Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Telomeric 반복 포함 된 RNA 테라에서 살아있는 세포에서 단일 Telomere 표현 시각화 하 암 세포 클론의 세대

doi: 10.3791/58790 Published: January 17, 2019

Summary

여기, 선물이 단일 subtelomere에서 MS2 시퀀스 태그를 포함 하는 암 세포 클론을 생성 하는 프로토콜. MS2 GFP 시스템에 의존 하는이 방법은 생 성적표의 telomeric 반복 포함 된 RNA (테라)에서 살아있는 세포에서 단일 telomere 표현의 시각화 수 있습니다.

Abstract

Telomeres는 복사할 수, 반복 포함 하는 긴 noncoding RNAs (테라), telomeric를 야 기한는 telomere 생물학, telomere 길이 항상성 섬으로 형성 등 중요 한 역할을 제안 되었습니다. 최근 연구 결과 밝혀 테라 분자도 마우스 배아 줄기 (ES) 세포에 유전자 발현을 조절 하기 위해 내부 염색체 영역 상호 작용. 이 증거에 따라 RNA 형광 제자리에서 교 잡 (RNA-물고기) 분석만 하위 집합으로 나타났습니다 테라의 성적표는 염색체 끝에 지역화. 테라 분자의 역학의 더 나은 이해는 그들의 기능 및 행동의 메커니즘을 정의 하는 데 도움이 됩니다. 여기, 우리 고 MS2 GFP 시스템을 사용 하 여 암 세포에서 단일 telomere 테라 성적표를 시각화 하는 방법을 설명 합니다. 이 목표에 선물이 안정적인 클론을 생성 하는 프로토콜 MS2 시퀀스에서 단일 subtelomere 통합을 포함 하 AGS 인간 위 암 세포 라인을 사용 하 여. MS2 태그 telomere에서 테라의 전사 (MS2-GFP) GFP 융합 MS2 RNA 의무적인 단백질의 공동 식 시 라이브 세포 형광 현미경 검사 법에 의해 시각 MS2 태그 테라 분자의 표현을 결과입니다. 이 방법은 수 연구원은 암 세포에서 단일 telomere 테라 분자의 역학을 공부 하 고 다른 셀 라인에 적용 될 수 있습니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

긴 noncoding RNA 테라 염색체의 subtelomeric 지역에서 복사할 및 그것의 녹음 방송 종료 telomeric 반복로1,2내 염색체 끝을 향해. 이러한 이유로, 테라 사본 그들의 5' 끝에 subtelomeric 파생 시퀀스의 구성 하 고 telomeric 반복 (척추 동물에 UUAGGG)3종료. 역할 제안 되었습니다 테라,7,8 끝 telomeres4,5, DNA 복제6, 염색체 가운데 동종 재결합을 추진에서 섬으로 형성을 포함 하 여 중요 한 , 9, telomere 구조10및 telomere 길이 항상성2,11,,1213통제. 또한, 테라 성적표 마우스 배아 줄기 (ES) 세포14에 광범위 한 유전자 발현 조절에 수많은 extratelomeric 사이트와 상호 작용 합니다. 이 맞춰 증거, RNA 형광 제자리에서 교 잡 (RNA-물고기) 분석만 테라 성적 하위 집합 나타났습니다 telomeres1,,215에서 지역화 합니다. 또한, 테라 폼 핵 집계 마우스 세포2,16에서 X와 Y 염색체에서 지역화를 보고 되었습니다. 이러한 연구 결과 테라 성적표는 핵 내에서 복잡 한 역학 받아야 나타냅니다. 테라 분자의 역학을 이해 그들의 기능 및 행동의 메커니즘을 정의 하는 데 도움이 됩니다.

MS2 GFP 시스템은 다양 한 유기 체17,18에서 살아있는 세포에서 RNA 분자를 시각화 하기 위해 널리 사용 되었습니다. 이 시스템은 이전 태그를 S. cerevisiae12,19에서 단일 telomere 테라 분자 시각화 사용 되었습니다. 이 시스템을 사용 하 여, 최근에 보였다는 효 모 테라 성적표 지역화 세포질 내 게시물-diauxic 이동 단계 동안 테라 extranuclear 기능20발휘 수 있습니다 제안. 최근 암 세포21단일 telomere 테라 성적표 공부 MS2 GFP 시스템을 사용 했습니다. 이 목표를 우리 MS2 시퀀스는 단일 telomere (telomere 15q,이 하 Tel15q)에 통합 하는 CRISPR/Cas9 게놈 편집 도구를 고용 하 고 얻은 MS2 태그 내 생 Tel15q 테라 (테라 MS2 클론)을 표현 하는 클론. 인식 하 고 생활에 단일 telomere 테라 성적 MS2 RNA 시퀀스 수 시각화를 바인딩합니다 MS2 RNA 바인딩 GFP 융합 단백질 (MS2-GFP)의 공동 식21세포. 여기 설명 하는 프로토콜의 목적은 테라 MS2 클론의 생성에 필요한 단계를 자세히 설명 하는 것입니다.

테라 MS2 클론을 생성 하려면 MS2 카세트 telomere 15q의 subtelomeric 지역 통합은 테라 발기인 지역 및 전사 시작 사이트의 다운스트림. MS2 카세트 lox p 사이트에 의해 형벌 네오 마이 신 저항 유전자를 포함 하 고 subtelomere 15q에의 통합 CRISPR/Cas9 시스템22를 사용 하 여 수행 됩니다. 카세트, 단일 클론 MS2의 transfection 선택 후 카세트의 subtelomeric 통합 PCR에 의해 확인 된다 DNA 시퀀싱 및 남쪽 오 점. 긍정적인 복제품만 MS2 시퀀스 및 subtelomere 15q에 단일 lox p 사이트는 카세트에 선택 표시를 제거 하려면 Cre 표현 아 데 노 바이러스와 감염 됩니다. Tel15q에서 MS2 태그 테라 성적 표현의 실시간 정량 Pcr에 의해 확인 됩니다. 마지막으로, MS2 GFP 융해 단백질은 표현 형광 현미경 검사 법에 의해 MS2 테라 성적표를 시각화 하기 위해 retroviral 감염을 통해 테라 MS2 클론에. 테라 성적표 RNA 물고기에 의해 쉽게 검출 될 수 있다 고 반복 전용 telomeric를 사용 하 여 라이브 셀 이미징 프로브1,2,,1523. 이러한 접근에는 단일 셀 해상도에서 테라 분자의 전체 인구의 지역화에 대 한 중요 한 정보가 나와 있습니다. 단일 subtelomere에서 MS2 시퀀스를 포함 하는 클론의 세대에는 단일 telomere 테라 성적 기능과 테라의 행동의 메커니즘을 정의 하는 데 도움이 됩니다 살아있는 세포에서의 역학을 공부 하는 연구자 수 있게 된다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1입니다. 네오 마이 신 내성 클론의 선택

  1. 햄의 F-12_K (Kaighn) 매체와 10% 태아 둔감 한 혈 청 (FBS), 2 mM L-글루타민, 페니실린 (매체의 mL 당 0.5 단위), 스 (중간의 mL 당 0.2 µ g) 37 ° C, 5% CO2보충에 AGS 세포 성장. SgRNA/Cas9 벡터와 MS2 카세트 1시 10분에 표현 된 50-60% 합류에 셀 transfect 어 금 니 비율21.
    참고: 병렬 실험에서 GFP 표현 벡터 (즉, Cas9-GFP 벡터) transfecting 여 transfection 효율을 확인 합니다. 적어도 60-70 %transfection 효율을 달성 한다.
  2. 다음 날, 0.7 µ g/mL 최종 농도 (선택적 매체)에서 네오 마이 신을 포함 하는 매체 자란 매체를 바꿉니다.
    참고: 셀 분할 하 고 그들을 시드 선택적인 매체에 다음날 transfection 선택 프로세스 속도가 향상 됩니다. 모든 비 페 셀 즉시 죽을 것 이다. Transfection 6 잘 플레이트에서 수행 하는 경우이 경우는 60%에서 각 잘 합류 포함 약 0.7 x 106 셀, 셀 10 cm 접시 포함 하 선택적인 매체에 단일 우물에서 분할 될 수 있습니다 다음 날 됩니다.
  3. 계속 셀 선택적인 매체에 7-10 일에 대 한 변화 하는 매체 마다 하나 또는 이틀, 단일 복제 될 때까지 표시 됩니다.
  4. 세포 클론의 따기
    1. 포함 하는 각 음에 0.25 %trypsin 10 µ L 96 잘 접시를 준비 합니다.
      참고: 두 준비 96 잘 접시 경우에 이상의 96 클론 선택 될 것으로 예상 된다.
    2. 현미경의 사용으로 표시 각 클론의 위치 표시 10 cm 접시에는 마커를 사용 하 여 접시의 바닥에 점 여. 각 점 하 식민지에 대응 됩니다.
    3. 대체 자란 매체와 충분 한 인산 염 버퍼 염 분 (PBS) 클론에 액체의 얇은 필름을 형성 하 여 세포 복제 따기 동안 건조 하 게 하지.
    4. 10 µ L 피 펫을 사용 하 여 단일 식민지를 선택 하십시오. 트립 신 식민지의 5 µ L을 포함 하는 팁을 부착 하 고 천천히 식민지에 지역화 된 유지 trypsin 출시. 1 분에 대 한 셀을 분리 다음 팁과 식민지를 긁 고 팁으로 그것을 빨을 트립 신을 수 있습니다.
      참고:이 절차 동안 내리고 한쪽에 약간 접시 포착 되 고 식민지 주위 PBS의 볼륨을 감소 도움이 될 것입니다 따기 프로세스 식민지 주위 trypsin diluting 피하 여 그래서. 클론 링을 사용 하 여 또한 단일 클론을 따기 도움이 수 있습니다.
    5. 0.25 %trypsin 10 µ L을 포함 하는 96 잘 접시의 우물에는 식민지에서 세포를 놓습니다.
    6. 실 온에서 5 분을 품 어 다음 선택적 매체 (햄의 F-12 K (Kaighn 의) 중간 10 %FBS, 2 mM L-글루타민, 페니실린 (매체의 mL 당 0.5 단위), 스 (중간의 mL 당 0.2 µ g) 보충과 네오 마이 신에 포함 된의 150 µ L 잘 채워 0.7 µ g/mL의 농도입니다.
      참고: 보육 시간 동안 다른 클론 선택 수 있습니다. 가능한 많은 클론을 선택 하는 것이 좋습니다. 더 많은 클론 선택 가능성이 높은 긍정적인 것 들을 식별 될 것입니다.
    7. 일단 모든 클론 선택 96 잘 접시에 전송, 허용 선택적 매체 10 %FBS, 2 mM L-글루타민, 페니실린 (매체의 mL 당 0.5 단위), 스 (0.2 µ g mL 당 보충 햄의 F-12 K (Kaighn 의) 중간에에서 몇 일 동안 성장 하는 세포 매체)의 90%의 합류를 도달할 때까지 37 ° C, 5% CO2, 0.7 µ g/mL의 농도에서 네오 마이 신을 포함 하 고.
  5. 클론의 분
    1. 3 준비 96 잘 접시 잘, 당 젤라틴의 추가 100 µ L에 의해 젤라틴 코팅 실 온에서 30 분 동안 품 어 후 PBS로 두 번 씻어. 이 번호판 DNA 추출 (DNA 플레이트)과 냉동 (냉동 번호판) 복제에 사용 됩니다.
      참고: 젤라틴 첨부 파일의 세포와 DNA의 우물을 추진 하겠습니다. 특히, 젤라틴 코팅 DNA DNA 추출 하는 동안 우물의 바닥에 막대기 및 절차 (아래 설명)을 씻어 수 있습니다. 복제 분할 절차 동안에 그것은 멀티 채널 피 펫을 사용 하는 것이 좋습니다.
    2. 클론 90% 합류에 도달, 96 잘 접시의 각 우물에서 매체를 발음, PBS로 세척, 잘, 당 0.25 %trypsin 30 µ L을 추가 하 고 37 ° c.에 5 분 동안 품 어
      참고: 클론은 클론 당 선택 하는 셀의 수에 따라 달라 집니다 것입니다 또한 다른 속도로 성장할 것입니다. 따라서,이 단계는 다른 클론 90% 합류를 도달 하는 때 몇 일 동안 수행 됩니다.
    3. 잘 당 선택적인 매체의 70 µ L을 추가, 웰 스, 내부를 위아래로 pipetting으로 세포 덩어리를 중단 다음 gelatinized 냉동 번호판 prefilled 재치를 잘 하 고 30 µ L 당 선택적인 매체의 120 µ L로 prefilled gelatinized DNA 접시를 100 µ L의 30 µ L를 전송 (선택) 없이 h 50 µ L 미디어.
    4. 인큐베이터에서 DNA 접시를 놓고 90% 합류까지 37 ° C, 5% CO2 에서 성장 하는 세포를 허용 합니다.
    5. 냉동 접시의 각 음에 얼음의 80 µ L 갓 만든 동결 매체 (80 %FBS 20% 디 메 틸 sulfoxide (DMSO)) x 2를 추가, parafilm (70% 에탄올 뿌리) 각 잘 밀봉, 뚜껑 위에 놓고 포장 알루미늄 호 일 접시에 이렇게 접시 위에 추가. -80 ° c.에 냉동 번호판을 배치
    6. 분할 된 PCR 검사 결과까지 문화에서 그것을 유지 하는 클론을 포함 하는 원래 96 잘 접시를 잘 당 선택적인 매체의 90 µ L를 추가 합니다. 이 접시는 백업 접시로 사용 됩니다.

2. 네오 마이 신 내성 클론의 심사

  1. 96 잘 DNA 접시에서 DNA 추출입니다.
    1. 클론 DNA 접시에 배양 도달 90% 합류, PBS, 2 회 세척 후 50 µ L 세포의 용 해 버퍼 (10 mM Tris pH 7.5, 10 mM EDTA, 10 mM NaCl, 0.5 %SDS, 고 1 mg/mL 가수분해 K) lyse. Parafilm으로 플레이트 커버, 뚜껑을 넣어 각 잘 밀봉, 포장지로 커버 하 고 37 ° C에서 밤새 껏 두기 위하여.
    2. 추가 냉 에탄올 (동부 표준시-OH)의 100 µ L/NaCl 솔루션 (100% 에탄올에 0.75 M NaCl) 각 잘 6 h 또는 하룻밤 실 온에서 침전.
      참고: 프로토콜 수 수 일시 중지 여기.
    3. 접시를 반전 하 여 동부 표준시-오/NaCl 솔루션을 제거 하 고 잘 당 70% 에탄올의 200 µ L로 3 번 세척.
    4. 증류수에 RNAse A 솔루션의 25 µ L을 추가 하 고 1 시간 동안 37 ° C에서 품 어.
  2. 게놈 DNA의 3 µ L를 사용 하 여 PCR 증폭에 대 한. 네오 마이 신 저항 유전자와 subtelomere 15q 단련 하는 뇌관을 사용 하 여 선택 된 클론의 PCR 검사를 수행 합니다. PCR 확대 표준 중 합 효소 효소와 PCR 프로토콜21을 사용 하 여 수행 됩니다.
    참고: PCR MS2 뇌관 (MS2-subtel15q-뇌관-S와 MS2 입문서로)과 클릭률 뇌관 (클릭률 프라임 S 및 클릭률 뇌관으로)에 대 한 조건은 다음: 20 98 ° C의 변성 단계 및 98 ° C 10 s, 58 ° C 20 s, 72 ° C 15 s 34 주기 다음으로 25 µ L에서 중 합 효소 효소를 사용 하 여 반응 혼합 ( 재료의 표참조). 뇌관 순서는 표 1에 표시 됩니다.
  3. Agarose 젤에 PCR 반응을 실행 하 고 표준 젤 추출 절차 (젤 추출 시 약에 대 한 재료의 표 참조)를 사용 하 여 긍정적인 클론에서 얻은 PCR 밴드를 추출.
  4. MS2 시퀀스21의 존재의 확인을 위해 젤 추출 PCR 제품의 DNA 연속 분석을 수행 합니다.
    참고: 시퀀싱 분석 수행할 수 있습니다 PCR 검사에 사용 되는 뇌관을 사용 하 여.
  5. PCR 긍정적인 클론의 남쪽 오 점 심사
    1. 클론 PCR 및 시퀀싱 심사 원래 96 잘 접시 (백업 플레이트)에서 10 %FBS, 2 mM L-글루타민, 페니실린 (매체의 mL 당 0.5 단위), 스 (0.2 µ g 당으로 보충 하는 햄의 F-12 K (Kaighn 의) 중간에 6 잘 플레이트를 긍정적인 성장 매체의 mL) 37 ° C 5% CO2에서 0.7 µ g/mL의 농도에서 네오 마이 신을 포함 하 고.
      참고: 또는, 있다면 이러한 일부 손실, 해 동 냉동 번호판 (프로토콜 2.6 참조) 중 하나에서 그들.
    2. 클론에 90% 합류에 일단 6 잘 플레이트, PBS로 세포 세척 하 고 잘 당 0.5 µ g 가수분해 K를 포함 하는 세포의 용 해 버퍼의 250 µ L을 추가.
    3. 셀 스 크레이 퍼를 사용 하 여 셀을 긁 고 lysate 1.5 mL 튜브에 전송.
    4. 16 h 37 ° C에서 품 어.
    5. 100% 에탄올의 1 mL를 추가 하 고, 적극적으로, 악수 2 시간 이상 침전 또는-20 ° c.에서 하룻밤 DNA를 허용
      참고: 프로토콜 수 수 일시 중지 여기.
    6. 10 분 동안 4 ° C에서 13,400 x g에서 회전 시키십시오, 상쾌한, 삭제 하 고 70% 에탄올과 펠 릿을 세척. 산 탄 어 실 온에서 건조 하 게. 또는, 진공 집중 장치를 사용 하 여.
    7. RNAse A를 포함 하는 증류수 50 µ L에서 DNA 알갱이 resuspend 하 고 37 ° c.에 1 시간에 대 한 품 어
    8. 밤새 소화 반응 37 ° C에서 배양 하 여 100 µ L 반응 볼륨에서 NcoI 및 BamHI 제한 효소 (2 개의 독립적인 소화)를 사용 하 여 게놈 DNA의 5-10 µ g을 소화.
    9. 완전 한 소화 확인 agarose 젤 (agarose 0.8%)에 소화의 4 µ L를 실행 합니다.
    10. 100% 에탄올의 나트륨 아세테이트 3 M 솔루션 pH 5.2와 2 볼륨의 1/10 볼륨 제한 소화 반응에 추가 적어도 2 시간을 품 어 또는 DNA를 침전에-20 ° C에서 하룻밤.
      참고: 프로토콜 수 수 일시 중지 여기.
    11. 13,400 x g 20 분 동안 4 ° C에에 centrifuge supernatants, 삭제 하 고, 70% 에탄올과 펠 릿을 세척. 실내 온도에 공기를 펠 릿 건조 수 있습니다. 또는, 진공 집중 장치를 사용 하 여.
    12. 20 µ L의 증류수에 펠 릿을 resuspend 하 고 0.8 %agarose 젤에 소화 DNA를 로드 합니다.
      참고: 소화 DNA의 더 나은 해결을 위해 긴 젤 최소 15 cm를 준비 하 고 낮은 전압 (̴30 볼트)에서 밤새 껏 달린다. 전기 이동 법 설정 최적화 되어야 합니다.
    13. 다음 날, 실 온에서 30 분 동안 1 µ L/10 mL 최종 농도에 ethidium 평범한 사람 같은 DNA 라벨 에이전트와 젤을 얼룩이 고 악기 이미징 젤에 젤 가까운 통치자와 사진의 찍을.
    14. 나일론 막에 DNA의 전송을 설정 하 고 막 교 잡 MS2 시퀀스 관련 프로브21표준 절차 사용 하 여 수행.
    15. 녹여 PCR, DNA 시퀀싱 및 남부에서 긍정적인 클론 (다음 단계 참조) 두 개의 냉동 접시 중 하나에서 오 점.
  6. 클론의 해빙
    1. 5 mL의 미리 데워 진된 햄의 F-12 K를 포함 한 15 mL 튜브 준비와 10 %FBS, 2 mM L-글루타민, 페니실린 (매체의 mL 당 0.5 단위), 스 (중간의 mL 당 0.2 µ g) 해 동 수를 각 복제에 대 한 보충 (Kaighn 의) 중간.
    2. -80 °에서 냉동 접시 중 하나를 제거 하 고 필요에 잘 포함 하는 동 수를 긍정적인 클론을 미리 데워 F12K 완전 한 매체의 100 µ L를 추가.
      참고:이 절차는 신속 하 게 수행 되어야 합니다 고 냉동 남아 다른 클론을 허용 하기 위하여 각 복제 해 동 후에 드라이 아이스에 96 잘 접시 배치 한다. 이것은 여러 클론 같은 96 잘 접시에서 해 동을 해야 하는 경우에 특히 중요 하다입니다.
    3. 매체와 실 온에서 5 분 동안 800 x g에서 원심 분리기의 5 mL를 포함 하는 15 mL 튜브에 세포를 전송 합니다.
    4. 매체를 발음 하 고 미리 예 열된 완료 F12K 매체의 500 µ L에 셀 resuspend 12 잘 플레이트의 단일 잘 각 복제 전송.
  7. Subtelomere 15q MS2 카세트에서 네오 마이 신 저항 유전자의 제거 통합.
    1. 클론 완전 F12K 매체에서 10 cm 접시 12 잘 접시에서 성장 하는 것을 허용 한다.
      참고: 네오 마이 신 안 포함 되어야 합니다는 매체에 명시 되지 않는 한.
    2. Cre 표현 아 데 노비 루스 10 mL 전체 F12K 매체의 합류 점 70%에서 10 cm 접시에 교양된 있는 셀에 추가 합니다.
      참고: Cre GFP 표현 아 데 노 바이러스를 사용 하 여 100% 접근 해야 감염의 효율성의 평가 허용할 것 이다. 아 데 노비 루스 복제 결함 문화에 몇 구절 후 손실 됩니다.
    3. 3 10 cm 요리에서 셀 분할 감염 후 48 시간. 두 요리 사용할 네오 마이 신 유전자 제거의 확인에 대 한 부정적인 선택, 네오 마이 신을 포함 하는 셀을 성장 매체 (첫 번째 접시), 남부 여 (두 번째 접시) 되 리.
    4. 문화 셀 및 RNA 추출에 대 한 복제를 포함 하는 세 번째 접시.

3. 실시간 정량 Pcr에 의해 테라 MS2 대 본 식의 확인

  1. 네오 마이 신 유전자 제거의 확인, 시 총 RNA 추출에서 테라 MS2 클론 유기 용 제 (페 놀 및 guanidine isothiocynate 솔루션)21을 사용 하 여 수행 합니다.
    1. Diethyl pyrocarbonate (DEPC) 물 100 µ L에 10 cm 접시에서 추출한 RNA resuspend
    2. 농도 및 RNA의 무결성을 확인 하려면 denaturating (1% 포름알데히드-포함) 1 x 3-(N-Morpholino) propanesulfonic 산 (MOPS) 젤에 RNA의 3 µ L를 실행 합니다. 또한 RNA 농도 분 광 광도 계를 사용 하 여 분석.
    3. DNAse와 RNA의 3 µ g 나 DNAse의 1 단위를 사용 하 여 치료 나 60 µ L 최종 반응에에서 효소.
    4. 품 어 1 h 37 ° c.에 대 한 반응
  2. 반전 녹음 방송 반응 및 정량 분석
    1. Nuclease 무료 microcentrifuge 관에는 다음 구성 요소 추가: 1 µ M 테라 특정 뇌관, dNTPs 믹스 (10 mM 각)의 1 µ L, DNAse I 치료 RNA (̴300ng RNA에 해당)의 6 µ L의 2 µ L. DEPC 물 4 µ L로 13 µ L 볼륨을 조정 합니다.
      참고: 각 RNA 분석에 대 한 동일한 시 약 하지만 테라 특정 뇌관 대신 참조 특정 뇌관, 포함 된 두 번째 튜브 준비 되어야 한다.
    2. 5 분 동안 65 ° C에 혼합물을가 열 하 고 적어도 1 분 동안 얼음에서 품 어.
    3. 간단히 원심 분리 하 여 튜브의 콘텐츠를 수집 하 고 5 X RT 효소 버퍼, 1 µ L 0.1 m M dithiothreitol (DTT), 1 µ L의 RNAse 억제제 (4 단위) 및 역전사의 1 µ L의 4 µ L 추가 ( 재료의 표참조).
    4. 60 분 동안 42 ° C에서 샘플을 품 어 다음 정량 분석에 대 한 RT 반응의 2 µ L을 사용 합니다.
  3. 정량 Pcr 반응 혼합 2 x qPCR 마스터 믹스, cDNA 템플릿의 2 µ L, 앞으로 뇌관 (10 µ M), 1 µ L의 역방향 뇌관 (10 µ M), 그리고 물 6 µ L의 1 µ L 10 µ L의 구성 20 µ L의 최종 볼륨에서을 준비 합니다.
  4. 정량 Pcr 반응 thermocycler21표준 프로토콜 사용 하 여 수행 합니다.

4. MS2 GFP 표현 레트로 바이러스의 생산

  1. 레트로 바이러스 벡터 (pBabe-MS2-GFP 순수 하지 않아)와 4: 1의 몰 비를 사용 하 여 (예: pCMV-VSVG) 벡터를 표현 하는 환경 을 유전자 MS2 GFP 융해 단백질 80 %confluent 피닉스 포장 셀 MS2 GFP 표현 레트로 바이러스를 생성 하려면 transfect 두 벡터 스
  2. 다음 날, 신선한 중간 포함 10 m m 나트륨 낙 산 염 (DMEM 보충 10 %FBS, 2 m L-글루타민 m와 펜/Strep) 자란 매체를 바꿉니다.
  3. 37 ° c, 5% CO2, 8 h incubate 다음 신선한 자란 매체에서 바이러스 수집 될 것입니다 매체를 바꿉니다.
  4. 48 h 후 피닉스 셀에서 레트로 바이러스를 포함 하는 매체를 제거 합니다. 이 매체 테라 MS2 클론의 감염에 대 한 직접 사용할 수 있습니다, 어떤 경우에 필터 매체 0.45 μ m 필터를 통해, polybrene (30 µ g/mL 최종 농도) 추가 및 셀 (이 경우 5 단계에서 계속 되는 프로토콜)에 그것을 추가. 또는 레트로 바이러스 50% 말뚝-8000/900 m m NaCl 솔루션의 1/5번째 볼륨을 추가 하 고 회전 바퀴에 4 ° C에서 하룻밤 배양 여 50ml 팔 콘 튜브에 침전 될 수 있습니다.
  5. 다음 날, 30 분 2000 x g에서 원심 분리에 의해 펠 레트로 바이러스 입자에 상쾌한, 제거 하 고 혈 청 하지 않고 F12K 매체에 펠 릿을 resuspend.
    참고: 바이러스 입자는 원래 표면에 뜨는 볼륨의 1/100번째 에 resuspended 수 있습니다. 감염 테스트를 효율적으로 세포를 감염 하는 데 필요한 레트로 바이러스의 최소 볼륨을 확인 하기 위하여 수행 되어야 한다.

5. 살아있는 세포에서 테라 MS2 성적표의 시각화

  1. 판 테라-MS2 클론 고 유리 바닥 요리에서 WT AGS 셀. 감염의 날, 매체 (30 µ g/mL 최종 농도) 및 MS2 GFP 표현 레트로 바이러스 polybrene을 추가 합니다.
  2. 24 시간 후, 바이러스가 포함 된 매체를 삭제 하 고 페 놀 레드 없이 신선한 매체를 추가 합니다.
  3. 적절 한 현미경 설정을 사용 하는 거꾸로 한 현미경에서 세포를 분석 합니다. 100 X 셀 또는 큰 숫자 조리개 (1.4 X)와 민감한 카메라 (EMCCD)를 사용 하 여 60 X 목표 이미지. 환경 제어 시스템을 사용 하 여 이미징 동안 37 ° C, 5% CO2 샘플을 유지.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

그림 1 실험적인 전략의 개요를 나타냅니다. 프로토콜 및 AGS 셀에서 테라 MS2 클론의 세대를 위한 나타내는 타임 라인의 주요 단계 (그림 1A) 표시 됩니다. 1 일에서 6 잘 플레이트의 여러 우물 MS2 카세트와 sgRNA/Cas9 (참조 그림 1B) 벡터 표현 페는. 2 개의 다른 subtelomere 15q 전용 가이드 RNA 순서 Cas9 nickase 표현에서 복제는 pX335 벡터, 공동 transfected MS2 카세트는 2 개의 sgRNA pX335 벡터를 생성. 접시의 한 잘 transfection 효율을 확인 하기 위해 벡터를 표현 하는 GFP와 페 수 있습니다. 2 일에 셀 trypsinized 이며 10 cm 접시 선택적 매체를 포함 하는 단일 잘에서 전송. 3 일에 매체 가장 untransfected 셀 죽은 것으로 변경 되어야 합니다. 세포 클론 표시 하 고 선택할 준비가 될 때까지 선택에서 성장 된다. 이 시간 동안, 셀 하지 trypsinized 수 해야 하 고 자란 보통 1-2 일 마다 변경 해야 첫 번째 주와 다음 2-3 일 마다 나중에 대 한. 일단 단일 클론 볼 수 있습니다, 그들은 선택 하 고 그들이 합류의 80-90%에 도달할 때까지 성장 수는 96 잘 접시에 전송. 이 시점에서, 클론 4 다른 96 잘 접시, 색상 코드와 함께 그림 1 에 표시 된 분할 됩니다. 클론 DNA 접시 (녹색) 경작 80% 합류에 도달, 그들은 있다 lysed 및 게놈 DNA 추출 PCR 검사;에 대 한 백업 플레이트 (파란색)에서 클론 PCR 검사, 붉은 냉동 번호판은-80 ° c.에 고정 하는 동안의 결과까지 문화에 지켜질 것 이다 그림 2 B 는 네오 마이 신 내성 클론의 PCR 검사의 대표적인 결과 보여줍니다. 이 심사, 뇌관의 2 세트 사용 된다: 1 개의 뇌관 쌍 (MS2 뇌관) 네오 마이 신 유전자와 subtelomere 15q 시퀀스 내에서 어 닐 링 MS2 카세트 (뇌관 지역화의 대표 이미지에에서 나와 의 존재를 확인 하는 데 사용 됩니다 그림 2A). 두 번째 뇌관 쌍 (클릭률 뇌관) 어 닐 링 내부 염색체 지역에서 (뇌관 순서는 1에 표시 된) false 네거티브 클론의 존재를 확인 하는 데 사용 됩니다. 카세트의 통합에 대 한 부정적인 클론 MS2 뇌관 확대에 부정적이 고 긍정적인 클릭률 뇌관 증폭을 해야 합니다. 게놈 DNA 나 그 오염 결과로 게놈 DNA 추출에 기술 문제 MS2 및 클릭률 뇌관 반응에서 PCR 증폭을 배제 것 이다. 이러한 경우에, 관련 된 클론 수 다시 상영 PCR에 의해 백업 플레이트에서 게놈 DNA 추출 시. 긍정적인 복제품의 MS2 뇌관 증폭에서 얻은 밴드 젤 추출 및 10 MS2 시퀀스의 존재를 확인 하기 위해 MS2 뇌관을 사용 하 여 시퀀스 된 될 수 있습니다.

PCR 검사에서 긍정적인 클론은 게놈 DNA 추출 및 남쪽 오 점 분석 lysed 그 다음 6 잘 플레이트에 96 잘 백업 플레이트 ( 그림 1에서 파란색 접시)에서 경작. 그림 2 D 젤 (왼쪽)과 방사성 이라는 MS2 시퀀스 특정 프로브 (오른쪽)의 PCR 긍정적인 클론의 남쪽 오 점 심사 때 교배 하는 막의 대표적인 이미지를 보여줍니다. Subtelomere 15q에 MS2 시퀀스 통합의 확인에 대 한 각 복제에서 추출한 게놈 DNA 두 개의 별도 소화 반응에 (NcoI와 BamHI) 두 개의 다른 금지 효소로 소화 한다. NcoI 및 BamHI 제한 효소는 subtelomere 15q에 MS2 카세트 통합의 확인에 적합 합니다. 다른 효소는 또한 사용 될 수 있습니다. 젤이 보여준다 게놈 DNA의 완전 한 소화 BamHI 제한 효소를 사용 하 여 얼룩의 존재에 의해 표시 된 대로. 남쪽 오 점 결과 나타냅니다 그 클론이 subtelomere 15q에 MS2 카세트의 통합에 대 한 긍정적인 여러 밴드의 존재에 의해 표시 된 대로 여러 클론은 카세트의 여러 통합 이벤트를 표시 하는 동안. 긍정적인 복제품은 genomic DNA21의 NcoI 소화 시 두 번째 남부 오에 의해 분석 되어야 합니다. Subtelomere 15q 포함 하는 MS2 카세트의 대표 이미지와 NcoI 및 BamHI 제한 효소 사이트의 위치는 그림 2C에 표시 됩니다.

클론 긍정적인 PCR 및 남쪽 오 점 분석에 감염 된 Cre GFP 표현 아 데 노비 루스 MS2 카세트에 네오 마이 신 유전자를 제거 하려면. 그림 3 A 묘사 MS2 태그 subtelomere 15q Cre 식 전후. 복제 subtelomere 15q에 MS2 카세트 통합에 대 한 긍정적인 이미지 Cre GFP 그림 3B에서 볼 수 표현 아 데 노비 루스 감염. 모든 셀에 네오 마이 신 유전자의 완전 한 제거를 위한 감염 효율 약 100% 되어야만 합니다. 그림 3C같이 네오 마이 신 유전자의 제거를 확인 하려면 Cre GFP 감염 세포는 분할 세 접시에 감염에서 48 시간 후. 한 접시 네오 마이 신 존재 경작 될 것 이다. 이 접시에 있는 모든 셀은 6-7 일 이내 죽을 한다. 두 번째 접시에서 80-90% 합류를 선택 하지 않고 완전 한 매체에서 성장 세포를 허용 됩니다. 이 시점에서 게놈 DNA 추출 이며 남쪽 오 점 분석. 세 번째 접시는 냉동 주식 복제 및 RNA 추출에 대 한 준비와 테라 MS2 대 본 식의 실시간 정량 분석 수 있도록 완전 한 매체에서 경작. 그림 3 Cre GFP 감염 전후 D 긍정적인 클론의 남쪽 오 점 분석의 대표 이미지를 보여줍니다. DNA agarose 젤 (왼쪽 이미지) NcoI 제한 효소를 사용 하 여 게놈 DNA의 완전 한 소화를 확인 합니다. 남쪽 오 점 분석은 방사성 이라는 MS2 시퀀스 특정 조사 (오른쪽 이미지)을 사용 하 여 수행 되었다. 이 분석은 네오 마이 신 유전자의 제거를 확인합니다. Cre GFP 감염 샘플에서 얼룩의 존재 확인 MS2 시퀀스의 telomeric 통합 합니다. 15q subtelomere 내의 NcoI 제한 사이트의 위치는 그림 3에 표시 됩니다.

네오 마이 신 저항 유전자의 제거를 확인 하는 일단 클론 테라 MS2 성적 표현에 대 한 테스트할 수 있습니다. 이 목표를 총 RNA는 각 복제에서 추출 하 고(그림 4)의 무결성을 확인 하는 denaturating MOPS 젤에서 실행. 리보솜 RNA 밴드 4700 기지 (28S rRNA)에서 볼 수 있어야 하 고 1900 기지 (18S rRNA). Retrotranscription 반응 telomeric 반복-특정 뇌관을 사용 하 여 수행 됩니다 및 테라 식의 정량 분석 참조 유전자 특정 뇌관 (그림 4B, 위)는 뇌관의 2 세트를 사용 하 여 수행 됩니다: 한 뇌관 쌍 MS2 시퀀스와 subtelomere 15q 시퀀스; 어 닐 링 15q subtelomere 내에서 단련 하는 뇌관의 두번째 쌍. 뇌관 순서는 1에 표시 됩니다. 그림 4B 에서 제시 하는 그래프 AGS WT 셀과 두 개의 다른 테라 MS2 클론에서 테라 식의 실시간 정량 분석을 보여줍니다. 이러한 분석 subtelomere 15q WT 세포에서에서 표현 하는 테라 성적표에 대 등 한 수준에서 두 개의 클론에 테라 MS2 성적 표현의 확인 합니다. 이러한 데이터 선택 2 테라 MS2 클론 라이브 셀 이미징 녹취 록 테라 MS2의 분석에 대 한 적합 한 나타냅니다.

살아있는 세포에서 테라 MS2 성적표를 시각화 하기 위해 선택 된 클론 MS2 GFP 융해 단백질을 표현 하는 레트로 바이러스로 감염 된다. 그림 5 A 프로토콜 4 단계에 설명 된 대로 MS2 GFP 표현 레트로 바이러스, 생성 하는 절차를 보여 줍니다. AGS WT 세포 및 테라 MS2 유리 바닥 요리에 감염 됩니다. 감염에서 24 h 후 세포 형광 현미경 검사 법에 의해 분석 된다. 신호의 특이성 테라-MS2-GFP foci AGS WT 셀 (그림 5B) 그리고 테라 MS2 클론의 핵에서 발견의 존재에 의해 확인 된다. MS2 GFP의 인구에서 표현 하는 셀, 셀 간에 MS2 GFP 수준 측면에서와 이미징 분석에 대 한 낮은 레벨을 표현 하는 셀을 선택 합니다. 또는, MS2 GFP 표현 셀 GFP의 저급을 표현 하는 세포의 부분 모집단을 수집 하기 위해 FACS 이전 현미경 분석에 의해 정렬할 수 있습니다. 우리는 이전 테라-MS2-GFP foci에서 40% ~ 60% 셀 AGS 테라-MS2의21를 복제 발견. 이러한 셀에 1 ~ 4 테라-MS2-GFP foci 셀 당 몇 군데 있었다. 테라-MS2-GFP foci 명백한 크기 및 역학 발견된21일 수 있다. 테라 MS2 클론 단일 telomere 테라 성적표 살아있는 세포에서의 역학 연구를 사용할 수 있습니다. 이 응용 프로그램의 예를 들어, 그림 5C 는 테라 MS2 클론 MS2 GFP 융해 단백질와 TRF2에 mCherry를 융합 하는 telomere 바인딩 단백질의 현미경 분석에서 대표 이미지 테라 MS2 태그 성적 및 살아있는 세포의 telomeres를 시각화 합니다. 이 방법을 사용 하 여, 우리는 이전 관찰 테라-MS2-GFP foci 공동 44%는 세포의 telomeres와 지역화는 테라 성적표만 뚜렷이 공동 지역화 AGS 셀21에 염색체 끝을 나타내는.

Figure 1
그림 1 . 실험적인 전략 및 테라-MS의 세대를 위한 나타내는 타임 라인의 개요2 복제 AGS 셀에. A) 테라 MS2의 선택 복제에 대 한 프로토콜을 나타내는 타임 라인에 설명 된 단계에 표시 됩니다. 셀은 선형화 MS2 카세트와 벡터를 표현 하는 sgRNA/Cas9 6 잘 플레이트에 페. 색상 코드 백업 플레이트와 냉동 번호판 프로토콜 섹션에 표시 된 DNA 접시를 구별 하는 데 사용 됩니다. B) The MS2 카세트 MS2 시퀀스의 10 번 반복 다음 800 nt 긴 subtelomere 15q 시퀀스의 구성 그리고 lox p에 의해 형벌 네오 마이 신 저항 유전자 사이트 300 nt 긴 telomeric 반복 관을 3' 끝으로 종료 됩니다. sgRNA/Cas9 표현 벡터 BbsI 제한 사이트21,22를 사용 하 여 pX335 벡터에 subtelomere 15q 전용 가이드 RNA 시퀀스를 복제에 의해 생성 되었다. 두 개의 서로 다른 sgRNA-pX335 벡터 생성 된 고 두 벡터의 1:1 믹스는 transfection를 위해 사용 되었다. sgRNAs의 시퀀스는 1에 표시 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 . 대표 이미지와 남부 PCR의 네오 마이 신 내성 클론의 오 점. A) subtelomere 15q MS2 카세트 포함의 대표 이미지. PCR 검사에 대 한 사용 MS2 뇌관 (MS2-subtel15q-뇌관-S와 MS2 입문서로)의 위치가 표시 됩니다. 카세트 내의 loxP 사이트는 빨간색으로 표시 됩니다. B) 뇌관, MS2 뇌관 및 클릭률 뇌관 (클릭률 프라임 S 및 클릭률 뇌관으로)의 두 세트를 사용 하 여 네오 마이 신 내성 클론의 PCR 검사의 대표 이미지. C) subtelomere 15q MS2 카세트 포함의 대표 이미지. BamHI 및 NcoI 금지 사이트와 남쪽 오 점 심사에 대 한 사용 MS2 프로브 표시 됩니다. D) 왼쪽: genomic dna 복제 당 10 µ g BamHI와는 agarose 젤에 실행 소화 했다. 이미지는 하룻밤 30 볼트 실행 후 인수 되었다. 오른쪽: BamHI 제한 효소로 소화 하는 genomic DNA 충전 된 나일론 막 전송 되었고 방사성 표시 MS2 시퀀스 관련 프로브 때 교배. 빨간색 상자는 긍정적인 밴드의 예상된 크기를 나타냅니다. 빨간색 화살표는 하나의 긍정적인 복제를 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3 . 네오 마이 신 저항 유전자 및 검증 실험 제거 A) subtelomere 15q Cre 식 전후 MS2 카세트 포함의 대표 이미지. 남쪽 오 점 분석 및 NcoI 금지 효소 사이트 사용 MS2 특정 조사 표시 됩니다. 카세트 내의 loxP 사이트는 빨간색으로 표시 됩니다. B) 테라 MS2 클론 Cre GFP 표현 아 데 노비 루스 감염의 형광 현미경 분석. 단일 초점 비행기에서 획득 하는 대표적인 이미지 표시 됩니다. 나, 다양 한 감염, 바이러스 감염에 대 한 사용의 수와 호스트 셀 수 비율입니다. 눈금 막대: 30 µ m C) 네오 마이 신 유전자의 제거를 확인 하는 데 사용 하는 실험적인 전략의 개요. Cre-GFP에 감염 된 세포는 i) 부정적인 선택, ii) 남쪽 오 점 분석 및 iii) 준비 냉동된 셀 주식 및 RNA 추출의 감염에서 48 시간 후 세 접시에 분할 됩니다. 테라 MS2의 D) 남쪽 오 점 분석 클론 Cre GFP 아 데 노 바이러스 감염 전후. 10 µ g 게놈 DNA의 제한 효소 NcoI와 함께 소화 했다. Agarose 젤 확인 완전 한 소화 두 클론 (왼쪽)에서 이루어집니다. 소화 genomic DNA 충전 된 나일론 막 옮겨 졌다 고 MS2 시퀀스 관련 프로브를 사용 하 여 때 교배. 네오 마이 신 유전자의 완전 한 제거는 특정 밴드의 부재에 의해 확인 된다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4 . 전화의 실시간 정량 분석15q-테라와 전화15q-테라-MS2 성적 표현. A) AGS WT 세포 및 테라 MS2에서 추출한 총 RNA를 보여주는 MOPS 젤의 대표 이미지. 해당 밴드 리보솜 RNAs에 28S와 18S는 표시 됩니다. B) 탑: 테라 성적 표현 MS2 태그 subtelomere 15q 회로도. 뇌관 (노란색) 테라 retrotranscription 및 Tel15q-테라 (블루) 및 Tel15q MS2 테라 (레드)의 정량 분석에 사용 되는 표시 됩니다. LoxP 사이트는 빨간색으로 표시 됩니다. 아래: AGS WT 세포 및 테라 MS2 Tel15q-테라와 Tel15q MS2 테라 성적 표현의 실시간 정량 분석 복제 합니다. p < 0.05, 짝이 없는 t-테스트. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 5
그림 5 . 라이브 셀 이미징 분석 테라-MS의2 클론. A) 프로토콜 4 단계에 설명 된 대로 MS2 GFP 표현 레트로 바이러스, 생산 절차의 개요. MS2 태그 subtelomere 15q과 MS2 GFP 융합 단백질에 의해 인식 하는 테라 녹취 록의 회로도 오른쪽에 표시 됩니다. B) AGS WT와 2 테라-MS2의 대표적인 형광 현미경 이미지 복제 MS2 GFP를 표현. 테라-MS2-GFP foci 화살표로 표시 됩니다. 이미지는 EMCCD 카메라 장착 회전 디스크 confocal 현미경을 사용 하 여 인수 했다. 이미지 X 100을 사용 하 여 캡처된 / 영상 실에서 1.46 apochromat 목표 5% CO2와 37 ° C에서 유지. 488 레이저 광원으로 사용 되었다. 눈금 막대: 5 µ m. C) 라이브 셀 이미징 테라-MS2-GFP foci 및 TRF2 mCherry의 분석 telomeres 표시. 테라-MS2-GFP 초점 및 단일 telomere 사이 공동 지역화 이벤트 표시 됩니다. 이미지 B, 488 520 레이저 광원으로 사용 하 여에서 인수 했다. Z 최대 투영 스택 시간 경과 이미징 실험의 포인트 표시 됩니다 한 번에 수행 하는 실험. 눈금 막대: 5 µ m. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

뇌관 이름 뇌관 순서 응용 프로그램
MS2-subtel15q-뇌관-S TGCATTAAAGGGTCCAGTTG 앞으로 네오 마이 신 내성 클론의 PCR 검사 사용 MS2 뇌관
MS2 뇌관으로 CCTAACTGACACACATTCCACAGA MS2 뇌관 역방향 네오 마이 신 내성 클론의 PCR 검사에 대 한 사용
CTR 뇌관 S TGT ACG CCA ACA CAG TGC 안내 앞으로 네오 마이 신 내성 클론의 PCR 검사에 사용 되는 클릭률 뇌관
CTR 뇌관으로 GCT GGA AGG TGG ACA GCG A CTR 뇌관 역방향 네오 마이 신 내성 클론의 PCR 검사에 사용
Tel15q-S1 GCAGCGAGATTCTCCCAAGC 정량에 의해 Tel15q와 Tel15q MS2 테라 식 감지 하는 데 사용 하는 감각 뇌관
hTel15q-AS TAACCACATGAGCAATGTGGGTG 정량에 의해 Tel15q와 Tel15q MS2 테라 식 감지 하는 데 사용 하는 센스 뇌관
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG 정량에 의해 Tel15q MS2 테라 식 감지 하는 데 사용 하는 센스 뇌관
테라-RT-뇌관 CCCTAACCCTAACCCTAACCCTAACCCTAA Retrotranscription 테라 성적에 대 한 사용 뇌관
sgRNA1 TTGGGAGAATCTCGCTGGCC 짧은 가이드 RNA 1의 시퀀스 pX335 벡터에 복제 하 고 Cas9 nickase subtelomere 15q에 효소 활동을 직접 하는 데 사용
sgRNA2 TGCATTAAAGGGTCCAGTTG 짧은 가이드 RNA 2의 시퀀스 pX335 벡터에 복제 하 고 Cas9 nickase subtelomere 15q에 효소 활동을 직접 하는 데 사용

테이블 1 :이 연구에 사용 된 뇌관의 목록. 뇌관과이 프로토콜에 사용 되는 sgRNAs의 시퀀스의 목록이 제공 됩니다. 시퀀스는 5' 3'.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

이 문서에서 우리는 subtelomere 15q 통합 MS2 시퀀스를 포함 하는 인간의 암 세포 클론을 생성 하는 방법을 제시. 이러한 클론을 사용 하 여, subtelomere 15q에서에서 복사할 MS2 태그 테라 분자 MS2 GFP 융해 단백질의 공동 식으로 형광 현미경 검사 법에 의해 검색 됩니다. 이 방법은 단일에서 표현 하는 테라의 역학을 공부 하는 연구자 수 생활에서 telomere21세포. 이 프로토콜에서 테라 MS2 클론 AGS 셀 라인, 테라, 테라 식 이기 때문에 인간의 위 암 샘플24upregulated 공부 하는 재미 있는 모델 시스템을 나타내는 선택 됩니다. 그러나, 여기에 설명 된 프로토콜은 다른 셀 라인에서 테라 MS2 클론 선택 적용할 수 있습니다. MS2 시퀀스의 통합 원리에 홍보하실 수 있습니다 subtelomere 다른 telomere 15q에 특정 MS2 카세트 및 CRISPR 전략을 사용 하 여. 여기에 제시 된 방법에서 Cas9 nickase 효소 및 이중 가이드 RNAs 통합22의 특이성을 증가 하기 위하여 채택 된다. 이 전략을 사용 하 여, 긍정적인 클론의 전체 2 %AGS 셀에서 확인 될 것으로 예상 된다. 클론 선택25의 성공률을 증가 하는 시도에서 Cas9 효소의 다른 버전을 테스트할 수 있습니다. 또한, 프로토콜의 다음 단계는 클론 선택의 효율성을 최대화 하기 위해 고려해 야 할 중요 한 것 들.

I) 테라 MS2 클론 선택의 기회를 증가 하기 위하여 MS2 카세트와 CRISPR 벡터의 높은 transfection 효율을 달성 하는 것이 중요 하다. 저조한 transfected 세포 대부분 긍정적인 클론을 선택 하기 위해 transfection, 클론 선택 및 심사의 여러 라운드를 요구할 것 이다.

II)는 클론의 선택에 사용할 네오 마이 신의 정확한 농도 결정 하는 것이 중요입니다. 실제로, 약물의 낮은 농도 사용 하 여 높은 농도 긍정적인 클론의 식별을 방해 수 있습니다 동안 거짓 긍정적인 클론 발생 합니다. 이 프로토콜에 표시 된 네오 마이 신 농도 치명적인 AGS 셀에 6-7 일 자란 매체에 추가에서 있습니다.

클론 III) 따기 중요 한 단계입니다. 실제로,이 절차 동안에 그것은 필요한만 단일 클론 선택 됩니다. 이런이 이유로, 서로 혼합 하는 것을 막기 위해 피해 야 한다 너무 가까이 있습니다 식민지 다른 클론에서 세포에 대 한 여러 게놈 사이트 통합 MS2 시퀀스를 포함할 수 있는 클론의 혼합된 인구의 선택의 결과. 남쪽 오 점 심사 하는 동안 이러한 이벤트를 식별 합니다.

4) 합칠 96 잘 DNA 접시 (프로토콜 2)에서 추출한 게놈 DNA의 양을 약 5 µ g을 것으로 추정 된다 고 PCR 및 단일 제한 효소 소화와 남부 럽 모든 복제에 충분 해야 합니다. 그러나, 예상된 telomere에 카세트의 통합을 확인, 그것은 2 개의 다른 제한 효소로 게놈 DNA를 소화 하 여 남쪽 오 점 하 여 각 복제에 중요 한 됩니다. 이 목표는 프로토콜에 표시 된 대로 클론 PCR 검사에서 긍정적인 되어야 6 잘 플레이트에서 경작. 6 잘 플레이트의 우물에서 추출 하는 genomic DNA의 양을 두 개 이상 제한 소화 남쪽 오 점 분석에 필요한에 대 한 충분 한 될 것입니다.

여기에 설명 된 프로토콜 MS2 시퀀스 subtelomere 15q 여러 가지 이유로 내 통합: 나) 테라 발기인 지역과 테라 전사 시작 사이트가 subtelomere26,27;에 확인 되었습니다 ii) 테라 식 subtelomere 15q에서에서 생체 외에서 기술4,27,,2829,30;를 사용 하 여 검증 된 iii) 염색체 15q의 subtelomeric 지역을 시퀀싱 하 고 MS2 카세트21의 통합 대상이 될 수 있는 telomeric 반복 요로에 인접 한 독특한 지역 포함. PCR 및 남쪽 오 점 접근 확인 subtelomere 15q 테라 MS2 클론에서 내 MS2 시퀀스의 단일 통합 개발 되었다. 그것은 또한 고정된 분열 중 기 염색체의 MS2 시퀀스의 염색체 지 방화를 시각화 하기 위해 염색체 확산에 DNA-물고기 실험을 수행 하기 위해 재미 있을 것. 그러나,는 10xMS2의 길이 시퀀스 (450 bp) 염색체 스프레드 (세균 인공 염색체 (Bac), cosmids 또는 플라스 미드)31에 DNA-물고기 실험에서 일반적으로 사용 하는 프로브에 비해 매우 짧은 프로브를 사용 하 여 부과. 이 기술에 도전 하지 못했습니다 우리는 프로토콜의 한계를 나타내는 염색체 스프레드에 MS2 시퀀스를 시각화에서. 방법의 한 추가 제한 시간과 테라 MS2 클론을 선택 하는 데 필요한 노력입니다. 또한, 특정 실험실을 설정 및 바이러스, 방사성 물질 및 현미경 분석의 사용에 대 한 장비 필요 됩니다.

여기 설명 하는 방법은 telomere 부전 또는 세포질 노 쇠, 우리 이해를 돕고 동안 다양 한 생물학 문맥에서 테라의 역학 관계를 정의 하기 위해 다른 셀 라인에서 테라 MS2 클론의 세대에 대 한 구현 이러한 프로세스에는 테라의 함수입니다. 이 접근의 흥미로운 개발 TetO 포함 된 테라 MS2 클론의 세대 반복 MS2 태그 telomere를 포함 하 여 특정 subtelomere에 통합 될 것입니다. 형광 성 단백질 (즉, mCherry)를 융합 하는 TetR 단백질의 표현이 시각화 하면 생활에 특정 telomere 세포32. 이 이렇게 인간의 테라 성적표 지역화 하 고 cis에서 telomere를 염색체, 또는 트랜스에서 다른 염색체에 재배치 하 여 속기 테라에 행동 하는 여부의 조사를 수 있게 된다. 테라의 생물학에서이 질문을 명확히 해야 남아 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자 아무 경쟁 금융 관심 선언

Acknowledgments

우리는 Trento의 대학에 CIBIO의 고급 이미징 시설 및 비엔나에서 BioOptics 빛 현미경 시설 최대 F. Perutz 실험실 (MFPL)에서 직원에 게 감사. 이러한 결과 연구는 기금을 받았다 Mahlke Obermann 재단 및 연구, 기술 개발 및 실증에 대 한 유럽 연합의 7 차 프레임 워크 프로그램에서 부여 계약 없음 609431 적에 EC는 이탈리아 정부 대학 교육 및 연구 (MIUR)에서 리 타 레비 Montalcini 친교에 의해 지원 됩니다.

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
Telomeric 반복 포함 된 RNA 테라에서 살아있는 세포에서 단일 Telomere 표현 시각화 하 암 세포 클론의 세대
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter