Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

कैंसर सेल क्लोन की पीढ़ी Telomeric दोहराने-युक्त आरएनए टेरा कल्पना करने के लिए जीवित कोशिकाओं में एक एकल Telomere से व्यक्त

doi: 10.3791/58790 Published: January 17, 2019

Summary

यहां, हम एक एकल subtelomere में एक MS2 अनुक्रम टैग युक्त कैंसर सेल क्लोन उत्पंन करने के लिए एक प्रोटोकॉल प्रस्तुत करते हैं । इस दृष्टिकोण, MS2 पर भरोसा-GFP प्रणाली, telomeric दोहराने युक्त आरएनए (टेरा) के अंतर्जात टेप के दृश्य में सक्षम बनाता है रहने वाले कोशिकाओं में एक ही telomere से व्यक्त की ।

Abstract

Telomeres लिखित हैं, telomeric दोहराने-युक्त लंबे समय से कोडिंग RNAs (टेरा), जिसमें heterochromatin गठन और telomere लंबाई homeostasis सहित telomere जीवविज्ञान में महत्वपूर्ण भूमिका निभाने का प्रस्ताव किया गया है, को जंम दे रही है । हाल के निष्कर्षों से पता चला कि टेरा अणु भी आंतरिक गुणसूत्र क्षेत्रों के साथ बातचीत करने के लिए माउस भ्रूण स्टेम (ES) कोशिकाओं में जीन अभिव्यक्ति को विनियमित । इस प्रमाण के साथ लाइन में, आरएनए प्रतिदीप्ति में सीटू संकरण (आरएनए-मछली) विश्लेषण से पता चला है कि केवल टेरा टेप का एक सबसेट गुणसूत्र में स्थानीयकृत समाप्त होता है । टेरा अणुओं की गतिशीलता की एक बेहतर समझ में मदद मिलेगी उनके समारोह और कार्रवाई के तंत्र को परिभाषित । यहां, हम एक विधि का वर्णन करने के लिए लेबल और MS2-GFP प्रणाली का उपयोग कर कैंसर की कोशिकाओं में एकल telomere टेरा टेप कल्पना । इस उद्देश्य के लिए, हम एक प्रोटोकॉल वर्तमान स्थिर क्लोन उत्पंन करने के लिए, AGS मानव पेट कैंसर सेल लाइन का उपयोग कर, MS2 एक एकल subtelomere में एकीकृत अनुक्रम युक्त । MS2 से टेरा के प्रतिलेखन-MS2 की अभिव्यक्ति में telomere परिणाम टैग-टेरा अणुओं है कि जी द्वारा कल्पना कर रहे है-सेल प्रतिदीप्ति माइक्रोस्कोपी सह पर एक MS2 आरएनए-बाध्यकारी प्रोटीन की अभिव्यक्ति GFP (MS2-GFP) से जुड़े । यह दृष्टिकोण शोधकर्ताओं को एक कैंसर की कोशिकाओं में telomere टेरा अणुओं की गतिशीलता का अध्ययन करने के लिए सक्षम बनाता है, और यह अंय सेल लाइनों के लिए लागू किया जा सकता है ।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

लंबे समय से डिकोडिंग आरएनए टेरा गुणसूत्रों के subtelomeric क्षेत्र से लिखित है और गुणसूत्र की ओर अपनी प्रतिलेखन आय समाप्त होता है, telomeric दोहराने पथ1,2के भीतर समाप्त । इस कारण से, टेरा टेप subtelomeric से मिलकर बनता है-उनके ' 5 अंत में दृश्यों व्युत्पंन और telomeric दोहराता के साथ समाप्त (रीढ़ में UUAGGG)3। महत्वपूर्ण भूमिकाओं टेरा के लिए प्रस्तावित किया गया है, telomeres में heterochromatin गठन सहित4,5, डीएनए प्रतिकृति6, गुणसूत्र के बीच मुताबिक़ पुनर्संयोजन को बढ़ावा देने के7,8 समाप्त होता है , 9, विनियमन telomere संरचना10और telomere लंबाई homeostasis2,11,12,13। इसके अलावा, टेरा टेप कई extratelomeric साइटों के साथ बातचीत करने के लिए माउस भ्रूण स्टेम में व्यापक जीन अभिव्यक्ति को विनियमित (ES) कोशिकाओं14। इन सबूत के साथ लाइन में, आरएनए प्रतिदीप्ति में सीटू संकरण (आरएनए-मछली) विश्लेषण से पता चला है कि केवल टेरा टेप का एक सबसेट telomeres1,2,15पर information. इसके अतिरिक्त, टेरा को माउस कोशिकाओं2,16में एक्स और वाई गुणसूत्रों में स्थानीयकरण के लिए परमाणु समुच्चय के रूप में सूचित किया गया है । इन निष्कर्षों से संकेत मिलता है कि टेरा टेप नाभिक के भीतर जटिल गतिशीलता से गुजरना । टेरा अणुओं की गतिशीलता को समझने में मदद उनके समारोह और कार्रवाई के तंत्र को परिभाषित करेगा ।

MS2-GFP प्रणाली को व्यापक रूप से विभिन्न जीवों17,18से जीवित कोशिकाओं में आरएनए अणुओं कल्पना करने के लिए प्रयोग किया गया है । इस प्रणाली को पहले टैग और एस cerevisiae12,19में एकल telomere टेरा अणुओं कल्पना किया गया है । इस प्रणाली का प्रयोग, यह हाल ही में दिखाया गया है कि खमीर टेरा टेप पोस्ट के दौरान कोशिका द्रव्य के भीतर स्थानीयकरण-diauxic बदलाव चरण, सुझाव है कि टेरा extranuclear कार्यों20लागू हो सकता है । हम हाल ही में उपयोग किया है MS2-GFP प्रणाली के अध्ययन के लिए एकल-telomere टेरा टेप कैंसर कोशिकाओं में21। इस उद्देश्य के लिए, हम CRISPR/Cas9 जीनोम संपादन उपकरण कार्यरत एक एकल telomere में MS2 दृश्यों को एकीकृत (telomere 15q, इसके बाद Tel15q) और प्राप्त MS2-अंतर्जात Tel15q टेरा (टेरा-MS2 क्लोन)-टैग व्यक्त क्लोन । एक GFP-आपस में जुड़े MS2 आरएनए-बाइंडिंग प्रोटीन (MS2-GFP) की सह-अभिव्यक्ति, जो पहचानता है और बांधता है MS2 आरएनए अनुक्रम एकल-telomere टेरा टेप के दृश्य में सक्षम बनाता है रहने वाली कोशिकाओं में21। यहां सचित्र प्रोटोकॉल का उद्देश्य विस्तार में टेरा-MS2 क्लोनों की पीढ़ी के लिए आवश्यक कदम का वर्णन है ।

टेरा-MS2 क्लोन उत्पंन करने के लिए, एक MS2 कैसेट telomere 15q, टेरा प्रमोटर क्षेत्र और प्रतिलेखन प्रारंभ साइट के बहाव के subtelomeric क्षेत्र के भीतर एकीकृत है । MS2 कैसेट एक निओमायसिन प्रतिरोध लोक्स-पी साइटों द्वारा पार्श्व जीन होता है, और subtelomere 15q में अपने एकीकरण CRISPR/Cas922प्रणाली का उपयोग किया जाता है । MS2 कैसेट के अभिकर्मक के बाद, एकल क्लोन का चयन कर रहे है और कैसेट के subtelomeric एकीकरण पीसीआर, डीएनए अनुक्रमण और दक्षिणी दाग द्वारा सत्यापित है । सकारात्मक क्लोन एक Cre-व्यक्त एडीनोवायरस से संक्रमित करने के लिए कैसेट में चयन मार्कर को दूर करने के लिए, केवल MS2 दृश्यों और एक भी लोक्स-पी साइट subtelomere 15q में छोड़ रहे हैं । MS2 की अभिव्यक्ति-Tel15q से टैग टेरा टेप आरटी द्वारा सत्यापित है-qPCR । अंत में, MS2-GFP फ्यूजन प्रोटीन retroviral संक्रमण के माध्यम से टेरा-MS2 क्लोन में व्यक्त की है क्रम में MS2 माइक्रोस्कोपी द्वारा प्रतिदीप्ति-टेरा टेप कल्पना है । टेरा टेप आसानी से आरएनए द्वारा पता लगाया जा सकता है-मछली और लाइव सेल इमेजिंग का उपयोग telomeric दोहराने विशिष्ट जांच1,2,15,23। इन दृष्टिकोण एकल सेल संकल्प पर टेरा अणुओं की कुल जनसंख्या के स्थानीयकरण पर महत्वपूर्ण जानकारी प्रदान करते हैं । एक एकल subtelomere में MS2 दृश्यों युक्त क्लोन की पीढ़ी के शोधकर्ताओं ने एक जीवित कोशिकाओं है, जो समारोह और टेरा की कार्रवाई के तंत्र को परिभाषित करने में मदद मिलेगी में telomere टेरा टेप की गतिशीलता का अध्ययन करने के लिए सक्षम हो जाएगा ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. निओमायसिन प्रतिरोधी क्लोनों का चयन

  1. है हैम एफ में AGS कोशिकाओं बढ़ो-12K (Kaighn) मध्यम 10% भ्रूण गोजातीय सीरम (FBS) के साथ पूरक, 2 मिमी एल-glutamine, पेनिसिलिन (०.५ मध्यम प्रति मिलीलीटर), और streptomycin (०.२ µ ग्राम प्रति मिलीलीटर) पर ३७ ° c और 5% सह2. Transfect के साथ 50-60% संगम पर कोशिकाओं को sgRNA/Cas9 व्यक्त वेक्टर और एक 1:10 दाढ़ अनुपात21में MS2 कैसेट ।
    नोट: एक समानांतर प्रयोग में, एक GFP-व्यक्त वेक्टर (यानी, Cas9-GFP वेक्टर) transfecting द्वारा अभिकर्मक दक्षता सत्यापित करें । सबसे कम 60-70% अभिकर्मक दक्षता हासिल की जानी चाहिए ।
  2. अगले दिन, ०.७ µ जी/एमएल अंतिम एकाग्रता (चुनिंदा माध्यम) पर निओमायसिन युक्त माध्यम से संवर्धन माध्यम की जगह ।
    नोट: कोशिकाओं के बंटवारे और उन्हें चयनात्मक माध्यम में बोने के दिन के बाद अभिकर्मक चयन प्रक्रिया को गति देगा । सभी गैर transfected कोशिकाओं को तुरंत मर जाएगा । यदि अभिकर्मक 6 अच्छी तरह से प्लेटों में किया जाता है, जो मामले में एक ६०% संगम पर प्रत्येक अच्छी तरह से लगभग ०.७ x 106 कोशिकाओं को शामिल होगा, अगले दिन कोशिकाओं को एक ही अच्छी तरह से एक 10 सेमी चयनित माध्यम युक्त पकवान से विभाजित किया जा सकता है ।
  3. 7-10 दिनों के लिए चुनिंदा माध्यम में कोशिकाओं रखें, मध्यम हर एक या दो दिन बदल रहा है, जब तक एक क्लोन दिखाई दे रहे हैं ।
  4. सेल क्लोन के उठा
    1. एक ९६ अच्छी तरह से प्रत्येक अच्छी तरह से ०.२५% trypsin के 10 µ एल युक्त थाली तैयार करें ।
      नोट: २ ९६ अच्छी तरह प्लेटें मामले में ९६ से अधिक क्लोन उठाया होने की उंमीद कर रहे है तैयार करते हैं ।
    2. एक खुर्दबीन के उपयोग के साथ, एक मार्कर का उपयोग पकवान के तल पर एक डॉट बनाकर 10 सेमी डिश में दिखाई प्रत्येक क्लोन की स्थिति को चिह्नित । प्रत्येक डॉट को उठाया जा करने के लिए एक कॉलोनी के अनुरूप होगा ।
    3. बस पर्याप्त फॉस्फेट बफर खारा (पंजाब) के साथ संवर्धन माध्यम बदलें क्लोन पर तरल की एक पतली फिल्म बनाने के लिए और नहीं जाने के क्लोन के दौरान सूख कोशिकाओं ।
    4. एक 10 µ एल पिपेट का उपयोग कर एकल कालोनियों उठाओ । trypsin की कॉलोनी के लिए 5 µ एल युक्त टिप संलग्न और धीरे trypsin जो कॉलोनी पर स्थानीय रहेगा जारी । अनुमति trypsin 1 मिनट के लिए अलग कोशिकाओं के लिए, तो टिप के साथ कॉलोनी परिमार्जन और यह टिप में चूसना ।
      नोट: इस प्रक्रिया के दौरान, एक तरफ पकवान थोड़ा flipping तो कॉलोनी के चारों ओर पंजाबियों की मात्रा में कमी के लिए उठाया जा रहा है कॉलोनी के आसपास trypsin कमजोर परहेज से उठा प्रक्रिया में मदद मिलेगी । एक क्लोन अंगूठी का उपयोग भी एक क्लोन उठा मदद कर सकते हैं ।
    5. इस कॉलोनी से कोशिकाओं को ९६ अच्छी तरह से ०.२५% trypsin के 10 µ एल युक्त थाली के एक कुआं में रखें ।
    6. कमरे के तापमान पर 5 मिनट की मशीन, फिर चयनात्मक माध्यम के १५० µ एल के साथ अच्छी तरह से भरें (है हैम एफ 12K (है Kaighn) मध्यम के साथ पूरक 10% FBS, 2 मिमी L-glutamine, पेनिसिलिन (मध्यम की एमएल प्रति ०.५ इकाइयों), streptomycin (०.२ µ ग्राम प्रति मिलीलीटर) और युक्त निओमायसिन में ०.७ µ जी की एकाग्रता/
      ध्यान दें: के दौरान मशीन समय अंय क्लोन उठाया जा सकता है । यह संभव के रूप में कई क्लोन के रूप में लेने की सिफारिश की है । अधिक क्लोन अधिक संभावना है कि सकारात्मक लोगों की पहचान की जाएगी उठाया जाता है ।
    7. एक बार सभी क्लोनों और उठाया ९६ अच्छी तरह से थाली में स्थानांतरित कर रहे हैं, कोशिकाओं को चयनात्मक माध्यम में कुछ दिनों के लिए विकसित करने की अनुमति दें हैम के एफ-12K (Kaighn) मध्यम 10% FBS के साथ पूरक, 2 मिमी एल-glutamine, पेनिसिलिन (मध्यम की ०.५ यूनिट प्रति मिलीलीटर), streptomycin (०.२ µ ग्राम प्रति मिलीलीटर के माध्यम से) और ०.७ µ जी की एकाग्रता पर निओमायसिन युक्त/एमएल में ३७ डिग्री सेल्सियस और 5% सह2, ९०% संगम तक पहुंचने तक ।
  5. क्लोन के बंटवारे
    1. तैयार ३ ९६ अच्छी तरह से प्रति अच्छी तरह से जिलेटिन की १०० µ एल जोड़कर जिलेटिन के साथ लेपित प्लेटें, कमरे के तापमान पर 30 मिनट के लिए गर्मी, तो पंजाब के साथ दो बार धो लो । ये प्लेटें डीएनए निष्कर्षण (डीएनए प्लेट) और क्लोन जमने (फ्रीज प्लेट) के लिए इस्तेमाल की जाएंगी ।
      नोट: जिलेटिन कोशिकाओं के लगाव और डीएनए के कुओं को बढ़ावा देगा । विशेष रूप से, जिलेटिन कोटिंग डीएनए को डीएनए निष्कर्षण और वॉश प्रक्रियाओं के दौरान कुओं के नीचे छड़ी करने की अनुमति देगा (नीचे चर्चा की) । क्लोन-बंटवारे की प्रक्रिया के दौरान, यह एक मल्टीचैनल पिपेट का उपयोग करने के लिए सलाह दी जाती है ।
    2. एक बार क्लोन ९०% संगम, ९६ अच्छी तरह से थाली के प्रत्येक अच्छी तरह से महाप्राण माध्यम तक पहुंच, पंजाबियों के साथ धो, अच्छी तरह से प्रति ०.२५% trypsin के 30 µ एल जोड़ने के लिए, और ३७ ° c पर 5 मिनट के लिए मशीन ।
      नोट: क्लोन अलग दरों, जो भी क्लोन प्रति चुना कोशिकाओं की संख्या पर निर्भर करेगा पर बढ़ेगा । इस प्रकार, यह कदम कई दिनों के दौरान प्रदर्शन किया जाएगा जब अलग क्लोन ९०% संगम तक पहुँचने ।
    3. अच्छी तरह से प्रति चयनात्मक माध्यम के ७० µ एल जोड़ें, pipetting ऊपर और नीचे कुओं के अंदर से सेल के झुरमुट को बाधित, तो १०० µ एल के 30 µ एल हस्तांतरण के लिए एक अच्छी तरह से और 30 µ एल के लिए १२० µ एल के साथ एक से अधिक के साथ इस जिलेटिनल ठंड प्लेटों से भरा हुआ है । एच ५० µ एल मध्यम (चयन के बिना) ।
    4. मशीन में डीएनए प्लेट प्लेस और कोशिकाओं ३७ ° c और 5% सह पर बढ़ने के लिए अनुमति दें2 जब तक ९०% संगम ।
    5. बर्फ के ८० µ एल जोड़ें-ठंड हौसले से बनाया 2x ठंड मध्यम (८०% FBS और 20% dimethyl sulfoxide (DMSO)) ठंड प्लेट के प्रत्येक कुआं के लिए, parafilm जोड़ें (७०% इथेनॉल के साथ छिड़काव) प्लेट के शीर्ष पर तो एक अच्छी तरह से सील करने के लिए, शीर्ष पर ढक्कन जगह और एल्यूमीनियम पंनी के साथ थाली लपेटो । -८० डिग्री सेल्सियस पर ठंड प्लेट रखें ।
    6. जोड़ें ९० µ एल के प्रति अच्छी तरह से मूल ९६ अच्छी थाली क्लोन है कि विभाजन किया गया है और इसे संस्कृति में रखने तक पीसीआर स्क्रीनिंग परिणाम युक्त । इस प्लेट को बैकअप प्लेट के तौर पर इस्तेमाल किया जाएगा ।

2. निओमायसिन प्रतिरोधी क्लोनों की स्क्रीनिंग

  1. डीएनए ९६ अच्छी तरह से डीएनए प्लेट से निष्कर्षण ।
    1. एक बार डीएनए थाली में संस्कृति के क्लोन ९०% संगम तक पहुंचने, पंजाबियों के साथ 2 बार धो, फिर ५० µ एल lysis बफर के साथ लाइसे (10 मिमी Tris पीएच ७.५, 10 मिमी EDTA, 10 मिमी NaCl, ०.५% एसडीएस, और 1 मिलीग्राम/एमएल proteinase कश्मीर) । parafilm के साथ प्लेट कवर, एक अच्छी तरह से सील, पर ढक्कन डाल, सरन लपेटो के साथ कवर, और जगह ३७ ° c रात भर में ।
    2. ठंडा इथेनॉल के १०० µ एल जोड़ें (एट-OH)/NaCl समाधान (०.७५ १००% इथेनॉल में एम NaCl) प्रत्येक अच्छी तरह से और 6 ज या कमरे के तापमान पर रात भर के लिए हाला ।
      नोट: प्रोटोकॉल यहां ठहराया जा सकता है ।
    3. प्लेट उलटा करके एट-ओह/NaCl समाधान निकालें और अच्छी तरह से ७०% इथेनॉल के २०० µ l के साथ 3 बार धो लो ।
    4. आसुत जल में एक समाधान RNAse के 25 µ एल जोड़ें और 1 एच के लिए ३७ ° c में मशीन ।
  2. पीसीआर प्रवर्धन के लिए जीनोमिक डीएनए के 3 µ l का प्रयोग करें । निओमायसिन प्रतिरोध जीन और subtelomere 15q भीतर एनीलिंग प्राइमरों का उपयोग कर चयनित क्लोन की पीसीआर स्क्रीनिंग प्रदर्शन । पीसीआर प्रवर्धन मानक पोलीमरेज़ एंजाइमों और पीसीआर प्रोटोकॉल21का उपयोग किया जाता है ।
    नोट: MS2 प्राइमरों के लिए पीसीआर शर्तों (MS2-subtel15q-प्राइमर-एस और MS2 प्राइमर के रूप में) और सीटीआर प्राइमरों (सीटीआर प्रधानमंत्री एस और सीटीआर प्राइमर के रूप में) निंनलिखित हैं: ९८ ° c के लिए 20 एस विकार कदम के रूप में और फिर ३४ चक्र पर ९८ ° c 10 s, 58 ° c 20 s, ७२ ° c 15 s , एक 25 µ एल प्रतिक्रिया मिश्रण में पोलीमरेज़ एंजाइम का उपयोग ( सामग्री की तालिकादेखें) । प्राइमरी दृश्यों तालिका 1में संकेत कर रहे हैं ।
  3. agarose जेल पर पीसीआर प्रतिक्रियाओं को चलाने और पीसीआर बैंड मानक जेल निष्कर्षण प्रक्रियाओं का उपयोग कर सकारात्मक क्लोन से प्राप्त निकालने (जेल निष्कर्षण रिएजेंट के लिए सामग्री की तालिका देखें) ।
  4. MS2 अनुक्रम21की उपस्थिति की पुष्टि के लिए जेल से निकाले गए पीसीआर उत्पाद का डीएनए अनुक्रमण विश्लेषण करते हैं ।
    नोट: अनुक्रमण विश्लेषण पीसीआर स्क्रीनिंग के लिए इस्तेमाल किया प्राइमरों का उपयोग किया जा सकता है ।
  5. दक्षिणी दाग पीसीआर की स्क्रीनिंग पॉजिटिव क्लोन
    1. बढ़ क्लोन पीसीआर और अनुक्रमण मूल ९६ अच्छी तरह से प्लेट (बैकअप प्लेट) से 6 अच्छी तरह से है हैम एफ में प्लेटों में 12K (Kaighn) मध्यम 10% FBS के साथ पूरक, 2 मिमी एल-glutamine, पेनिसिलिन (०.५ मध्यम प्रति मिलीलीटर), streptomycin (०.२ µ ग्राम प्रति मध्यम की मिलीलीटर) और ३७ डिग्री सेल्सियस 5% CO2में ०.७ µ g/एमएल की एकाग्रता पर निओमायसिन युक्त ।
      नोट: वैकल्पिक रूप से, यदि इन क्लोनों के कुछ खो दिया गया है, उंहें ठंड प्लेटों में से एक से गल (देखें प्रोटोकॉल २.६) ।
    2. एक बार क्लोन 6 खैर प्लेट में ९०% संगम पर हैं, पंजाबियों के साथ कोशिकाओं को धोने और ०.५ µ जी proteinase K प्रति अच्छी तरह से युक्त lysis बफर के २५० µ एल जोड़ें ।
    3. एक सेल खुरचनी का उपयोग कर कोशिकाओं परिमार्जन और एक १.५ मिलीलीटर ट्यूब में lysate हस्तांतरण ।
    4. 16 एच के लिए ३७ ° c पर मशीन ।
    5. १००% इथेनॉल की 1 मिलीलीटर जोड़ें, तेजी से हिला, और डीएनए कम 2 ज या रात में-20 डिग्री सेल्सियस हाला करने के लिए अनुमति देते हैं ।
      नोट: प्रोटोकॉल यहां ठहराया जा सकता है ।
    6. 10 मिनट के लिए 4 ° c पर १३,४०० x g पर स्पिन, supernatant त्यागें, और ७०% इथेनॉल के साथ छर्रों धो लो । छर्रों हवा कमरे के तापमान पर शुष्क करते हैं । वैकल्पिक रूप से, एक वैक्यूम ध्यानी का उपयोग करें ।
    7. RNAse एक और ३७ डिग्री सेल्सियस पर 1 ज के लिए मशीन युक्त आसुत जल के ५० µ एल में डीएनए छर्रों resuspend ।
    8. डाइजेस्ट 5-10 µ जी जीनोमिक डीएनए के NcoI और BamHI प्रतिबंध एंजाइमों (दो स्वतंत्र डाइजेस्ट) में १०० µ एल प्रतिक्रिया मात्रा में ३७ डिग्री सेल्सियस रात भर पाचन प्रतिक्रियाओं की मशीन द्वारा प्रयोग ।
    9. पूर्ण पाचन पुष्टि के लिए agarose जेल (०.८% agarose) पर पाचन के 4 µ एल भागो ।
    10. 1/10 सोडियम एसीटेट 3 मीटर समाधान पीएच ५.२ और प्रतिबंध पाचन प्रतिक्रियाओं के लिए १००% इथेनॉल के 2 संस्करणों की मात्रा में जोड़ें और कम 2 ज या रात में-20 डिग्री सेल्सियस के लिए डीएनए हाला ।
      नोट: प्रोटोकॉल यहां ठहराया जा सकता है ।
    11. 20 मिनट के लिए 4 डिग्री सेल्सियस पर १३,४०० x g पर केंद्रापसारक, supernatants त्यागें, और ७०% इथेनॉल के साथ छर्रों धो लो । कमरे के तापमान पर शुष्क हवा के लिए छर्रों की अनुमति दें । वैकल्पिक रूप से, एक वैक्यूम ध्यानी का उपयोग करें ।
    12. आसुत जल के 20 µ एल में छर्रों resuspend और एक ०.८% agarose जेल पर पचा डीएनए लोड ।
      नोट: पचा डीएनए के एक बेहतर संकल्प के लिए, एक जेल में कम से 15 सेमी लंबी और कम वोल्टेज पर रात भर चलाने के लिए तैयार (̴30 वोल्ट). ट्रो सेट अनुकूलित किया जाना चाहिए ।
    13. अगले दिन, एक डीएनए लेबलिंग एजेंट के साथ जेल दाग, इस तरह के रूप में ethidium ब्रोमाइड पर 1 µ l/10 मिलीलीटर अंतिम एकाग्रता, कमरे के तापमान पर 30 मिनट के लिए और एक जेल इमेजिंग उपकरण पर जेल के लिए करीब एक शासक के साथ एक तस्वीर ले लो ।
    14. एक नायलॉन झिल्ली के लिए डीएनए के हस्तांतरण सेट और एक MS2 अनुक्रम विशिष्ट जांच मानक प्रक्रियाओं21का उपयोग कर के साथ झिल्ली संकरण प्रदर्शन ।
    15. दो ठंड प्लेटों में से एक से पीसीआर, डीएनए अनुक्रमण और दक्षिणी दाग में सकारात्मक हैं कि क्लोन गल (अगला कदम देखें) ।
  6. क्लोनों का गल जाना
    1. तैयार १ १५ मिलीलीटर ट्यूब पूर्व गर्म है हैम एफ-12K के 5 मिलीलीटर युक्त (Kaighn) मध्यम 10% FBS के साथ पूरक, 2 मिमी एल-glutamine, पेनिसिलिन (०.५ मध्यम प्रति मिलीलीटर), और प्रत्येक क्लोन के लिए streptomycin (०.२ µ ग्राम प्रति मिलीलीटर) के लिए गल जाना ।
    2. -८० ° से ठंड प्लेटों में से एक को हटा दें और अच्छी तरह से युक्त सकारात्मक क्लोन करने के लिए पूर्व गर्म F12K पूर्ण माध्यम के १०० µ एल जोड़ने के लिए गल जाएगा ।
      नोट: यह प्रक्रिया जल्दी से किया जाना चाहिए और एक क्लोन गल गया है के बाद ९६ अच्छी तरह से थाली सूखी बर्फ पर रखा जाना चाहिए, ताकि अंय क्लोनों जमे रहने के लिए अनुमति देने के लिए । यह विशेष रूप से महत्वपूर्ण है अगर कई क्लोन एक ही ९६ अच्छी तरह से थाली से गल जाने की जरूरत है ।
    3. 15 मिलीलीटर ट्यूब मध्यम के 5 मिलीलीटर युक्त और कमरे के तापमान पर 5 मिनट के लिए ८०० x g पर केंद्रापसारक करने के लिए कोशिकाओं स्थानांतरण ।
    4. मध्यम महाप्राण, पूर्व के ५०० µ एल में कोशिकाओं resuspend पूरा F12K माध्यम गर्म है, और एक 12 अच्छी तरह से थाली की एक भी अच्छी तरह से एक क्लोन हस्तांतरण ।
  7. subtelomere 15q में एकीकृत MS2 कैसेट से निओमायसिन प्रतिरोध जीन के उंमूलन ।
    1. क्लोन एक 12 अच्छी थाली से पूरा F12K माध्यम में एक 10 सेमी डिश के लिए विकसित करने की अनुमति दें ।
      नोट: निओमायसिन मध्यम में जब तक अंयथा संकेत शामिल नहीं किया जाना चाहिए ।
    2. Cre-व्यक्त एडीनोवायरस को पूर्ण F12K माध्यम के 10 मिलीलीटर में ७०% संगम पर 10 सेमी डिश में प्रसंस्कृत कोशिकाओं में जोड़ें ।
      नोट: एक Cre-GFP व्यक्त एडीनोवायरस का उपयोग संक्रमण, जो १००% दृष्टिकोण चाहिए की दक्षता के मूल्यांकन की अनुमति देगा । प्रतिकृति-दोषपूर्ण एडीनोवायरस संस्कृति में कुछ अंश के बाद खो जाएगा ।
    3. ४८ घंटे संक्रमण के बाद, ३ १० सेमी व्यंजन में कोशिकाओं को विभाजित । दो व्यंजन नकारात्मक चयन द्वारा निओमायसिन जीन हटाने के सत्यापन के लिए इस्तेमाल किया जाएगा, निओमायसिन-युक्त मध्यम (पहली डिश) में कोशिकाओं बढ़ रही है, और दक्षिणी दाग (दूसरी डिश) द्वारा ।
    4. संस्कृति कोशिका ठंड और आरएनए निष्कर्षण के लिए क्लोन युक्त तीसरी डिश ।

3. RT-qPCR द्वारा टेरा-MS2 प्रतिलिपि अभिव्यक्ति का सत्यापन

  1. निओमायसिन जीन हटाने के सत्यापन पर, कार्बनिक सॉल्वैंट्स (phenol और guanidine isothiocynate समाधान)21का उपयोग कर टेरा-MS2 क्लोन से कुल आरएनए निष्कर्षण प्रदर्शन ।
    1. diethyl pyrocarbonate (DEPC) पानी के १०० µ एल में एक 10 सेमी डिश से निकाली गई आरएनए को पुनर्निलंबित ।
    2. आरएनए के एकाग्रता और अखंडता की पुष्टि करने के क्रम में एक denaturating (1% formaldehyde-युक्त) 1x 3-(N-Morpholino) propanesulfonic एसिड (MOPS) जेल पर आरएनए के 3 µ एल भागो । इसके अलावा एक spectrophotometer का उपयोग आरएनए एकाग्रता का विश्लेषण.
    3. DNAse मैं ६० µ एल अंतिम प्रतिक्रिया मात्रा में DNAse मैं एंजाइम की 1 इकाई का उपयोग कर के साथ आरएनए के 3 µ जी समझो ।
    4. ३७ डिग्री सेल्सियस पर 1 एच के लिए प्रतिक्रिया की मशीन ।
  2. उलट प्रतिलेखन प्रतिक्रिया आणि qPCR िरा
    1. एक nuclease-free microcentrifuge ट्यूब के लिए निंनलिखित घटक जोड़ें: 2 µ एल के एक 1 µ एम टेरा विशिष्ट प्राइमर, 1 µ एल के dNTPs मिश्रण (10 मिमी प्रत्येक), 6 µ एल के DNAse I-इलाज आरएनए (̴300ng आरएनए के लिए इसी) । DEPC पानी के 4 µ l के साथ 13 µ l को वॉल्यूम समायोजित करें ।
      नोट: प्रत्येक आरएनए के लिए विश्लेषण किया जा करने के लिए, एक दूसरी ट्यूब एक ही रिएजेंट है, लेकिन एक संदर्भ विशिष्ट प्राइमर, बजाय टेरा विशिष्ट भजन, तैयार किया जाना चाहिए युक्त ।
    2. ६५ ° c के लिए मिश्रण गर्मी 5 मिनट के लिए और बर्फ में कम से कम 1 मिनट के लिए मशीन ।
    3. संक्षिप्त केंद्रापसारक द्वारा ट्यूबों की सामग्री ले लीजिए और 5x आरटी एंजाइम बफर के 4 µ एल जोड़ने के लिए, 1 µ एल ०.१ एम dithiothreitol (डीटीटी), 1 µ एल (4 इकाइयों) RNAse अवरोध करनेवाला, और 1 µ एल के रिवर्स transcriptase ( सामग्री की तालिकादेखें) ।
    4. ६० मिनट के लिए ४२ डिग्री सेल्सियस पर नमूनों की मशीन, तो qPCR विश्लेषण के लिए आर टी प्रतिक्रिया के 2 µ एल का उपयोग करें ।
  3. 20 µ के एक अंतिम मात्रा में qPCR प्रतिक्रिया मिश्रण तैयार 2x qPCR मास्टर मिश्रण के 10 µ एल से मिलकर l, 2 µ l के सीडीएनए खाके, 1 µ l की फॉरवर्ड प्राइमरी (10 µ मी), रिवर्स प्राइमरी (10 µ मी) की 1 µ l, और पानी की 6 µ l.
  4. मानक प्रोटोकॉल का उपयोग कर thermocycler में qPCR प्रतिक्रिया निष्पादित करें21.

४. एक MS2-GFP व्यक्त Retrovirus का उत्पादन

  1. उत्पंन करने के लिए MS2-GFP व्यक्त retrovirus, transfect ८०% धाराप्रवाह फीनिक्स पैकेजिंग सेल एक MS2-GFP फ्यूजन प्रोटीन के साथ retrovirus वेक्टर (pBabe-MS2-GFP पूरो) व्यक्त और एक env जीन एक्सप्रेस वेक्टर (जैसे pCMV-VSVG) का उपयोग कर एक दाढ़ अनुपात 4:1 दो वैक्टर ।
  2. अगले दिन, संवर्धन मध्यम (DMEM 10% FBS, 2 मिमी L-glutamine और पेन/Strep) के साथ ताजा मध्यम मिमी सोडियम butyrate युक्त की जगह है ।
  3. ३७ डिग्री सेल्सियस, 5% सह2पर 8 घंटे के लिए मशीन, तो ताजा संवर्धन माध्यम है जिसमें से वायरस एकत्र किया जाएगा के साथ माध्यम की जगह ।
  4. ४८ ज के बाद, फीनिक्स कोशिकाओं से retrovirus युक्त मध्यम निकालें । इस माध्यम सीधे टेरा के संक्रमण के लिए इस्तेमाल किया जा सकता है-MS2 क्लोन, जो मामले में एक ०.४५ µm फिल्टर के माध्यम से मध्यम फिल्टर, polybrene जोड़ें (30 µ जी/एमएल अंतिम एकाग्रता) और यह कोशिकाओं को जोड़ने के (इस मामले में प्रोटोकॉल कदम पर जारी है 5) । वैकल्पिक रूप से, retrovirus एक ५० मिलीलीटर फाल्कन ट्यूब में ५०% खूंटी-8000/900 mM NaCl समाधान और एक रोटेटर व्हील पर 4 डिग्री सेल्सियस पर रातोंरात गर्मी की 1/5वीं मात्रा जोड़कर में उपजी जा सकता है ।
  5. अगले दिन पर, गोली retrovirus कणों से 30 मिनट के लिए २,००० x g पर, supernatant को हटाने, और F12K माध्यम में गोली resuspend बिना सीरम ।
    नोट: वायरस कणों मूल supernatant मात्रा के 1/100वें में resuspend किया जा सकता है । एक संक्रमण परीक्षण करने के लिए कुशलता से कोशिकाओं को संक्रमित करने के लिए आवश्यक retrovirus की ंयूनतम मात्रा सत्यापित करने के लिए किया जाना चाहिए ।

5. टेरा के दृश्य-कक्ष में रहने वाले MS2 टेप

  1. थाली टेरा-MS2 क्लोन और WT AGS कोशिकाओं में ग्लास तली व्यंजन । संक्रमण के दिन, मध्यम (30 µ g/mL अंतिम एकाग्रता) और MS2-GFP व्यक्त retrovirus में polybrene जोड़ें ।
  2. 24 घंटे के बाद, वायरस युक्त मध्यम त्यागें और phenol-लाल बिना ताजा माध्यम जोड़ें ।
  3. उपयुक्त माइक्रोस्कोप सेटिंग का उपयोग कर एक औंधा माइक्रोस्कोप पर कोशिकाओं का विश्लेषण. छवि एक 100X या बड़े संख्यात्मक एपर्चर (1.4 x) के साथ 60X उद्देश्य के साथ कोशिकाओं और एक संवेदनशील कैमरा (EMCCD) का उपयोग कर । इमेजिंग के दौरान ३७ ° c और 5% CO2 पर नमूनों को बनाए रखने के लिए एक पर्यावरणीय नियंत्रण प्रणाली का उपयोग करें ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

चित्रा 1 प्रयोगात्मक रणनीति के एक सिंहावलोकन का प्रतिनिधित्व करता है । प्रोटोकॉल के मुख्य चरणों और AGS कोशिकाओं में टेरा-MS2 क्लोनों की पीढ़ी के लिए एक संकेत समयरेखा (चित्रा 1A) दिखाया जाता है । 1 दिन में, एक 6 अच्छी तरह से थाली के कई कुओं MS2 कैसेट और sgRNA/Cas9 व्यक्त वैक्टर के साथ transfected है ( चित्र 1Bमें दिखाया गया है) । दो अलग subtelomere 15q-विशिष्ट गाइड आरएनए अनुक्रम Cas9 nickase-व्यक्त pX335 वेक्टर में क्लोन कर रहे हैं, दो sgRNA-pX335 वैक्टर कि transfected कैसेट के साथ सह MS2 पैदा कर रहे हैं । प्लेट की एक अच्छी तरह से एक GFP व्यक्त वेक्टर अभिकर्मक दक्षता सत्यापित करने के साथ transfected जा सकता है । 2 दिन में, कोशिकाओं trypsinized और एक ही अच्छी तरह से एक 10 सेमी चुनिंदा माध्यम युक्त पकवान से स्थानांतरित कर रहे हैं । 3 दिन में, मध्यम सबसे untransfected कोशिकाओं मर जाएगा के रूप में परिवर्तित किया जाना चाहिए । कोशिकाओं के चयन में बड़े हो रहे है जब तक क्लोन दिखाई और तैयार हो उठाया है । इस समय के दौरान, कोशिकाओं trypsinized नहीं होना चाहिए और संवर्धन मध्यम पहले सप्ताह के लिए हर 1-2 दिन और फिर हर 2-3 दिन बाद में परिवर्तित किया जाना चाहिए । एक बार एक क्लोन दिखाई दे रहे हैं, वे उठाया और एक ९६ अच्छी तरह से थाली में स्थानांतरित कर रहे हैं, जहां वे संगम के 80-90% तक पहुंचने जब तक बढ़ने की अनुमति है । इस बिंदु पर, क्लोन 4 अलग ९६ अच्छी तरह से प्लेटों, जो एक रंग कोड के साथ चित्र 1 में चिह्नित कर रहे है में विभाजित हैं । एक बार डीएनए प्लेट (ग्रीन) में कल्चरित क्लोन ८०% संगम तक पहुँच जाते हैं, वे पीसीआर स्क्रीनिंग के लिए निकाले गए लीजड ड और जीनोमिक डीएनए हैं; बैकअप प्लेट (ब्लू) में क्लोनों को पीसीआर स्क्रीनिंग के नतीजों तक कल्चर में रखा जाएगा, जबकि-80 डिग्री सेल्सियस पर रेड जमने वाली प्लेटें जमी रहेंगी । चित्रा 2 बी निओमायसिन के एक पीसीआर स्क्रीनिंग के प्रतिनिधि परिणाम-प्रतिरोधी क्लोन दिखाता है । इस स्क्रीनिंग के लिए, प्राइमरों के दो सेट का उपयोग किया जाता है: निओमायसिन जीन और subtelomere 15q अनुक्रम के भीतर एक प्राइमरी जोड़ी (MS2 प्राइमरों) एनीलिंग MS2 कैसेट की उपस्थिति सत्यापित करने के लिए प्रयोग किया जाता है (प्राइमरों स्थानीयकरण के एक प्रतिनिधि छवि में दिखाया गया है चित्रा 2) । एक दूसरी प्राइमरी जोड़ी (सीटीआर प्राइमरों) एक आंतरिक गुणसूत्र क्षेत्र में एनीलिंग झूठी नकारात्मक क्लोन की उपस्थिति की पुष्टि करने के लिए प्रयोग किया जाता है (प्राइमर दृश्यों तालिका 1में संकेत कर रहे हैं) । कैसेट के एकीकरण के लिए नकारात्मक क्लोन MS2 ' प्राइमर प्रवर्धन के लिए नकारात्मक और सीटीआर प्राइमरों प्रवर्धन के लिए सकारात्मक होना चाहिए । जीनोमिक डीएनए जीनोमिक डीएनए या इसके संदूषण के अभाव में जिसके परिणामस्वरूप निष्कर्षण में तकनीकी समस्याओं MS2 और सीटीआर प्राइमर प्रतिक्रियाओं से पीसीआर प्रवर्धन बाधा होगा । इन मामलों में, क्लोन शामिल फिर से बैकअप प्लेट से जीनोमिक डीएनए की निकासी पर पीसीआर द्वारा दिखलाई जा सकता है । MS2 से प्राप्त बैंड सकारात्मक क्लोनों के प्रवर्धन जेल-निकाला जा सकता है और MS2 प्राइमरों का उपयोग कर अनुक्रम, क्रम में दस MS2 दृश्यों की उपस्थिति की पुष्टि करने के लिए ।

कि पीसीआर स्क्रीनिंग में सकारात्मक है क्लोन ९६ अच्छी तरह से बैकअप प्लेट ( चित्रा 1में नीले रंग की थाली) एक 6 अच्छी तरह से थाली से, तो जीनोमिक डीएनए निष्कर्षण और दक्षिणी दाग के विश्लेषण के लिए लीजड ड से संस्कृति रहे हैं । चित्रा 2 डी एक जेल के प्रतिनिधि छवियों (बाएं) और एक रेडियोधर्मी लेबल MS2 अनुक्रम विशिष्ट जांच पीसीआर सकारात्मक क्लोन की एक दक्षिणी दाग स्क्रीनिंग के (सही) के साथ संकर झिल्ली से पता चलता है । subtelomere 15q पर MS2 अनुक्रम एकीकरण की पुष्टि के लिए, प्रत्येक क्लोन से निकाले जीनोमिक डीएनए दो अलग पाचन प्रतिक्रियाओं में दो विभिन्न प्रतिबंध एंजाइमों (NcoI और BamHI) के साथ पचा जाना चाहिए. NcoI और BamHI प्रतिबंध एंजाइमों subtelomere 15q में MS2 कैसेट एकीकरण के सत्यापन के लिए उपयुक्त हैं । अंय एंजाइमों भी इस्तेमाल किया जा सकता है । जेल जीनोमिक डीएनए BamHI प्रतिबंध एंजाइम का उपयोग कर के एक पूर्ण पाचन से पता चलता है, के रूप में एक धब्बा की उपस्थिति के द्वारा संकेत दिया । दक्षिणी दाग से परिणाम संकेत मिलता है कि एक क्लोन subtelomere 15q में MS2 कैसेट के एकीकरण के लिए सकारात्मक है, जबकि कई क्लोन कैसेट के कई एकीकरण घटनाओं शो, के रूप में कई बैंड की उपस्थिति से संकेत दिया । एक सकारात्मक क्लोन जीनोमिक21डीएनए के NcoI पाचन पर एक दूसरे दक्षिणी दाग से विश्लेषण किया जाना चाहिए । MS2 कैसेट युक्त एक subtelomere 15q की एक प्रतिनिधि छवि और BamHI और NcoI प्रतिबंध एंजाइम साइटों की स्थिति चित्रा 2सीमें दिखाया गया है ।

पीसीआर और सदर्न ब्लाटर को पॉजिटिव करने वाले क्लोनों को MS2 कैसेट में मौजूद निओमायसिन जीन को हटाने के लिए एक Cre-GFP एक्सप्रेस एडीनोवायरस से संक्रमित किया जाता है । चित्रा 3 एक MS2-टैग subtelomere 15q पहले और बाद में Cre अभिव्यक्ति का चित्रण । एक क्लोन की एक छवि subtelomere 15q पर MS2 कैसेट एकीकरण के लिए सकारात्मक एक Cre-GFP व्यक्त एडीनोवायरस से संक्रमित चित्रा 3बीमें दिखाया गया है सभी कोशिकाओं में निओमायसिन जीन का एक पूर्ण हटाने के लिए, संक्रमण दक्षता लगभग १००% तक पहुंच जाना चाहिए । के रूप में चित्रा 3सीमें दिखाया गया है, ताकि निओमायसिन जीन के उंमूलन को सत्यापित करने के लिए, Cre-GFP संक्रमित कोशिकाओं तीन प्लेटों में संक्रमण से ४८ घंटे के बाद विभाजित हैं । निओमायसिन की मौजूदगी में एक-एक थाली कल्चर की जाएगी । इस थाली में सभी कोशिकाओं को 6-7-दिनों के भीतर मरना चाहिए । एक दूसरी थाली में, कोशिकाओं को 80-90% संगम तक चयन के बिना पूर्ण माध्यम में विकसित करने की अनुमति दी जाएगी । इस बिंदु पर, जीनोमिक डीएनए निकाला और दक्षिणी दाग द्वारा विश्लेषण किया है । तीसरी थाली पूरा माध्यम में संस्कृति के लिए क्लोन के जमे हुए शेयरों की तैयारी और आरएनए निष्कर्षण और भ-टेरा के qPCR विश्लेषण-MS2 प्रतिलिपि अभिव्यक्ति की अनुमति है । चित्रा 3 D से पहले और Cre-GFP संक्रमण के बाद एक सकारात्मक क्लोन के दक्षिणी दाग विश्लेषण के प्रतिनिधि छवियों से पता चलता है । डीएनए agarose जेल (बाईं ओर छवि) NcoI प्रतिबंध एंजाइम का उपयोग कर जीनोमिक डीएनए के पूर्ण पाचन की पुष्टि करता है । दक्षिणी दाग विश्लेषण एक रेडियोधर्मी-लेबल्ड MS2-अनुक्रम विशिष्ट जांच (सही पर छवि) का उपयोग किया गया था । यह विश्लेषण निओमायसिन जीन को हटाने की पुष्टि करता है । Cre-GFP संक्रमित नमूने में एक धब्बा की उपस्थिति MS2 दृश्यों के telomeric एकीकरण की पुष्टि करता है । subtelomere 15q के भीतर NcoI प्रतिबंध साइटों की स्थिति चित्रा 3में दिखाया गया है ।

एक बार निओमायसिन प्रतिरोध जीन के उंमूलन की पुष्टि की है, क्लोन टेरा की अभिव्यक्ति MS2 टेप के लिए परीक्षण किया जा सकता है । इस उद्देश्य के लिए, कुल आरएनए प्रत्येक क्लोन से निकाला जाता है और अपनी अखंडता (चित्रा 4) की पुष्टि करने के लिए एक denaturating MOPS जेल पर चला जाता है । राइबोसोमल आरएनए बैंड ४,७०० कुर्सियां (rRNA 28S) और १,९०० कुर्सियां (rRNA 18S) पर दिखाई जानी चाहिए । Retrotranscription प्रतिक्रिया एक telomeric दोहराने का उपयोग किया जाता है-विशिष्ट प्राइमर और संदर्भ जीन विशिष्ट प्राइमर (चित्रा 4बी, ऊपर), जबकि टेरा अभिव्यक्ति के qPCR विश्लेषण प्राइमरों के दो सेट: एक किताब का उपयोग कर प्रदर्शन कर रहे है युग्म एनीलिंग MS2 अनुक्रम और subtelomere 15q अनुक्रम के भीतर; subtelomere 15q के भीतर एनीलिंग प्राइमरों की एक दूसरी जोड़ी । प्राइमरी दृश्यों तालिका 1में संकेत कर रहे हैं । चित्रा 4बी में प्रस्तुत ग्राफ AGS WT कोशिकाओं और दो अलग टेरा-MS2 क्लोन से टेरा अभिव्यक्ति के RT-qPCR विश्लेषण से पता चलता है । इन विश्लेषणों के स्तर पर दो क्लोनों में टेरा-MS2 टेप की अभिव्यक्ति की पुष्टि है कि टेरा टेप WT कोशिकाओं में subtelomere 15q से व्यक्त की तुलना कर रहे हैं । इन आंकड़ों से संकेत मिलता है कि दो टेरा-MS2 क्लोन चयनित टेरा के विश्लेषण के लिए उपयुक्त हैं, लाइव सेल इमेजिंग द्वारा MS2 टेप ।

क्रम में रहने वाली कोशिकाओं में टेरा-MS2 टेप कल्पना करने के लिए, चयनित क्लोन एक MS2-GFP फ्यूजन प्रोटीन व्यक्त retrovirus से संक्रमित हैं । चित्रा 5 MS2-GFP व्यक्त retrovirus, प्रोटोकॉल चरण 4 में वर्णित के रूप में जनरेट करने के लिए प्रक्रिया दिखाता है । AGS WT कोशिकाएँ और टेरा-MS2 क्लोन काँच के नीचले व्यंजन में संक्रमित होते हैं. संक्रमण से 24 घंटे के बाद, कोशिकाओं प्रतिदीप्ति माइक्रोस्कोपी द्वारा विश्लेषण कर रहे हैं । संकेत की विशिष्टता टेरा की उपस्थिति-MS2-GFP घावों टेरा के नाभिक में पाया-MS2 क्लोन और AGS WT कोशिकाओं में नहीं (चित्रा 5बी) की पुष्टि की है । MS2-GFP एक्सप्रेस कोशिकाओं की आबादी में, कोशिकाओं के बीच MS2-GFP स्तरों के संदर्भ में विविधता की उम्मीद है और कम स्तर पर व्यक्त कोशिकाओं इमेजिंग विश्लेषण के लिए चुना जाना चाहिए. वैकल्पिक रूप से, MS2-GFP एक्सप्रेस कोशिकाओं GFP के निम्न स्तर व्यक्त कोशिकाओं की उपजनसंख्या को इकट्ठा करने के क्रम में FACS पूर्व माइक्रोस्कोपी विश्लेषण से हल किया जा सकता है. हमने पहले टेरा-MS2-GFP घावों का पता लगाया है ४०% में AGS टेरा-MS2 क्लोन21की कोशिकाओं का ६०% । इन कोशिकाओं में, एक से चार टेरा-MS2-GFP घावों प्रति कोशिका छवि थे । टेरा-MS2-GFP घावों अलग आकार और गतिशीलता दिखा21पता लगाया जा सकता है । टेरा-MS2 क्लोनों में रहने वाली कोशिकाओं में एकल telomere टेरा टेप की गतिशीलता का अध्ययन किया जा सकता है । इस आवेदन के एक उदाहरण के रूप में, चित्रा 5सी एक टेरा-MS2 क्लोन MS2-GFP फ्यूजन प्रोटीन और telomere-बाध्यकारी प्रोटीन TRF2 करने के लिए mCherry के लिए इनकार व्यक्त की सूक्ष्म विश्लेषण से प्रतिनिधि छवियों से पता चलता है क्रम में करने के लिए कल्पना MS2-टैग टेरा टेप और जीवित कोशिकाओं में telomeres । इस दृष्टिकोण का प्रयोग, हम पहले देखा है कि टेरा-MS2-GFP घावों सह-स्थानीयकरण कोशिकाओं के ४४% में telomeres के साथ, यह दर्शाता है कि टेरा टेप केवल क्षणिक सह गुणसूत्र के साथ स्थानीयकरण AGS कोशिकाओं21में समाप्त होता है ।

Figure 1
चित्रा 1 . AGS कोशिकाओं में टेरा-एमएस 2 क्लोन की पीढ़ी के लिए प्रयोगात्मक रणनीति और संकेत समयरेखा का अवलोकन । क) प्रोटोकॉल में वर्णित कदम और टेरा-MS2 क्लोन के चयन के लिए एक संकेत समय रेखा से पता चला रहे हैं । कोशिकाओं को रैखिक MS2 कैसेट और sgRNA/Cas9 व्यक्त वैक्टर के साथ एक 6 अच्छी तरह से थाली में transfected हैं । एक रंग कोड डीएनए प्लेट, बैकअप प्लेट और फ्रीजिंग प्लेट प्रोटोकॉल अनुभाग में दर्शाया भेद करने के लिए प्रयोग किया जाता है । ख) MS2 कैसेट एक ८०० nt लंबे समय subtelomere 15q अनुक्रम MS2 दृश्यों और एक निओमायसिन प्रतिरोध के 10 repetitionों द्वारा पीछा कर रहे है के रूप में शामिल हैं-पी साइटों और एक ३०० nt लंबे telomeric दोहराने पथ के साथ समाप्त होता है अपने 3 ' अंत में । sgRNA/Cas9 व्यक्त वैक्टर क्लोनिंग subtelomere 15q-विशिष्ट गाइड आरएनए अनुक्रम pX335 में BbsI प्रतिबंध साइट का उपयोग करते हुए द्वारा उत्पन्न किए गए थे21,22. दो विभिंन sgRNA-pX335 वैक्टर उत्पंन और दो वैक्टर के एक 1:1 मिश्रण अभिकर्मक के लिए इस्तेमाल किया गया था । sgRNAs के अनुक्रम तालिका 1में संकेत कर रहे हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2 . पीसीआर और दक्षिणी निओमायसिन प्रतिरोधी क्लोनों के दाग स्क्रीनिंग के प्रतिनिधि छवियां । एक) MS2 कैसेट युक्त subtelomere 15q की प्रतिनिधि छवि । पीसीआर स्क्रीनिंग के लिए इस्तेमाल MS2 प्राइमरों (MS2-subtel15q-प्राइमरी-एस और MS2 प्राइमरी जैसी) की स्थिति दर्शाई गई है । कैसेट के भीतर मौजूद loxP स्थलों को लाल रंग में दिखाया गया है. ख) निओमायसिन प्रतिरोधी क्लोनों की पीसीआर स्क्रीनिंग के प्रतिनिधि छवि प्राइमरों, MS2 प्राइमरों और सीटीआर प्राइमरों के दो सेट का उपयोग (सीटीआर प्रधानमंत्री एस और सीटीआर प्राइमर के रूप में) । ग) MS2 कैसेट युक्त subtelomere 15q की प्रतिनिधि छवि. BamHI और NcoI प्रतिबंध साइटों और दक्षिणी दाग स्क्रीनिंग के लिए इस्तेमाल किया MS2 जांच दिखाया जाता है । घ) वाम: क्लोन प्रति जीनोमिक डीएनए के 10 µ जी BamHI के साथ पचा और एक agarose जेल पर चलाने थे । छवि 30 वोल्ट पर एक रात चलाने के बाद अधिग्रहीत किया गया था. ठीक है: जीनोमिक डीएनए BamHI प्रतिबंध एंजाइम के साथ पचा एक सकारात्मक आरोप लगाया नायलॉन झिल्ली को हस्तांतरित किया गया था और एक रेडियोधर्मी लेबल MS2 अनुक्रम विशिष्ट जांच के साथ संकर । लाल बॉक्स धनात्मक बैंड के अपेक्षित आकार को इंगित करता है. लाल तीर एक सकारात्मक क्लोन इंगित करता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3 . निओमायसिन प्रतिरोध जीन और मांयता प्रयोगों के उंमूलन । एक) subtelomere 15q की प्रतिनिधि छवि से पहले और Cre अभिव्यक्ति के बाद MS2 कैसेट युक्त । दक्षिणी दाग विश्लेषण और NcoI प्रतिबंध एंजाइम साइटों के लिए इस्तेमाल किया MS2 विशिष्ट जांच दिखाई जाती हैं । कैसेट के भीतर मौजूद loxP स्थलों को लाल रंग में दिखाया गया है. ख) एक टेरा-MS2 क्लोन Cre-GFP व्यक्त एडीनोवायरस से संक्रमित के प्रतिदीप्ति माइक्रोस्कोपिक विश्लेषण । प्रतिनिधि छवि एक भी फोकल विमान में अधिग्रहीत दिखाया गया है । MOI, संक्रमण के गुणन, संक्रमण और मेजबान कोशिकाओं की संख्या के लिए इस्तेमाल किया वायरस की संख्या के बीच अनुपात है । स्केल बार: 30 µm ग) निओमायसिन जीन के उन्मूलन को सत्यापित करने के लिए प्रयुक्त प्रयोगात्मक कार्यनीति का अवलोकन. Cre-GFP संक्रमित कोशिकाओं के लिए संक्रमण से ४८ घंटे के बाद तीन प्लेटों में विभाजित कर रहे हैं i) नकारात्मक चयन, द्वितीय) दक्षिणी दाग विश्लेषण और iii) जमे हुए सेल स्टॉक और आरएनए निष्कर्षण की तैयारी । ) Cre-GFP एडीनोवायरस संक्रमण से पहले और बाद में एक टेरा-MS2 क्लोन का दक्षिणी दाग जोडकर । जीनोमिक डीएनए के 10 µ जी को प्रतिबन्ध एंजाइम NcoI से पच रहे थे. Agarose जेल की पुष्टि करता है कि पूर्ण पाचन दोनों क्लोनों (बाएं) में हासिल की है । पचा जीनोमिक डीएनए एक सकारात्मक आरोप लगाया नायलॉन झिल्ली को हस्तांतरित किया गया था और एक MS2 अनुक्रम विशेष जांच का उपयोग कर संकर । निओमायसिन जीन के पूर्ण उन्मूलन विशिष्ट बैंड के अभाव से पुष्टि की है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4 . RT-तेल 15 क्यू के qPCR विश्लेषण-टेरा और दूरभाष15क्यू-टेरा-MS2 टेप अभिव्यक्ति । एक) कुल आरएनए AGS WT कोशिकाओं और टेरा-MS2 क्लोन से निकाले दिखा एक MOPS जेल के प्रतिनिधि छवि । बैंड राइबोसोमल RNAs 28S और 18S के लिए इसी संकेत कर रहे हैं । ख) Top: MS2 के एक योजनाबद्ध-subtelomere 15q व्यक्त टेरा टेप को टैग । प्राइमर टेरा retrotranscription के लिए इस्तेमाल किया (पीला) और Tel15q के qPCR विश्लेषण-टेरा (नीला) और Tel15q-MS2 टेरा (लाल) दिखाया जाता है । loxP साइट लाल रंग में दिखाया गया है । नीचे: RT-qPCR Tel15q के विश्लेषण-टेरा और Tel15q-MS2 टेरा AGS WT कोशिकाओं और टेरा-MS2 क्लोन में अभिव्यक्ति टेप । *पी < ०.०५, ख़राब t-test. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्रा 5 . टेरा-MS 2 क्लोनों का लाइव सेल इमेजिंग विश्लेषण । a) MS2-GFP व्यक्त retrovirus, के रूप में प्रोटोकॉल चरण 4 में वर्णित उत्पादन करने के लिए कार्यविधि का ओवरव्यू । MS2 के एक योजनाबद्ध-subtelomere 15q और टेरा MS2 द्वारा मांयता प्राप्त टेप-GFP फ्यूजन प्रोटीन सही पर दिखाया गया है । ख) प्रतिनिधि प्रतिदीप्ति माइक्रोस्कोपी AGS WT और दो टेरा-MS2 क्लोन MS2-GFP व्यक्त की छवि । टेरा-MS2-GFP घावों तीर द्वारा संकेत कर रहे हैं । छवियां एक EMCCD कैमरा के साथ सुसज्जित एक स्पिनिंग डिस्क फोकल माइक्रोस्कोप का उपयोग कर प्राप्त कर रहे थे । छवियां एक इमेजिंग चैंबर में एक 100X/1.46 apochromat उद्देश्य का उपयोग कर कब्जा कर लिया गया 5% CO2के साथ ३७ ° c पर बनाए रखा । एक ४८८ लेजर प्रकाश स्रोत के रूप में इस्तेमाल किया गया था । स्केल बार: 5 µm. ग) लाइव सेल इमेजिंग विश्लेषण के टेरा-MS2-GFP घावों और TRF2-mCherry लेबल telomeres । टेरा-MS2-GFP फ़ोकस और एकल telomere के बीच एक सह-स्थानीयकरण ईवेंट दिखाया गया है । छवियों को बीके रूप में प्राप्त किया गया, का उपयोग ४८८ और प्रकाश स्रोत के रूप में ५२० पराबैंगनीकिरण । एक जेड स्टैक प्रयोग का एक अधिकतम प्रक्षेपण समय चूक इमेजिंग प्रयोग के एक ही समय बिंदु पर प्रदर्शन किया है दिखाया गया है । स्केल बार: 5 µm. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण देखने के लिए

प्राइमरी का नाम प्राइमरी सीक्वेंस अनुप्रयोग
MS2-subtel15q-प्राइमरी-एस TGCATTAAAGGGTCCAGTTG निओमायसिन प्रतिरोधी क्लोनों की पीसीआर स्क्रीनिंग के लिए इस्तेमाल MS2 प्राइमरी फॉरवर्ड
MS2 प्राइमर के रूप में CCTAACTGACACACATTCCACAGA निओमायसिन प्रतिरोधी क्लोनों की पीसीआर स्क्रीनिंग के लिए इस्तेमाल MS2 प्राइमरी रिवर्स
सीटीआर प्राइमर एस टीजीटी ACG सीसीएल ऐका सीएजी TGC टीजी सीटीआर प्राइमरी आगे निओमायसिन प्रतिरोधी क्लोन की पीसीआर स्क्रीनिंग में प्रयुक्त
सीटीआर प्राइमर के रूप में GCT GGA AGG TGG ऐका GCG एक सीटीआर प्राइमरी रिवर्स निओमायसिन प्रतिरोधी क्लोन की पीसीआर स्क्रीनिंग में प्रयुक्त
Tel15q-s GCAGCGAGATTCTCCCAAGC नब्ज प्राइमर qPCR द्वारा Tel15q और Tel15q-MS2 टेरा अभिव्यक्ति का पता लगाने के लिए इस्तेमाल किया
hTel15q-AS TAACCACATGAGCAATGTGGGTG Antisense प्राइमर qPCR द्वारा Tel15q और Tel15q-MS2 टेरा अभिव्यक्ति का पता लगाने के लिए इस्तेमाल किया
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG Antisense प्राइमर qPCR द्वारा Tel15q-MS2 टेरा अभिव्यक्ति का पता लगाने के लिए इस्तेमाल किया
टेरा-आरटी-प्राइमर CCCTAACCCTAACCCTAACCCTAACCCTAA प्राइमर टेरा टेप के retrotranscription के लिए इस्तेमाल किया
sgRNA1 TTGGGAGAATCTCGCTGGCC लघु गाइड आरएनए के अनुक्रम 1 pX335 वेक्टर में क्लोन और subtelomere 15q करने के लिए Cas9 nickase एंजाइमी गतिविधि प्रत्यक्ष करने के लिए इस्तेमाल किया
sgRNA2 TGCATTAAAGGGTCCAGTTG लघु गाइड आरएनए के अनुक्रम 2 pX335 वेक्टर में क्लोन और subtelomere 15q करने के लिए Cas9 nickase एंजाइमी गतिविधि प्रत्यक्ष करने के लिए इस्तेमाल किया

सारणी 1 : इस अध्ययन में प्रयुक्त प्राइमरों की सूची । प्राइमरियों की सूची और इस प्रोटोकॉल में इस्तेमाल किए जाने वाले sgRNAs के जुगाड़ उपलब्ध कराए गए हैं । जुगाड़ 5 ' से 3 ' होते हैं ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

इस लेख में हम मानव कैंसर कोशिका subtelomere 15q भीतर एकीकृत MS2 दृश्यों युक्त क्लोन उत्पंन करने के लिए एक विधि प्रस्तुत करते हैं । इन क्लोनों का प्रयोग, MS2-टेरा subtelomere 15q से प्रतिलिखित अणुओं एक MS2-GFP फ्यूजन प्रोटीन की सह अभिव्यक्ति द्वारा प्रतिदीप्ति माइक्रोस्कोपी द्वारा पता लगाया जाता है । यह दृष्टिकोण शोधकर्ताओं टेरा की गतिशीलता21कोशिकाओं में रहने वाले एक एकल telomere से व्यक्त अध्ययन करने के लिए सक्षम बनाता है । इस प्रोटोकॉल में, टेरा-MS2 क्लोन AGS सेल लाइन है, जो एक दिलचस्प मॉडल को टेरा अध्ययन प्रणाली का प्रतिनिधित्व करता है, के बाद से टेरा अभिव्यक्ति मानव पेट के कैंसर के नमूनों में24में विनियमित है में चुना जाता है । हालांकि, यहां वर्णित प्रोटोकॉल अंय कोशिका लाइनों में टेरा-MS2 क्लोनों के चयन के लिए अनुकूलित किया जा सकता है । MS2 अनुक्रम के एकीकरण के सिद्धांत में एक विशिष्ट MS2 कैसेट और CRISPR रणनीति का उपयोग करके telomere 15q से अलग एक subtelomere में पदोंनत किया जा सकता है । यहाँ प्रस्तुत विधि में एक Cas9 nickase एंजाइम और डबल गाइड RNAs कार्यरत हैं ताकि एकीकरण की विशिष्टता को बढ़ाने के लिए२२. इस रणनीति का प्रयोग, सकारात्मक क्लोनों के एक समग्र 2% AGS कोशिकाओं में पहचान की उंमीद कर रहे हैं । Cas9 एंजाइम के अन्य संस्करणों का क्लोन चयन२५की सफलता दर को बढ़ाने के प्रयास में परीक्षण किया जा सकता है. इसके अलावा, प्रोटोकॉल के निंनलिखित कदम महत्वपूर्ण है खाते में लेने के लिए क्लोन चयन की क्षमता को अधिकतम:

I) क्रम में टेरा-MS2 क्लोन के चयन की संभावना को बढ़ाने के लिए, यह MS2 कैसेट और CRISPR वैक्टर के एक उच्च अभिकर्मक दक्षता प्राप्त करने के लिए महत्वपूर्ण है । खराब transfected सेल लाइनों सबसे अधिक संभावना अभिकर्मक के कई दौर की आवश्यकता होगी, क्लोन चयन और स्क्रीनिंग के क्रम में करने के लिए सकारात्मक क्लोन का चयन करें ।

II) यह निओमायसिन के सटीक एकाग्रता का निर्धारण करने के लिए क्लोन के चयन के लिए उपयोग करने के लिए महत्वपूर्ण है । वास्तव में, दवा की एक कम एकाग्रता का उपयोग झूठी सकारात्मक क्लोन में परिणाम होगा, जबकि एक उच्च एकाग्रता सकारात्मक क्लोनों की पहचान बाधा सकता है । इस प्रोटोकॉल में संकेत निओमायसिन एकाग्रता संवर्धन माध्यम के अलावा से 6-7 दिनों के भीतर AGS कोशिकाओं के लिए घातक है ।

III) क्लोन खरीदना एक महत्वपूर्ण कदम है । वास्तव में, इस प्रक्रिया के दौरान यह आवश्यक है कि केवल एक क्लोन उठाया जाता है । इस कारण से, कालोनियों है कि एक दूसरे को भी बंद कर रहे है आदेश में अलग क्लोन से मिश्रण कोशिकाओं को रोकने के लिए, क्लोन जो MS2 एकाधिक जीनोमिक साइटों पर एकीकृत अनुक्रम शामिल हो सकते है की एक मिश्रित जनसंख्या के चयन में जिसके परिणामस्वरूप से बचा जाना चाहिए । इन घटनाओं की पहचान दक्षिणी ब्लाटर स्क्रीनिंग के दौरान होनी चाहिए ।

IV) जीनोमिक डीएनए की राशि एक धाराप्रवाह ९६ अच्छी तरह से डीएनए प्लेट (प्रोटोकॉल 2) से निकाली के आसपास होने का अनुमान है 5 µ जी और एक एकल प्रतिबंध एंजाइम पाचन के साथ पीसीआर और दक्षिणी सोख्ता द्वारा हर क्लोन स्क्रीन करने के लिए पर्याप्त होना चाहिए. हालांकि, आदेश में आशा telomere पर कैसेट के एकीकरण की पुष्टि करने के लिए, यह दो अलग प्रतिबंध एंजाइमों के साथ जीनोमिक डीएनए पचा द्वारा दक्षिणी दाग से प्रत्येक क्लोन स्क्रीन महत्वपूर्ण हो जाएगा । इस उद्देश्य के लिए, के रूप में प्रोटोकॉल में संकेत दिया, पीसीआर स्क्रीनिंग में सकारात्मक क्लोन 6 अच्छी तरह से प्लेटों में संस्कृति होना चाहिए । जीनोमिक डीएनए की मात्रा एक 6 अच्छी तरह से थाली के एक कुआं से निकाले गए कम से दो प्रतिबंध दक्षिणी दाग विश्लेषण के लिए आवश्यक पचाने के लिए पर्याप्त होगा ।

प्रोटोकॉल में यहां वर्णित है, MS2 अनुक्रम कारणों की एक संख्या के लिए subtelomere 15q भीतर एकीकृत कर रहे हैं: i) टेरा प्रमोटर क्षेत्र और टेरा प्रतिलेखन शुरू साइटों इस subtelomere26,27पर पहचान की गई है; ii) subtelomere 15q से टेरा अभिव्यक्ति इन विट्रो तकनीक4,27,28,29,30का उपयोग करके मान्य किया गया है; iii) गुणसूत्र 15q के subtelomeric क्षेत्र अनुक्रम किया गया है और यह telomeric दोहराने पथ है कि MS2 के एकीकरण के लिए लक्षित किया जा सकता है के निकट एक अनूठा क्षेत्र शामिल है-कैसेट21। पीसीआर और दक्षिणी दाग दृष्टिकोण के लिए टेरा-MS2 क्लोन में subtelomere 15q भीतर MS2 दृश्यों के एकल एकीकरण की पुष्टि करने के लिए विकसित किया गया । यह भी करने के लिए एक निश्चित metaphase गुणसूत्रों में MS2 दृश्यों के गुणसूत्र स्थानीयकरण कल्पना करने के लिए गुणसूत्र पर डीएनए मछली प्रयोगों प्रदर्शन दिलचस्प होगा । हालांकि, 10xMS2 अनुक्रम (४५० बीपी) की लंबाई बहुत ही कम जांच के रूप में आम तौर पर डीएनए में इस्तेमाल किया जांच की तुलना में उपयोग करता है, गुणसूत्र फैलता पर मछली प्रयोगों (बैक्टीरियल कृत्रिम गुणसूत्रों (बीएसी), cosmids या plasmids)31। इस तकनीकी चुनौती हमें गुणसूत्र फैलता है जो प्रोटोकॉल की एक सीमा का प्रतिनिधित्व करता है पर MS2 दृश्यों visualizing से रोका गया है । विधि के एक और सीमा समय और टेरा-MS2 क्लोनों के चयन के लिए आवश्यक प्रयास है । इसके अलावा, विशिष्ट प्रयोगशाला स्थापित करने और वायरस, रेडियोधर्मी सामग्री और सूक्ष्म विश्लेषण के उपयोग के लिए उपकरणों की आवश्यकता है ।

विधि यहां वर्णित विभिंन कोशिका लाइनों में टेरा की पीढ़ी MS2 क्लोन के लिए लागू किया जा सकता है ताकि विभिंन जैविक संदर्भों में टेरा की गतिशीलता को परिभाषित करने के लिए, जैसे telomere रोग या सेलुलर वार्धक्य के दौरान, हमें मदद करने के लिए समझ इन प्रक्रियाओं में टेरा के समारोह । इस दृष्टिकोण का एक दिलचस्प विकास टेरा-MS2 TetO एक विशिष्ट subtelomere पर एकीकृत दोहराया जाता है, MS2-telomere टैग सहित क्लोन की पीढ़ी होगी । एक TetR प्रोटीन की अभिव्यक्ति एक फ्लोरोसेंट प्रोटीन से जुड़े (यानी, mCherry)३२कोशिकाओं में रहने वाले इस विशेष telomere के दृश्य की अनुमति देगा । यह दृष्टिकोण है कि मानव टेरा टेप स्थानीयकरण और सीआईएस में telomere और गुणसूत्र, या ट्रांस में अंय गुणसूत्रों को स्थानांतरित करके टेरा में कार्य की जांच सक्षम हो जाएगा । टेरा के जीवविज्ञान में यह प्रश्न स्पष्ट किया जाने लगा है.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखक कोई प्रतिस्पर्धी वित्तीय हितों की घोषणा

Acknowledgments

हम ट्रेंटो के विश्वविद्यालय में CIBIO की उन्नत इमेजिंग सुविधा के कर्मचारियों के लिए आभारी हैं और वियना में मैक्स एफ Perutz प्रयोगशालाओं (MFPL) में प्रकाशिकी प्रकाश माइक्रोस्कोपी सुविधा. इन परिणामों के लिए अग्रणी अनुसंधान Mahlke-Obermann Stiftung और यूरोपीय संघ अनुसंधान, तकनीकी विकास और अनुदान समझौते नहीं ६०९४३१ चुनाव आयोग के तहत प्रदर्शन के लिए सातवें ढांचे के कार्यक्रम से धन प्राप्त हुआ है । चुनाव आयोग एक रीता लेवी Montalcini फैलोशिप शिक्षा विश्वविद्यालय और अनुसंधान (MIUR) के इतालवी मंत्रालय से समर्थित है ।

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
कैंसर सेल क्लोन की पीढ़ी Telomeric दोहराने-युक्त आरएनए टेरा कल्पना करने के लिए जीवित कोशिकाओं में एक एकल Telomere से व्यक्त
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter