל הגברה של שיבוטים חיובי יכול להיות ג'ל, חילוץ, עוקב באמצעות תחל את MS2 כדי לאשר הנוכחות של רצפי MS2 עשר.

שיבוטים הם חיוביים ב- PCR ההקרנה הם בתרבית מהצלחת גיבוי טוב 96 (צלחת ההגשה באיור 1) על צלחת טוב 6, ואז lysed עבור הפקת דנ א גנומי וניתוחים תספיג דנ א. איור 2 D מראה להחליפן בתמונות של ג'ל (משמאל) ו קרום hybridized עם radioactively שכותרתה MS2 רצף מסוים של מכשיר בדיקה (מימין) הקרנה תספיג דנ א של ה-PCR חיובית שיבוטים. לאישור השילוב רצפי MS2 ב subtelomere 15q, צריך מתעכל דנ א גנומי מופק בכל שיבוט עם שני אנזימי הגבלה שונים (NcoI, BamHI) בתגובות עיכול נפרדים שני. אנזימי הגבלה NcoI ו- BamHI מתאימים עבור אימות של השילוב קלטת MS2 ב subtelomere 15q. ניתן להשתמש גם אנזימים אחרים. הג'ל מראה על העיכול מלאה של הדנ א באמצעות האנזים הגבלה BamHI, כפי שצוין על ידי הנוכחות של כתם. התוצאות של תספיג מציינים שאת אחד שיבוט הוא חיובי לשילוב של קלטת MS2 ב subtelomere 15q בעוד מספר שיבוטים מציגים שילוב מרובים, אירועי בקלטת, כפי שצוין על ידי הנוכחות של להקות מרובים. שיבוט חיובית צריך להיות מנותח על ידי תספיג השני על NcoI עיכול של דנ א גנומי21. תמונת הנציגה של קלטת subtelomere 15q המכיל את MS2 ואת המיקום של אתרי BamHI אנזים הגבלה NcoI מוצג באיור 2C.

יבויחה שיבוטים PCR, תספיג ניתוחים נגועים עם אדנו לביטוי Cre-GFP כדי להסיר את הגן neomycin נוכח בקלטת MS2. איור 3 A מתאר את subtelomere מתויג MS2 15q לפני ואחרי Cre ביטוי. תמונה של שיבוט חיובי עבור השילוב קלטת MS2 ב subtelomere 15q נגוע Cre-GFP אדנו לביטוי מוצג באיור 3ב'. עבור הסרה מלאה של הגן neomycin בתוך כל התאים, היעילות זיהום אמורים להגיע כ- 100%. כפי שמוצג באיור 3C, על מנת לוודא חיסול של הגן neomycin, Cre-GFP נגוע תאים הם נפרדו שלוש צלחות לאחר 48 שעות של הזיהום. לוח אחד תרבותי בנוכחות neomycin. כל התאים. על הצלחת הזו צריכה למות תוך 6-7 ימים. בצלחת השניה, יורשו תאים לגדול במדיום מלאה ללא בחירה למפגש 80-90%. בשלב זה, דנ א גנומי חילוץ, נותחו על ידי תספיג דנ א. הלוח השלישי הוא תרבותי במדיום מלאה כדי לאפשר הכנת המלאי קפוא של השיבוט, לחילוץ RNA וניתוחים RT-qPCR טרה-MS2 התעתיק הביטוי. איור 3 D מראה להחליפן בתמונות של ניתוחים תספיג דנ א של שיבוט חיובית לפני ואחרי זיהום Cre-GFP. ה-DNA agarose ג'ל (תמונה משמאל) מאשר העיכול מלאה של ה-DNA גנומי באמצעות האנזים NcoI הגבלה... תספיג דנ א ניתוח בוצע באמצעות מכשיר radioactively שאותה ניתן להתאים MS2-רצף ספציפי בדיקה (תמונה מימין). ניתוח זה מאשר ההסרה של הגן neomycin... הנוכחות של כתם במדגם Cre-GFP נגוע מאשר השילוב telomeric של רצפי MS2... המיקום של האתרים הגבלת NcoI בתוך subtelomere 15q מוצג באיור 3א.

לאחר חיסול של הגן ההתנגדות neomycin הוא אישר, השיבוטים ניתן לבחון את הביטוי של טרה-MS2 הפרוטוקולים. לכוונה זו, RNA הכולל הוא מופק כל המשובטים ולהפעיל על ג'ל מגבים denaturating כדי לוודא את תקינותו (איור 4א). להקות Ribosomal RNA צריך להיות גלוי בבסיסים 4,700 (rRNA 28S) ובסיסים 1,900 (rRNA 18S). התגובה Retrotranscription מתבצעת באמצעות פריימר חוזר ספציפי telomeric וכל התייחסות גנים ספציפיים פריימר (איור 4ב', בראש) בזמן ניתוח qPCR של הביטוי טרה יבוצעו באמצעות שתי קבוצות של צבעי יסוד: פריימר אחד זוג חישול בתוך הרצף MS2 ואת הרצף subtelomere 15q; זוג השנייה תחל חישול בתוך subtelomere 15q. פריימר רצפים מסומנים בטבלה 1. הגרף המוצג באיור 4B מראה RT-qPCR ניתוחים של הביטוי טרה מן התאים AGS WT שני שכפולים טרה-MS2 שונים. ניתוחים אלה אשר הביטוי של טרה-MS2 תעתיקים של שיבוטים שתי רמות זה דומות תעתיקים טרה הביע מ subtelomere 15q בתאים WT. נתונים אלה מצביעים על שני טרה-MS2 שיבוטים שנבחרו מתאימים לכל הניתוחים של טרה-MS2 הפרוטוקולים על ידי הדמיה תא חי.

על מנת להמחיש טרה-MS2 תעתיקים בתאים חיים, שיבוטים שנבחרו נגועים רטרווירוס לבטא את חלבון כימרי MS2-GFP. איור 5 א מציג את ההליך כדי ליצור הרטרווירוס לביטוי MS2-GFP, כפי שמתואר בשלב פרוטוקול 4. תאים AGS WT, טרה-MS2 שיבוטים נגועים במנות עם תחתית זכוכית. לאחר 24 שעות של הזיהום, תאים מנותחים על-ידי קרינה פלואורסצנטית מיקרוסקופ. ייחודה של האות אושר על ידי הנוכחות של טרה-MS2-GFP foci זוהה בגרעין של טרה-MS2 שיבוטים ולא התאים AGS WT (איור 5B). אוכלוסיה של MS2-GFP לבטא תאים, הטרוגניות מבחינת רמות MS2-GFP בין תאים צפוי, יש לבחור תאים המבטאים רמות נמוכות עבור הניתוחים הדמיה. לחלופין, התאים מבטאים MS2-GFP ניתן למיין לפי ניתוחים קודמים מיקרוסקופ FACS כדי לאסוף את subpopulation של תאים המבטאים רמות נמוכות של GFP. בעבר זיהינו foci טרה-MS2-GFP ב 40%-60% של תאים של AGS טרה-MS2 שיבוטים21. בתאים אלה, אחד עד ארבעה מוקדים טרה-MS2-GFP היו עם תמונה לכל תא. טרה-MS2-GFP foci המציגה דינמיקה וגדלים שונים יכול להיות שזוהו21. טרה-MS2 שיבוטים ניתן ללמוד את הדינמיקה של יחיד-טלומר תעתיקים טרה בתאים חיים. כדוגמה של יישום זה, מציג איור 5C נציג תמונות מניתוחי מיקרוסקופיה של שיבוט טרה-MS2 לבטא את חלבון כימרי MS2-GFP, החלבון טלומר-איגוד ש-trf2 דבוקה mCherry על מנת דמיינו טרה מתויג MS2 תעתיקים של טלומרים בתאים חיים. באמצעות גישה זו, בעבר הבחנו טרה-MS2-GFP foci לשפה משותפת עם טלומרים ב- 44% של התאים, המציין כי טרה תעתיקים רק transiently משותף לשפה עם כרומוזום קצוות AGS תאים21.

Figure 1
איור 1 . סקירה של אסטרטגיה ניסיוני, מעיד על ציר הזמן לדור של טרה-MS2 שיבוטים בתאים AGS. A) השלבים המתוארים את הפרוטוקול ואת קו הזמן מעיד על הבחירה של טרה-MS2 שיבוטים מוצגים. התאים הם transfected בצלחת טוב 6 עם קלטת MS2 ליניארית, sgRNA/Cas9 לבטא וקטורים. קוד צבע משמש כדי להבדיל את הצלחת ה-DNA, את הצלחת גיבוי והלוחיות מקפיא המצוין בסעיף פרוטוקול. B) קלטת MS2 מורכב מרצף ארוך subtelomere 15q nt 800 ואחריו 10 חזרות של הרצף MS2 ואת גן עמידות neomycin, ולצדו סלומון-p אתרי מסתיימת עם 300 nt telomeric זמן אני חוזר חבל בקצה 3'. וקטורים לביטוי sgRNA/Cas9 נוצרו על-ידי שיבוט subtelomere מדריך ספציפי 15q RNA רצפי וקטור pX335 באמצעות21,22אתר ההגבלה BbsI. נוצרו שני וקטורים שונים sgRNA-pX335, שילוב 1:1 של שני וקטורים שומש על תרביות תאים. מסדרות sgRNAs מסומנים בטבלה 1. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 . להחליפן בתמונות של ה-PCR ובדרום כתם ההקרנה של שיבוטים עמיד neomycin. A) תמונת הנציגה של subtelomere 15q המכיל את הקלטת MS2. המיקום של תחל MS2 (פריימר MS2-subtel15q-פריימר-S ו- MS2 כמו) המשמש לסינון PCR מסומן. האתרים loxP מתנה בתוך בקלטת מוצגים באדום. B) תמונת הנציגה של PCR ההקרנה של שיבוטים neomycin עמיד באמצעות סט שני של צבעי יסוד, תחל MS2 תחל CTR (CTR ראש S ו- CTR פריימר בתור). C) תמונת הנציגה של subtelomere 15q המכיל את הקלטת MS2. באתרים מגבלת BamHI ו- NcoI המכשיר MS2 המשמש ההקרנה תספיג מוצגים. D) שמאל: µg 10 של ה-DNA גנומי לכל המשובטים היו מתעכל עם BamHI, על ג'ל agarose הפעלה. התמונה נרכשה לאחר ללון לרוץ במהירות 30 וולט. מימין: דנ א גנומי מתעכל עם אנזים הגבלה BamHI הועבר קרום ניילון הטעון חיובית, hybridized עם מכשיר בדיקה ספציפית רצף MS2 מתויג radioactively. התיבה האדומה מציין את הגודל הצפוי של הלהקה חיובי. החץ האדום מציין אחד שיבוט חיובי. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3 . חיסול neomycin ההתנגדות הניסויים ג'ין ואימות. A) תמונת הנציגה של subtelomere 15q המכיל את הקלטת MS2 לפני ואחרי Cre הביטוי. המכשיר הספציפי MS2 המשמש עבור ניתוחים תספיג ואתרים אנזים הגבלה NcoI מוצגים. האתרים loxP מתנה בתוך בקלטת מוצגים באדום. B) קרינה פלואורסצנטית ניתוח מיקרוסקופיה של שיבוט טרה-MS2 נגוע אדנו לביטוי Cre-GFP. תמונת הנציגה רכשה מטוס מוקד בודד מוצג. MOI, ריבוי של זיהום, הוא היחס בין מספר וירוסים המשמשים את הזיהום ואת המספר של התאים המארחים. סרגל קנה מידה: 30 מיקרומטר C) סקירה של האסטרטגיה ניסיוני המשמש לאימות חיסול של הגן neomycin. Cre-GFP נגוע תאים הם נפרדו שלוש צלחות לאחר 48 שעות של הזיהום הבחירה i) שלילי, ניתוחים ii) תספיג דנ א, iii) הכנת תא קפוא המלאי והפקת RNA. ניתוחים תספיג דנ א יח) של טרה-MS2 לשכפל לפני ואחרי זיהום אדנו Cre-GFP. µg 10 של ה-DNA גנומי היו מתעכל עם האנזים הגבלת NcoI. Agarose ג'ל מאשרת כי עיכול מלאה מושגת בשתי שיבוטים (משמאל). ה-DNA גנומי מתעכל הועבר קרום ניילון הטעון חיובית, hybridized באמצעות בדיקה ספציפית רצף MS2. חיסול מוחלט של הגן neomycin אושר על ידי העדר של הלהקה ספציפיים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4 . RT-qPCR ניתוחים של תל15q-טרה ו תל15q-טרה-MS2 ביטוי תעתיקים. A) תמונת הנציגה של ג'ל MOPS מראה RNA הכולל שחולצו מן התאים AGS WT טרה-MS2 שיבוטים. להקות המתאימים RNAs ribosomal מסומנים 28S ו- 18S. B) העליון: תיאור סכמטי של MS2 מתויג subtelomere 15q לבטא תעתיקים טרה. תחל המשמש טרה retrotranscription (צהוב) וניתוחים qPCR של Tel15q-טרה (כחול) ו- Tel15q-MS2 טרה (אדום) מוצגים. האתר loxP מוצגים באדום. למטה: RT-qPCR ניתוחים של הביטוי תעתיקים Tel15q-טרה טרה Tel15q-MS2 AGS WT תאים, טרה-MS2 שיבוטים. p < 0.05, אינטראקצית t-מבחן. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5 . תא חי הדמיה ניתוחים של טרה-MS2 שיבוטים. A) סקירה כללית של ההליך כדי לייצר רטרווירוס לביטוי MS2-GFP, כפי שמתואר בשלב פרוטוקול 4. שרטוט של subtelomere מתויג MS2 15q, תעתיקים טרה מזוהה על-ידי החלבון פיוז'ן MS2-GFP מוצג מימין. B) זריחה נציג תמונת מיקרוסקופ של AGS WT, שני טרה-MS2 שיבוטים לבטא MS2-GFP. טרה-MS2-GFP foci מסומנים באמצעות החצים. תמונות נרכשו באמצעות ספינינג דיסק מיקרוסקופ קונפוקלי מצויד עם מצלמת EMCCD. התמונות נלקחו בשבי באמצעות 100 X / 1.46 מטרת עדשה אפוכרומטית תא הדמיה ומתוחזק על 37 ° C עם 5% CO2. לייזר 488 שימש מקור האור. סרגל קנה מידה: 5 מיקרומטר. C) תא חי הדמיה ניתוחים של טרה-MS2-GFP foci ו- TRF2-mCherry שכותרתו טלומרים. אירוע משותף לשפות אחרות בין מוקד טרה-MS2-GFP טלומר יחיד מוצג. תמונות נרכשו כמו B, באמצעות לייזרים 488 ו 520 בתור מקור האור. הקרנה מקסימלי של ניסוי מחסנית z שבוצעה במועד יחיד נקודת זמן לשגות ניסוי הדמיה מוצג. סרגל קנה מידה: 5 מיקרומטר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

פריימר שם פריימר רצף יישום
MS2-subtel15q-פריימר-S TGCATTAAAGGGTCCAGTTG MS2 פריימר לפנים בשימוש להקרנה PCR של שיבוטים neomycin עמיד
פריימר MS2 כמו CCTAACTGACACACATTCCACAGA פריימר MS2 הפוכה המשמש לסינון PCR של שיבוטים neomycin עמיד
CTR פריימר S TGT ACG המרכז לאמנות עכשווית ACA חטיבתי TGC TG CTR פריימר לפנים בשימוש PCR ההקרנה של שיבוטים neomycin עמיד
CTR פריימר כמו לשממ יניינעל ילבולגה דרשמה GCT AGG TGG ACA GCG ב A CTR פריימר הפוכה בשימוש PCR ההקרנה של שיבוטים neomycin עמיד
Tel15q-S1 GCAGCGAGATTCTCCCAAGC פריימר הגיוני להשתמש כדי לזהות ביטוי Tel15q ו- Tel15q-MS2 טרה על ידי qPCR
hTel15q-כ TAACCACATGAGCAATGTGGGTG פריימר antisense המשמש לזיהוי הביטוי Tel15q ו- Tel15q-MS2 טרה qPCR
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG פריימר antisense המשמשים לזיהוי הביטוי טרה Tel15q MS2 על ידי qPCR
טרה-RT-פריימר CCCTAACCCTAACCCTAACCCTAACCCTAA פריימר המשמש retrotranscription של הפרוטוקולים טרה
sgRNA1 TTGGGAGAATCTCGCTGGCC רצף של מדריך קצר RNA 1 משובטים ב וקטור pX335 ומשמש ישירה Cas9 nickase אנזימטי פעילות subtelomere 15q
sgRNA2 TGCATTAAAGGGTCCAGTTG רצף של מדריך קצר RNA 2 שיבטה ב וקטור pX335 ומשמש ישירה Cas9 nickase אנזימטי פעילות subtelomere 15q

טבלה 1 : רשימת תחל השתמשו במחקר זה. רשימה של תחל את רצפי sgRNAs בשימוש פרוטוקול זה הינם מסופקים. רצפים הם 5' ל 3'.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

במאמר זה אנו מציגים שיטה לייצר שיבוטים תאים סרטניים אנושיים המכיל רצפי MS2 משולב בתוך subtelomere 15q. באמצעות שיבוטים אלה, מולקולות טרה מתויג MS2 עיבד מ subtelomere 15q מזוהים על-ידי קרינה פלואורסצנטית מיקרוסקופ על ידי ביטוי משותף של חלבון פיוז'ן MS2-GFP. גישה זו מאפשרת לחוקרים ללמוד את הדינמיקה של טרה הביע אחד טלומר חי תאים21. ב פרוטוקול זה, טרה-MS2 שיבוטים שנבחרו בשורה תא AGS, אשר מייצג מערכת מודל מעניין ללמוד טרה, שכן הביטוי טרה הוא upregulated דגימות סרטן הקיבה אנושי24. עם זאת, פרוטוקול המתוארים כאן ניתן להתאים עבור הבחירה של טרה-MS2 שיבוטים בשורות תאים אחרים. השילוב של רצפי MS2 באופן עקרוני ניתן לפתח ב subtelomere שונה טלומר 15q באמצעות של קלטת MS2 ספציפי ואסטרטגיה CRISPR. השיטה המוצגת כאן, אנזים nickase Cas9, מדריך זוגי RNAs מועסקים על מנת להגביר את ייחודה של אינטגרציה22. באמצעות אסטרטגיה זו, % 2 הכוללת של שיבוטים חיובי צפויים להיות מזוהה בתאי AGS. גירסאות אחרות של האנזים Cas9 יכול להיבדק בניסיון להגדיל את שיעור ההצלחה של בחירת שיבוטים25. בנוסף, השלבים הבאים של הפרוטוקול הן הקריטיות לקחת בחשבון כדי למקסם את היעילות של הבחירה שיבוט:

I) על מנת להגדיל את הסיכוי של בחירת שיבוטים טרה-MS2, זה חשוב להשיג יעילות של תרביות תאים גבוהה בקלטת MS2 ווקטורים CRISPR. שורות תאים גרוע transfected ידרוש רוב הסיכויים כמה סבבים של תרביות תאים, שיבוט בחירה, סינון לשם בחירת שיבוטים חיובי.

II) חשוב לקבוע ריכוז neomycin לשימוש עבור בחירת השיבוטים מדויקים. ואכן, באמצעות ריכוז נמוך של התרופה תגרום שיבוטים חיובי כוזב בזמן ריכוז גבוה עשוי למנוע את הזיהוי של שיבוטים חיובי. ריכוז neomycin המצוין פרוטוקול זה הוא קטלני על התאים AGS תוך 6-7 ימים מן התוספת המדיום culturing

III) שיבוט האיסוף הוא שלב קריטי. ואכן, במהלך ההליך זה נדרש שיבוטים היחידה נאספים. משום כך, מושבות שנמצאים קרוב שאחד לשני להימנע כדי למנוע ערבוב תאים מן שיבוטים שונה, וכתוצאה מכך הבחירה של אוכלוסייה מעורבת של שיבוטים אשר עשוי להכיל רצפי MS2 משולב באתרים מרובים גנומית. אירועים אלה צריך להיות מזוהה במהלך ההקרנה תספיג דנ א.

IV) את כמות ה-DNA גנומי מופק confluent 96 טוב DNA צלחת (פרוטוקול 2) מוערך בסביבות 5 µg, יספיק למסך כל המשובטים ע י PCR סופג הדרומי עיכול אנזים הגבלה יחיד. עם זאת, כדי לאשר את השילוב של הקלטת-הצפוי טלומר, זה יהיה חשוב לסנן כל המשובטים על-ידי תספיג דנ א על ידי ה-DNA גנומי עם שני אנזימי הגבלה שונה. לכוונה זו, כמצוין בפרוטוקול, שיבוטים חיובי ב- PCR ההקרנה צריך להיות בתרבית ב 6 צלחות היטב. כמות ה-DNA גנומי מופק טוב של צלחת טוב 6 יהיה מספיק לפחות שני digestions הגבלה הדרושים עבור הניתוחים תספיג דנ א.

בפרוטוקול המתוארים כאן, רצפי MS2 משולבים בתוך subtelomere 15q עבור מספר סיבות: אני) אזור יחצ ן טרה ואתרים התחלה שעתוק טרה זוהו זה26,subtelomere27; ii) טרה ביטוי מ subtelomere 15q אומתה באמצעות במבחנה טכניקות4,27,28,29,30; iii) יש כבר וסודרו אזור subtelomeric של כרומוזום 15q והוא מכיל אזור הייחודית בסמוך דרכי חזרה telomeric זה ניתן לפלח לשילוב של מגירות MS221. PCR וגישות תספיג פותחו על מנת לאשר שילוב יחיד רצפי MS2 בתוך subtelomere 15q ב- TERRA-MS2 שיבוטים. זה יהיה מעניין גם ביצוע ניסויים DNA-דג על כרומוזום כפולות כדי להמחיש לוקליזציה כרומוזומליות של רצפי MS2 קבוע מפה של כרומוזומים. עם זאת, האורך של 10xMS2 רצף (450 bp) כופה את השימוש הגששים קצר מאוד לעומת הגששים משמשים בדרך כלל DNA-דג ניסויים על כרומוזום כפולות (חיידקי כרומוזומים המלאכותי (Bac), cosmids או פלסמידים)31. אתגר טכני זה מנעה מאיתנו להמחיש את רצפי MS2 על המרווחים כרומוזום המייצגת מגבלה של הפרוטוקול. מגבלה נוספת אחת של השיטה הוא הזמן את המאמץ הנדרש לבחירת שיבוטים טרה-MS2. בנוסף, מעבדה ספציפי וציוד לשימוש של וירוסים, חומר רדיואקטיבי וניתוחים מיקרוסקופ נדרשים.

השיטה המתוארת כאן יכול להיות מיושם עבור הדור של טרה-MS2 שיבוטים בשורות תאים שונים על מנת להגדיר את הדינמיקה של טרה בהקשרים ביולוגיים שונים, כגון במהלך טלומר בתפקוד או סלולרי הזדקנות ביולוגית, עוזר לנו להבין הפונקציה של טרה בתהליכים אלה. התפתחות מעניינת של גישה זו יהיה הדור של שיבוטים טרה-MS2 המכיל TetO חוזר משולב ב subtelomere ספציפיים, כולל את טלומר מתויג MS2. הביטוי של חלבון טטריס למצוא דבוקה חלבון פלואורסצנטי (קרי: mCherry) יאפשר ויזואליזציה של זה טלומר מסוים חי תאים32. גישה זו תאפשר חקירה של האדם תעתיקים טרה לשפה ולפעול ב- cis -טרה תעתיק טלומר, כרומוזום, או טרנס עם המעבר כרומוזום אחרים. שאלה זו בביולוגיה של טרה נשאר הבהרה.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים מצהירים אין אינטרסים כלכליים מתחרים

Acknowledgments

. אנחנו אסירי תודה על הסגל של המתקן הדמיה מתקדמות של CIBIO ב אוניברסיטה של טרנטו (trento), המתקן מיקרוסקופ אור BioOptics-מעבדות פרוץ פ מקס (MFPL) בווינה. המחקר שהוביל את התוצאות הללו קיבלה מימון מן Stiftung Mahlke-Obermann של תכנית המסגרת השביעית של האיחוד האירופי למחקר, פיתוח טכנולוגי, הפגנה תחת גרנט הסכם אין 609431 כדי לכלכלת EC נתמך על ידי מלגת ריטה לוי Montalcini איטלקית משרד החינוך ואוניברסיטת המחקר (MIUR).

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
הדור של סרטן התא שיבוטים כדי להמחיש Telomeric המכילים חוזר RNA טרה הביע מ טלומר יחיד בתאים חיים
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter