Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Generering av kreft cellen kloner å visualisere Telomeric gjenta inneholder RNA TERRA uttrykt fra en enkelt Telomere i levende celler

doi: 10.3791/58790 Published: January 17, 2019

Summary

Her presenterer vi en protokoll for å generere kreft cellen kloner en MS2 sekvens kode på en enkelt subtelomere. Denne tilnærmingen, avhengig av MS2-GFP systemet, gjør visualisering av endogene transkripsjoner av telomeric gjenta inneholder RNA (TERRA) uttrykt fra en enkelt telomere i levende celler.

Abstract

Telomeres er transkribert, gir opphav til telomeric gjenta inneholder lang noncoding RNAs (TERRA), som har blitt foreslått å spille viktige roller i telomere biologi, inkludert heterochromatin formasjon og telomere lengde homeostase. Nyere funn avslørte at TERRA molekyler også samhandle med interne chromosomal områder å regulere byggkorn under musen embryonic stem (ES) celler. I tråd med dette beviset, RNA fluorescens i situ hybridisering (RNA-fisk) analyser har vist at bare et delsett av TERRA transkripsjoner lokalisere kromosom slutter. En bedre forståelse av dynamikken i TERRA molekyler bidrar til å definere deres funksjon og virkningsmekanismer. Her beskriver vi en metode for å merke og visualisere single-telomere TERRA utskrifter i celler ved hjelp av MS2-GFP-systemet. Til dette målet presenterer vi en protokoll for å generere stabil kloner, bruker AGS menneskelige mage kreft cellen linjen som inneholder MS2 sekvenser integrert på en enkelt subtelomere. Transkripsjon av TERRA fra MS2-merket telomere gir uttrykk for MS2-merket TERRA molekyler som er visualisert ved live-celle fluorescens mikroskopi på co uttrykk for et MS2 RNA-bindende protein smeltet til GFP (MS2-GFP). Dette gir forskere til å studere dynamikken i enkelt-telomere TERRA molekyler i kreftcellene, og den kan brukes på andre linjer.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Den lange noncoding RNA TERRA er transkribert fra subtelomeric regionen av kromosomer, og dens transkripsjon fortsetter mot kromosom endene, avsluttes innen telomeric gjenta spor1,2. Derfor TERRA transkripsjoner består av subtelomeric-avledet sekvenser på 5' slutten og avslutte med telomeric gjentar (UUAGGG i virveldyr)3. Viktige roller er foreslått for TERRA, inkludert heterochromatin formasjon på telomeres4,5, DNA replikering6, fremme homologe rekombinasjon blant kromosom ender7,8 , 9, regulere telomere struktur10og telomere lengde homeostase2,11,12,13. Videre samhandle TERRA transkripsjoner med mange extratelomeric nettsteder å regulere utbredt byggkorn under musen embryonic stem (ES) celler14. I tråd med dette bevis, RNA fluorescens i situ hybridisering (RNA-fisk) analyser har vist at bare et delsett av TERRA transkripsjoner lokalisere telomeres1,2,15. I tillegg har TERRA blitt rapportert til skjemaet kjernefysiske aggregat lokalisere på X og Y kromosomer i musen celler2,16. Disse funnene tyder på at TERRA transkripsjoner gjennomgå komplekse dynamikken i kjernen. Forstå dynamikken i TERRA molekyler vil bidra til å definere sine funksjon og virkningsmekanismer.

MS2-GFP systemet har vært mye brukt til å visualisere RNA molekyler i levende celler fra ulike organismer17,18. Dette systemet har tidligere blitt brukt til å kode og visualisere single-telomere TERRA molekyler i S. cerevisiae12,19. Bruke dette systemet, var det nylig vist at gjær TERRA transkripsjoner lokalisere i cytoplasma i post-diauxic Skift fasen antyder at TERRA kan utøve extranuclear funksjoner20. Vi har nylig brukt MS2-GFP systemet for å studere single-telomere TERRA utskrifter i kreft celler21. Til dette målet, vi ansatt CRISPR/Cas9 genomet redigering verktøyet å integrere MS2 sekvenser på en enkelt telomere (telomere 15q, senere Tel15q) og fikk kloner uttrykke MS2-merket endogene Tel15q TERRA (TERRA-MS2 kloner). Co uttrykk for et GFP-smeltet MS2 RNA-bindende protein (MS2-GFP) som gjenkjenner og binder MS2 RNA sekvenser gjør visualisering av enkelt-telomere TERRA utskrifter i levende celler21. Formålet med protokollen illustrert her er å beskrive i detalj trinnene som kreves for generasjonen av TERRA-MS2 kloner.

Vil generere TERRA-MS2 kloner, kassetteninn MS2 er integrert i subtelomeric regionen av telomere 15q, nedstrøms TERRA promoter regionen og transkripsjon startwebstedet. MS2 kassett inneholder et neomycin motstand gen flankert av lox-p, og integrasjon på subtelomere 15q utføres med CRISPR/Cas9 systemet22. Etter hva av MS2 kassett, enkelt kloner velges og subtelomeric integrering av kassetten er bekreftet av PCR, DNA sekvensering og sørlige blot. Positiv kloner er infisert med en grobunn-uttrykke adenovirus for å fjerne markøren i kassetten, bare MS2 sekvenser og et enkelt lox-p nettsted på subtelomere 15q. Uttrykk for MS2-merket TERRA transkripsjoner fra Tel15q kontrolleres av RT-qPCR. Endelig MS2-GFP fusion protein er uttrykt i TERRA-MS2 kloner via retroviral infeksjon for å visualisere MS2-TERRA transkripsjoner av fluorescens mikroskopi. TERRA utskrifter kan lett oppdaget av RNA-fisk og live-celle bildevisning telomeric gjenta-spesifikke sonder1,2,15,23. Disse gir viktig informasjon om lokalisering av den totale befolkningen i TERRA molekyler enkeltcelle oppløsning. Generering av kloner som inneholder MS2 sekvenser på en enkelt subtelomere kan forskere til å studere dynamikken i enkelt-telomere TERRA utskrifter i levende celler, som bidrar til å definere funksjonen og virkningsmekanismer av TERRA.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Utvalg av Neomycin motstandsdyktig kloner

  1. Vokse AGS celler i Ham F-12_K (Kaighn) medium med 10% fosterets Bovine Serum (FBS), 2 mM L-glutamin, penicillin (0,5 enheter per mL av medium) og streptomycin (0,2 µg per mL av medium) på 37 ° C og 5% CO2. Transfect cellene på en 50-60% samløpet med sgRNA/Cas9 uttrykke vektor og MS2 kassetten på en 1:10 molar forholdet21.
    Merk: I en parallell eksperiment, kan du kontrollere hva effektivitet ved transfecting en GFP-uttrykke vektor (dvs. Cas9-GFP vektor). Minst 60-70% transfection effektivitet skal oppnås.
  2. Dagen erstatte culturing mediet med medium som inneholder neomycin på 0,7 µg/mL siste konsentrasjon (selektiv medium).
    Merk: Dele cellene og seeding dem i selektiv medium dagen etter transfection fart utvelgelsesprosessen. Alle ikke-transfekterte celler dør umiddelbart. Hvis hva utføres i 6 bra plater, da hver brønn på en 60% inneholder samløpet ca 0,7 x 106 celler, dagen cellene kan deles fra en enkelt brønn til en 10 cm parabolen med selektiv medium.
  3. Holde cellene i selektiv medium for 7-10 dager, endre medium hver ett eller to dager, til enkelt kloner er synlige.
  4. Plukking av cellen kloner
    1. Forberede en 96 godt plate inneholder 10 µL av 0,25% trypsin i hver brønn.
      Merk: Forberede to 96 godt plater i tilfelle mer enn 96 kloner skal plukkes.
    2. Med bruk av mikroskop, markere posisjonen til hver klone synlig i 10 cm retten ved å lage en prikk på bunnen av parabolen med en markør. Hvert punkt vil tilsvare en koloni skal plukkes.
    3. Erstatte culturing mediet med akkurat nok fosfat bufret saltvann (PBS) å danne en tynn film av væske på kloner og ikke la cellene tørr under klone plukking.
    4. Velg enkelt kolonier bruker en 10 µL pipette. Koble spissen som inneholder 5 µL av trypsin til kolonien og langsomt slipper trypsin som vil være lokalisert på kolonien. Tillate trypsin koble celler for 1 min, så skrape kolonien spissen og suge den opp i spissen.
      Merk: Under denne prosedyren bla parabolen litt på den ene siden så for å redusere volumet på PBS rundt kolonien blir plukket vil hjelpe prosessen ved å unngå fortynne trypsin rundt kolonien. Bruke en klone ring kan også plukke opp enkelt kloner.
    5. Plassere cellene fra kolonien i en brønn av 96 godt plate som inneholder 10 µL av 0,25% trypsin.
    6. Inkuber 5 min ved romtemperatur, og deretter fylle brønnen med 150 µL av selektiv medium (Ham F - 12K (Kaighn's) medium supplert med 10% FBS, 2 mM L-glutamin, penicillin (0,5 enheter per mL av medium), streptomycin (0,2 µg per mL av medium) og inneholder neomycin på en konsentrasjon av 0,7 µg/mL.
      Merk: Under inkubasjon tid andre kloner kan plukkes. Det anbefales å velge så mange kloner som mulig. Flere kloner plukkes jo høyere sjansene vil være å identifisere positive meldinger.
    7. Når alle de andre Klonene er plukket og overført i 96 godt plate, at cellene å vokse i noen dager i selektiv medium Ham F - 12K (Kaighn's) medium med 10% FBS, 2 mM L-glutamin, penicillin (0,5 enheter per mL av medium), streptomycin (0,2 µg per mL middels) og inneholder neomycin i en konsentrasjon av 0,7 µg/mL på 37 ° C og 5% CO2, fram 90% samløpet.
  5. Deling av kloner
    1. Forberede tre 96 godt platene belagt med gelatin ved å legge til 100 µL av per brønn, ruge i 30 min ved romtemperatur, og deretter vaske to ganger med PBS. Disse platene brukes for DNA utvinning (DNA plate) og klone frysing (frysing plater).
      Merk: Gelatin vil fremme vedlegget cellene og DNA fordelt. Spesielt tillater gelatin belegget DNA å holde på bunnen av brønnene under DNA utvinning og vaske prosedyrer (omtalt under). Under klone-splitting prosedyren anbefales det å bruke en flerkanals pipette.
    2. Når kloner når 90% samløpet, Sug opp medium fra hver brønn av 96 godt plate, vask med PBS, legge til 30 µL av 0,25% trypsin per brønn og ruge i 5 min på 37 ° C.
      Merk: Kloner vil vokse på forskjellige rater, som vil også avhenge av antall celler plukket per klone. Dermed utføres dette trinnet i flere dager når de ulike Klonene når 90% samløpet.
    3. Legge til 70 µL av selektiv medium per brønn, forstyrre celle klumper av pipettering opp og ned i brønnene, deretter overføre 30 µL av 100 µL av gelatinized DNA platen forhåndsutfylt med 120 µL av selektiv medium per godt og 30 µL til gelatinized frysing plater forhåndsutfylte vett h 50 µL medium (uten merking).
    4. Plasser DNA platen i inkubator, og at cellene å vokse på 37 ° C og 5% CO2 til 90% samløpet.
    5. Tilsett 80 µL av iskalde nystekte 2 x frysing medium (80% FBS og 20% dimethyl sulfoxide (DMSO)) hver brønn av frysing plate, Legg parafilm (sprayet med 70% etanol) på platen for å forsegle hver brønn, sett lokket på toppen og vikle platen med aluminiumsfolie. Plass frysing platene-80 ° C.
    6. Legge til 90 µL av selektiv medium per brønn i den originale 96 godt platen som inneholder kloner som har blitt delt og holde den i kultur til PCR screening resultater. Denne platen brukes som backup plate.

2. screening av Neomycin motstandsdyktig kloner

  1. DNA utvinning fra 96 godt DNA plate.
    1. Når kloner kultivert i DNA platen når 90% samløpet, vask 2 ganger med PBS, så lyse med 50 µL lyseringsbuffer (10 mM Tris pH 7.5 10 mM EDTA, 10 mM NaCl 0,5% SDS og 1 mg/mL proteinasen K). Dekk platen med parafilm, forsegling hver Vel, sette lokket på, dekket med saran brytes, og plassere på 37 ° C over natten.
    2. Legge til 100 µL av kaldt etanol (Et-OH) / NaCl løsning (0,75 M NaCl i 100% etanol) til hver godt og utløse 6 h eller over natten i romtemperatur.
      Merk: Protokollen kan pauses her.
    3. Fjerne Et-OH/NaCl løsningen ved å snu platen og vask 3 ganger med 200 µL av 70% etanol per brønn.
    4. Legg til 25 µL RNAse A løsning i destillert vann og ruge ved 37 ° C i 1 time.
  2. Bruk 3 µL av genomisk DNA for PCR forsterkning. Utføre PCR screening valgte kloner med primere annealing neomycin motstand genet og subtelomere 15q. PCR forsterkning utføres med standard polymerase enzymer og PCR protokoller21.
    Merk: PCR forhold for MS2 primer (MS2-subtel15q-primer-S og MS2 primer som) og CTR primere (CTR prime S og CTR primer som) er følgende: 98 ° C for 20 s rødsprit trinn og deretter 34 sykluser på 98 ° C 10 s, 58° C 20 s, 72 ° C 15 s , bruker polymerase enzym i en 25 µL reaksjon blande (se Tabell for materiale). Primer sekvenser angis i tabell 1.
  3. Kjøre PCR reaksjoner på agarose gel og ekstra PCR band fra positiv kloner bruker standard gel utvinning prosedyrer (se Tabell for materiale for gel utvinning reagenser).
  4. Utføre DNA sekvensering analyser av gel-utpakkede PCR produktet for bekreftelse av tilstedeværelsen av MS2 sekvenser21.
    Merk: Sekvensering analyser utføres med primere brukt for PCR screening.
  5. Sørlige blot screening av PCR positiv kloner
    1. Vokse kloner positiv PCR og sekvensering screening fra den originale 96 godt platen (backup plate) til 6 bra plater i Ham F - 12K (Kaighn's) medium med 10% FBS, 2 mM L-glutamin, penicillin (0,5 enheter per mL av medium), streptomycin (0,2 µg per mL av medium) og inneholder neomycin i en konsentrasjon av 0,7 µg/mL på 37 ° C 5% CO2.
      Merk: Alternativt, hvis noen av disse Klonene har gått tapt, tine dem fra en av frysing plater (se protokollen 2.6).
    2. Når kloner er på 90% samløpet i 6 godt platen, vask cellene med PBS og legge til 250 µL av lyseringsbuffer inneholder 0,5 µg proteinasen K per brønn.
    3. Skrape celler ved hjelp av en celle skraper og overføre den lysate i en 1,5 mL tube.
    4. Ruge på 37 ° C for 16 h.
    5. Legge 1 mL av 100% etanol, rist kraftig, og tillater DNA å fremskynde minst 2 timer eller over natten på 20 ° C.
      Merk: Protokollen kan pauses her.
    6. Spinn 13,400 x g ved 4 ° C i 10 min, forkaste nedbryting og vaske pellets med 70% etanol. La pellets luften tørr ved romtemperatur. Alternativt bruke en vakuum konsentrator.
    7. Resuspend DNA pellets i 50 µL destillert vann som inneholder RNAse A og Inkuber 1t på 37 ° C.
    8. Fordøye 5-10 µg genomisk DNA ved hjelp av NcoI og BamHI begrensning enzymer (to uavhengige digestions) i 100 µL reaksjon volum ved rugende fordøyelsen reaksjonene på 37 ° C over natten.
    9. Kjøre 4 µL av fordøyelsen på agarose gel (0,8% agarose) komplett fordøyelsen bekreftelse.
    10. Legg til 1/10 volum natrium acetate 3 M løsningen pH 5.2 og 2 volumer av 100% etanol til begrensning fordøyelsen reaksjoner og ruge minst 2 h eller overnatting på 20 ° C til å fremkalle DNA.
      Merk: Protokollen kan pauses her.
    11. Sentrifuge 13,400 x g på 4 ° C for 20 min, forkaste supernatants, og vask pellets med 70% etanol. Tillate pellets til luft tørr ved romtemperatur. Alternativt bruke en vakuum konsentrator.
    12. Resuspend pellets i 20 µL av destillert vann og laste fordøyd DNA på en 0,8% agarose gel.
      Merk: En bedre løsning av fordøyd DNA, forberede en gel minst 15 cm lang og kjøre over natten med lav spenning (̴30 volt). Geleelektroforese definerer skal optimaliseres.
    13. Dagen flekken gel med en DNA merking agent, for eksempel ethidium bromide på 1 µL/10 mL siste konsentrasjon, i 30 min ved romtemperatur og ta et bilde med en linjal nær gel på en gel imaging instrument.
    14. Angi overføring av DNA til en nylon membran og utføre membran hybridisering med en MS2 sekvens-spesifikke sonde med standard prosedyrer21.
    15. Tine kloner som er positive på PCR, DNA sekvensering og sørlige blot fra en av de to frysing platene (se neste trinn).
  6. Tiner kloner
    1. Forberede en 15 mL tube som inneholder 5 mL av forvarmes Ham F - 12 K (Kaighn's) medium med 10% FBS, 2 mM L-glutamin, penicillin (0,5 enheter per mL av medium) og streptomycin (0,2 µg per mL av medium) for hver klone til tines.
    2. Fjerne en av frysing platene fra-80 ° og legge 100 µL av forvarmes F12K komplett medium til den også inneholder positivt klone til tines.
      Merk: Denne prosedyren skal utføres raskt og 96 godt platen bør plasseres på tørris etter hver klone er tint opp, slik at andre kloner forblir frosset. Dette er spesielt viktig hvis flere kloner må tines fra samme 96 godt plate.
    3. Overføre cellene til 15 mL røret som inneholder 5 mL av medium og sentrifuge 800 x g for 5 min ved romtemperatur.
    4. Sug opp mediet resuspend cellene i 500 µL av forvarmes komplett F12K medium og overføre hver klone til et enkelt godt av en 12 godt plate.
  7. Eliminering av neomycin motstand genet fra MS2 kassetten integrert på subtelomere 15q.
    1. Tillate kloner skal vokse fra en 12 godt plate til en 10 cm rett i fullstendig F12K medium.
      Merk: Neomycin bør ikke inkluderes i medium med mindre annet er angitt.
    2. Legge grobunn-uttrykke adenovirus til cellene kulturperler i en 10 cm rett på 70% samløpet i 10 mL av komplett F12K medium.
      Merk: Bruk en grobunn-GFP uttrykke adenovirus vil tillate evaluering av effektiviteten av infeksjon, som 100%. Replikering-defekt adenovirus tapt etter noen passasjer i kultur.
    3. 48 timer etter infeksjon, dele cellene i tre 10 cm retter. To retter vil bli brukt for bekreftelse av neomycin genet fjerning av negative utvalg, voksende cellene i neomycin inneholder middels (første rett), og av sørlige blot (andre dish).
    4. Kultur tredje parabolen som inneholder klone for cellen frysing og RNA utvinning.

3. verifisering av TERRA-MS2 transkripsjon uttrykk av RT-qPCR

  1. Ved bekreftelse av neomycin genet fjerning, utføre totale RNA utvinning fra TERRA-MS2 kloner med organiske løsemidler (fenol og guanidine isothiocynate løsning)21.
    1. Resuspend RNA Hentet fra en 10 cm rett på 100 µL diethyl pyrocarbonate (DEPC) vann.
    2. Kjøre 3 µL av på en denaturating (1% formaldehyd-inneholder) 1 x 3-(N-Morpholino) propanesulfonic acid (MOPPER) gel for å verifisere konsentrasjon og integritet av den. Også analysere RNA konsentrasjon bruker et spektrofotometer.
    3. Behandle 3 µg av med DNAse jeg bruker 1 enhet av DNAse jeg enzym i 60 µL siste reaksjon volum.
    4. Inkuber reaksjonen 1t på 37 ° C.
  2. Omvendt transkripsjon reaksjon og qPCR analyser
    1. Legge til følgende komponenter slik nuclease uten microcentrifuge: 2 µL av en 1 µM TERRA bestemt primer, 1 µL dNTPs mix (10 mM hver), 6 µL av DNAse jeg behandlet RNA (tilsvarende ̴300ng RNA). Juster volumet til 13 µL med 4 µL DEPC vann.
      Merk: Hver RNA å bli analysert, en andre rør som inneholder samme reagensene men referanse bestemt primer, i stedet for TERRA bestemt primer, bør være forberedt.
    2. Varm blandingen til 65 ° C i 5 min og ruge i is minst 1 min.
    3. Samle innholdet i rørene ved kort sentrifugering og legge 4 µL av 5 X RT enzym Buffer, 1 µL 0.1 M dithiothreitol (DTT), 1 µL (4 enheter) av RNAse hemmer og 1 µL av revers transkriptase (se Tabell for materiale).
    4. Inkuber eksemplene ved 42 ° C i 60 minutter, deretter bruke 2 µL av RT reaksjonen for qPCR analyser.
  3. Forberede qPCR reaksjonen blanding i et siste volum på 20 µL består av 10 µL av 2 x qPCR master mix, 2 µL av cDNA, 1 µL av fremover primer (10 µM), 1 µL av omvendt primer (10 µM) og 6 µL av vann.
  4. Utføre qPCR reaksjon i en thermocycler ved hjelp av standardprotokoller21.

4. produksjon av en MS2-GFP uttrykke Retrovirus

  1. Vil generere MS2-GFP uttrykke retrovirus, transfect 80% confluent phoenix emballasje celler med en MS2-GFP fusion protein uttrykke retrovirus vektor (pBabe-MS2-GFP PURO) og en env genet uttrykke vektor (for eksempel pCMV-VSVG) med molar forholdet 4:1 to vektorer.
  2. Dagen, erstatte culturing mediet (DMEM supplert med 10% FBS, 2 mM L-glutamin og penn/Strep) med fersk middels inneholder 10mM natrium butyrate.
  3. Ruge 8 h ved 37 ° C, 5% CO2, og deretter erstatter mediet med fersk dyrking medium som viruset blir krevet.
  4. Etter 48 timer, kan du fjerne retrovirus som inneholder mediet fra phoenix celler. Dette mediet kan brukes for infeksjon av TERRA-MS2 kloner, da filtrere mediet gjennom et 0,45 µm filter, legge polybrene (30 µg/mL siste konsentrasjon) og legge den til cellene (i dette tilfellet protokollen fortsetter i trinn 5). Alternativt kan retrovirus være forårsaket i et 50 mL falcon rør ved å legge 1/5th volumet av 50% PEG-8000/900 mM NaCl løsning og rugende natten på 4 ° C på rotator hjul.
  5. På dagen pellet retrovirus partikler av sentrifugering 2000 x g i 30 min, fjerne nedbryting og resuspend pellet i F12K medium uten serum.
    Merk: Viruspartikler kan være resuspended i 1/100th av opprinnelige supernatant. En infeksjon test skal utføres for å verifisere minste mengde retrovirus som kreves for å effektivt infisere cellene.

5. visualisering av TERRA-MS2 utskrifter i levende celler

  1. Plate TERRA-MS2 kloner og WT AGS celler i glassbunn retter. På dagen for infeksjon, legge polybrene til mediet (30 µg/mL siste konsentrasjon) og MS2-GFP uttrykke retrovirus.
  2. Etter 24 timer, forkaste virus som inneholder mediet og legge frisk medium uten fenol-rød.
  3. Analysere cellene på en invertert mikroskop bruke innstillingen riktig mikroskop. Bilde cellene med 100 X eller 60 X målet med stor numeriske blenderåpning (1.4 X) og bruke en følsom kamera (EMCCD). Bruk en miljømessig system for å opprettholde prøvene på 37 ° C og 5% CO2 under bildebehandling.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figur 1 representerer en oversikt over den eksperimentelle strategien. De viktigste trinnene av protokollen og en indikativ tidslinje for generering av TERRA-MS2 kloner i AGS celler vises (figur 1A). På dag 1, flere brønner i en 6 godt plate er transfekterte med MS2 kassett og sgRNA/Cas9 uttrykke vektorer (vist i figur 1B). To forskjellige subtelomere 15q-spesifikke guide RNA sekvenser er klonet i Cas9 nickase-uttrykke pX335 vektor, genererer to sgRNA-pX335-vektorer som co transfekterte med MS2 kassetten. En brønn av platen kan være transfected med en GFP uttrykke vektor å bekrefte hva effektiviteten. På dag 2, er cellene trypsinized og overført fra en enkelt brønn til en 10 cm tallerken med selektiv medium. På dag 3 bør middels endres som mest untransfected celler vil være død. Celler er dyrket i valg til kloner er synlig og klar til å bli plukket. På denne tiden, bør du ikke trypsinized celler og dyrking medium bør endres hver 1-2 dager for den første uken og deretter hver 2-3 dager etterpå. Når enkelt kloner er synlig, er de plukket og overført i en 96 godt plate hvor de kan vokse fram 80-90% av samløpet. På dette punktet, deles kloner i 4 forskjellige 96 bra plater, som er merket i figur 1 med en fargekode. Når kloner kultivert i DNA platen (green) når 80% der, de er lysed og genomisk DNA utdraget for PCR screening; kloner i sikkerhetskopien plate (blå) vil bli holdt i kultur før resultatene av PCR screening, mens røde frysing platene fryses-80 ° C. Figur 2 B viser representant resultatene av en PCR screening av neomycin-resistente kloner. Dette screening, to sett med primere brukes: en primer par (MS2 primere) annealing innen neomycin gene og subtelomere 15q sekvensen brukes til å bekrefte tilstedeværelse av MS2 kassetten (et representativt bilde av primere lokalisering er vist i Finne 2A). En andre primer par (CTR primere) annealing på en intern chromosomal region brukes til å bekrefte tilstedeværelse av falske negative kloner (primer sekvenser er angitt i tabell 1). Negativ kloner for integrering av kassetten bør være negative til MS2 primerne forsterkning og positivt til CTR primerne forsterkning. Tekniske problemer i genomisk DNA utvinning resulterer i fravær av genomisk DNA eller forurensing ville utelukke PCR forsterkning fra MS2 og CTR primer reaksjoner. I disse tilfellene kan kloner involvert bli nytt vist av PCR på utvinning av genomisk DNA fra sikkerhetskopien platen. Band fra MS2 primere forsterkning av positiv kloner kan gel-utdraget og sekvensert med MS2 primer, for å bekrefte tilstedeværelse av ti MS2 sekvenser.

Kloner som er positive på PCR screening er kultivert fra 96 godt backup plate (blå plate i figur 1) en 6 godt platen, så lysed for genomisk DNA utvinning og sørlige blot analyser. Figur 2 D viser representant bilder av en gel (venstre) og membran hybridiserte med en radioactively merket MS2 sekvens bestemt sonde (til høyre) av en Southern blot screening av PCR positiv kloner. For bekreftelse av MS2 sekvenser integrering på subtelomere 15q, bør genomisk DNA utvunnet fra hver klone bli fordøyd med to forskjellige begrensning enzymer (NcoI og BamHI) i to separate fordøyelsen reaksjoner. NcoI og BamHI begrensning enzymer er egnet for bekreftelse av MS2 kassett integrering på subtelomere 15q. Andre enzymer kan også brukes. Gel viser en komplett fordøyelsen av genomisk DNA BamHI begrensning enzymet, som indikert av tilstedeværelsen av en smøre. Resultatene fra sørlige blot indikerer at en klone er positivt for integrering av MS2 kassetten på subtelomere 15q mens flere kloner viser flere integrering hendelser av kassetten, som indikert av tilstedeværelsen av flere felt. En positiv klone skal analyseres av en andre sørlige klatt på NcoI fordøyelsen genomisk DNA21. Et representativt bilde av en subtelomere 15q som inneholder MS2 kassett og plasseringen av BamHI og NcoI begrensning enzym nettsteder er vist i figur 2C.

Kloner positive PCR og sørlige blot analyser er infisert med en grobunn-GFP uttrykke adenovirus for å fjerne neomycin genet i MS2 kassetten. Figur 3 A viser en MS2-merket subtelomere 15q før og etter grobunn uttrykk. Et bilde av en klone positivt for MS2 kassett integrering på subtelomere 15q infisert med en grobunn-GFP uttrykke adenovirus er vist i figur 3B. For en fullstendig fjerning av neomycin genet i alle celler, skal infeksjon effektiviteten nå ca 100%. Som vist i figur 3C, for å verifisere eliminering av neomycin genet, er grobunn-GFP infiserte celler fordelt på tre plater etter 48 timer av infeksjon. En plate vil bli kultivert i nærvær av neomycin. Alle celler i denne platen bør dø innen 6-7-dager. I en annen plate tillates celler å vokse i fullstendig medium uten utvalg til 80-90% samløpet. På dette punktet er genomisk DNA trekkes ut og analyseres av sørlige blot. Tredje platen er kultivert i fullstendig mediet til å tillate utarbeidelsen av frosne aksjer klone og RNA utvinning og RT-qPCR analyser av TERRA-MS2 transkripsjon uttrykk. Figur 3 D viser representant bilder av sørlige blot analyser av en positiv klone før og etter grobunn-GFP infeksjon. DNA agarose gel (bildet til venstre) bekrefter komplett fordøyelsen av genomisk DNA ved hjelp av NcoI begrensning enzymet. Sørlige blot analyse var utført ved hjelp av en radioactively merket MS2-sekvens bestemt sonde (bildet til høyre). Denne analysen bekrefter fjerning av neomycin genet. Tilstedeværelsen av en smear i grobunn-GFP infisert utvalget bekrefter telomeric integrering av MS2 sekvenser. Plasseringen av NcoI begrensning områder innenfor subtelomere 15q er vist i figur 3A.

Når elimineringen av neomycin motstand genet er bekreftet, kan Klonene testes for uttrykket av TERRA-MS2 utskrifter. Til dette målet, er totalt RNA utdraget fra hver klone og kjører på en denaturating MOPPER gel å bekrefte integriteten (figur 4A). Ribosomal RNA band skal være synlig på 4700 baser (rRNA 28S) og 1900 baser (rRNA 18S). Retrotranscription reaksjon utføres ved hjelp av en telomeric gjenta-spesifikke primer og referanse gen-spesifikke primer (figur 4B, øverst) mens qPCR analyser av TERRA uttrykket utføres ved hjelp av to sett med primere: en primer par annealing MS2 sekvensen og subtelomere 15q sekvensen; et par primere annealing innen subtelomere 15q. Primer sekvenser angis i tabell 1. Grafen i figur 4B viser RT-qPCR analyser av TERRA uttrykk fra AGS WT celler og to forskjellige TERRA-MS2 kloner. Disse analysene bekrefte uttrykk for TERRA-MS2 utskrifter i to kloner på nivåer som er sammenlignbare med TERRA transkripsjoner uttrykt fra subtelomere 15q i WT celler. Disse dataene viser at to TERRA-MS2 kloner valgt er egnet for analyser av TERRA-MS2 utskrifter av levende celle tenkelig.

For å visualisere TERRA-MS2 utskrifter i levende celler, er valgte kloner infisert med et retrovirus uttrykke MS2-GFP fusion protein. Figur 5 En viser fremgangsmåten for å generere MS2-GFP uttrykke retrovirus, som beskrevet i protokollen trinn 4. AGS WT celler og TERRA-MS2 kloner er infisert glassbunn retter. Etter 24 timer fra infeksjon analyseres celler av fluorescens mikroskopi. Spesifisiteten av signalet er bekreftet av tilstedeværelsen av TERRA-MS2-GFP foci oppdaget i kjernen av TERRA-MS2 kloner og ikke i AGS WT celler (figur 5B). I en befolkning på MS2-GFP uttrykke celler, heterogenitet i MS2-GFP nivåer blant celler er forventet og celler uttrykke lave nivåer bør være valgt for bildebehandling analysene. MS2-GFP uttrykke cellene kan eventuelt sorteres etter FACS tidligere mikroskopi analyser for å samle subpopulasjon av celler uttrykke lave nivåer av GFP. Vi har tidligere oppdaget TERRA-MS2-GFP foci i 40% til 60% av celler av AGS TERRA-MS2 kloner21. I disse cellene, ble én til fire TERRA-MS2-GFP foci fotografert per celle. TERRA-MS2-GFP foci viser forskjellige størrelser og dynamikk kan være oppdaget21. TERRA-MS2 kloner kan brukes til å studere dynamikken i enkelt-telomere TERRA utskrifter i levende celler. Som et eksempel på dette programmet viser figur 5C representant bilder fra mikroskopi analyser av en TERRA-MS2 klone uttrykke MS2-GFP fusion protein og telomere bindende protein TRF2 del mCherry for å visualisere MS2-merket TERRA utskrifter og telomerer i levende celler. Bruker denne tilnærmingen, har vi tidligere observert at TERRA-MS2-GFP foci co lokalisere med telomerer i 44% av cellene, som indikerer at TERRA transkripsjoner bare transiently co lokalisere kromosom ender i AGS celler21.

Figure 1
Figur 1 . Oversikt over eksperimentell strategi og indikativ tidslinje for generering av TERRA-MS2 kloner i AGS celler. A) trinnene beskrevet i protokollen og en indikativ tidslinje for valg av TERRA-MS2 kloner vises. Cellene er transfekterte i en 6 godt plate med lineær MS2 kassett og sgRNA/Cas9 uttrykke vektorer. En fargekode brukes til å skille DNA platen, backup platen og frysing platene som er angitt i delen protokollen. B) The MS2 kassett består av en 800 nt lang subtelomere 15q sekvens etterfulgt av 10 repetisjoner av MS2 sekvenser og et neomycin motstand gen flankert av lox-p nettsteder og avslutter med en 300 nt lenge telomeric gjenta traktat affæren 3. sgRNA/Cas9 uttrykke vektorer ble generert av kloning subtelomere 15q-spesifikke guide RNA sekvenser i pX335 vektor bruker BbsI begrensning området21,22. To forskjellige sgRNA-pX335 vektorer ble generert og en 1:1 blanding av to vektorer ble brukt for transfection. Sekvenser av sgRNAs angis i tabell 1. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 . Representant bilder av PCR og sørlige blot screening av neomycin motstandsdyktig kloner. A) representativt bilde av subtelomere 15q som inneholder MS2 kassetten. Plasseringen av MS2 primerne (MS2-subtel15q-primer-S og MS2 primer som) brukes for PCR screening er angitt. Webområdene loxP stede i kassetten vises i rødt. B) representativt bilde av PCR screening av neomycin motstandsdyktig kloner med to sett med primere og MS2 primere CTREN primere (CTR prime S og CTR primer som). C) representativt bilde av subtelomere 15q som inneholder MS2 kassetten. BamHI og NcoI begrensning nettsteder og MS2 sonden brukes for sørlige blot screening vises. D) venstre: 10 µg genomisk DNA per klone ble fordøyd med BamHI og kjører på en agarose gel. Bildet ble kjøpt etter en overnight kjøre på 30 volt. Høyre: genomisk DNA fordøyd med BamHI begrensning enzym ble overført til en positivt ladet nylon membran og hybridiserte med en radioactively merket MS2 sekvens-spesifikke sonde. Den røde boksen angir den forventede størrelsen av positiv bandet. Den røde pilen indikerer en positiv klone. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 . Eliminering av neomycin motstand gene og validering eksperimenter. A) representativt bilde av subtelomere 15q som inneholder MS2 kassetten før og etter grobunn uttrykk. MS2 bestemte sonden sørlige blot analyser og NcoI begrensning enzym nettsteder vises. Webområdene loxP stede i kassetten vises i rødt. B) fluorescens mikroskopi analyse av en TERRA-MS2 klone infisert med grobunn-GFP uttrykke adenovirus. Representativt bilde kjøpt på en enkelt fokalplanet vises. MOI, mangfold av infeksjon, er forholdet mellom antall virus som brukes for infeksjon og antall vertsceller. Skala bar: 30 µm C) oversikt over eksperimentell strategien å verifisere eliminering av neomycin genet. Cre-GFP infisert celler er fordelt på tre plater etter 48 timer av infeksjon i) negative utvalg, ii) sør blot analyser og iii) utarbeidelse av frosne celle aksjer og RNA utvinning. D) sør blot analyser av et TERRA-MS2 klone før og etter grobunn-GFP adenovirus infeksjon. 10 µg genomisk DNA ble fordøyd med begrensning enzymet NcoI. Agarose gel bekrefter at fullstendig fordøyelsen er oppnådd i begge kloner (til venstre). Fordøyd genomisk DNA ble overført til en positivt ladet nylon membran og hybridiserte bruker en MS2 sekvens-spesifikke sonde. Fullstendig eliminering av neomycin genet er bekreftet av fravær av bestemte bandet. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4 . RT-qPCR analyser av Tel15q-TERRA og Tel15Q-TERRA-MULTIPLE Sclerosis2 utskrifter uttrykk. A) representativt bilde av en MOPPER gel viser totalt RNA Hentet fra AGS WT celler og TERRA-MS2 kloner. Band svarer til ribosomal RNAs 28S og 18S angis. B) toppen: en skjematisk av den MS2-merket subtelomere 15q uttrykke TERRA transkripsjoner. Primere brukt for TERRA retrotranscription (gul) og qPCR analyser av Tel15q-TERRA (blå) og Tel15q-MS2 TERRA (rød) vises. LoxP området vises i rødt. Bunnen: RT-qPCR analyser av Tel15q-TERRA og Tel15q-MS2 TERRA transkripsjoner uttrykk i AGS WT celler og TERRA-MS2 kloner. p < 0,05, hender t-test. Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5 . Levende celle imaging analyser av TERRA-MS2 kloner. A) en oversikt over fremgangsmåten for å produsere et MS2-GFP uttrykke retrovirus, som beskrevet i protokollen trinn 4. En skjematisk av MS2-merket subtelomere 15q og TERRA transkripsjoner anerkjent av MS2-GFP fusion protein vises til høyre. B) representant fluorescens mikroskopi bilde av AGS WT og to TERRA-MS2 kloner uttrykke MS2-GFP. TERRA-MS2-GFP foci angis med piler. Bildene ble anskaffet med spinning plate AC confocal mikroskop utstyrt med en EMCCD kameraet. Bildene ble tatt ved hjelp av en 100 X / 1.46 apochromat mål i en tenkelig kammer opprettholdt på 37 ° C med 5% CO2. En 488 laser ble brukt som lyskilde. Skala bar: 5 µm. C) levende celle imaging analyser av TERRA-MS2-GFP bildet og TRF2-mCherry kalt telomeres. En co lokalisering hendelse mellom TERRA-MS2-GFP fokus og en enkelt telomere vises. Bildene ble anskaffet i Bbruke 488 og 520 lasere som lyskilde. En maksimal projeksjon av en z stable eksperimentet utføres på en eneste gang punkt av time-lapse tenkelig eksperimentet vises. Skala bar: 5 µm. Klikk her for å se en større versjon av dette tallet.

Primer navn Primer sekvens Programmet
MS2-subtel15q-primer-S TGCATTAAAGGGTCCAGTTG MS2 primer frem brukes for PCR screening av neomycin motstandsdyktig kloner
MS2 primer som CCTAACTGACACACATTCCACAGA MS2 primer omvendt brukes for PCR screening av neomycin motstandsdyktig kloner
CTR primer S TGT ACG CCA ACA CAG TGC VS CTR primer frem brukes i PCR screening av neomycin motstandsdyktig kloner
CTR primer som GCT GGA AGG TGG ACA GCG A CTR primer omvendt brukes i PCR screening av neomycin motstandsdyktig kloner
Tel15q-S1 GCAGCGAGATTCTCCCAAGC Følelse primer brukes til å oppdage Tel15q og Tel15q-MS2 TERRA uttrykk av qPCR
hTel15q-AS TAACCACATGAGCAATGTGGGTG Antisense primer brukes til å oppdage Tel15q og Tel15q-MS2 TERRA uttrykk av qPCR
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG Antisense primer brukes til å oppdage Tel15q-MS2 TERRA uttrykk av qPCR
TERRA-RT-primer CCCTAACCCTAACCCTAACCCTAACCCTAA Primer brukes for retrotranscription av TERRA transkripsjoner
sgRNA1 TTGGGAGAATCTCGCTGGCC Sekvensen av kort guide RNA 1 klonet i pX335 vektor og brukes til direkte Cas9 nickase enzymatisk aktivitet til subtelomere 15q
sgRNA2 TGCATTAAAGGGTCCAGTTG Sekvensen av kort guide RNA 2 klonet i pX335 vektor og brukes til direkte Cas9 nickase enzymatisk aktivitet til subtelomere 15q

Tabell 1 : Liste over primere brukt i denne studien. En liste over primerne og sekvenser av sgRNAs brukes i denne protokollen tilbys. Sekvensene er 5' til 3.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I denne artikkelen presenterer vi en metode for å generere menneskelige kreft cellen kloner som inneholder MS2 sekvenser integrert i subtelomere 15q. Bruker disse kloner, er MS2-merket TERRA molekylene transkribert fra subtelomere 15q oppdaget av fluorescens mikroskopi av co uttrykk for en MS2-GFP fusion protein. Dette gir forskere til å studere dynamikken i TERRA uttrykt fra en enkelt telomere i levende celler21. I denne protokollen velges TERRA-MS2 kloner i AGS celle linjen som representerer en interessant modellsystem å studere TERRA, siden TERRA uttrykk er upregulated i menneskelige mage kreft prøver24. Imidlertid kan protokollen beskrevet her tilpasses for valg av TERRA-MS2 kloner i andre linjer. Integrering av MS2 sekvenser kan i prinsippet forfremmet for en subtelomere forskjellig fra telomere 15q ved hjelp av en bestemt MS2 kassett og CRISPR strategi. I metoden som presenteres her, er en Cas9 nickase enzym og dobbelt RNAs ansatt for å øke spesifisiteten av integrasjon22. Bruker denne strategien, forventes en total 2% av positiv kloner å bli identifisert i AGS celler. Andre versjoner av Cas9 enzym kan testes i forsøket på å øke suksessraten av kloner utvalg25. I tillegg er følgende protokollen kritisk de ta hensyn å maksimere effektiviteten av klone valget:

Jeg) for å øke sjansene for å velge TERRA-MS2 kloner, er det viktig å oppnå en høy transfection effektivitet MS2 kassetten og CRISPR vektorer. Dårlig transfekterte linjer vil mest sannsynlig kreve flere runder med transfection, klone utvalg og screening for å velge positiv kloner.

II) det er viktig å bestemme nøyaktig konsentrasjonen av neomycin bruke for valg av kloner. Faktisk vil bruker en lav konsentrasjon av stoffet resultere i falske positive kloner mens høy konsentrasjon kan utelukke identifikasjon av positiv kloner. Neomycin konsentrasjonen i denne protokollen er dødelige til AGS cellene innen 6-7 dager fra tillegg til culturing medium.

III) klone plukking er kritiske. Faktisk under denne prosedyren er det nødvendig at bare én kloner er plukket. For derfor koloniene som er for nær hverandre bør unngås for å hindre blanding celler fra ulike kloner, integrert resulterer i valg av en blandet befolkning av kloner som kan inneholde MS2 sekvenser på flere genomisk nettsteder. Disse hendelsene skal identifiseres i sørlige blot screening.

IV) mengden genomisk DNA trukket ut fra en confluent 96 godt DNA plate (protocol 2) er anslått til rundt 5 µg og bør nok for å skjermen hver klone av PCR og Southern blotting en enkelt begrensning enzym fordøyelsen. Men for å bekrefte integrering av kassetten på forventet telomere, vil det være viktig å skjermen hver klone av sørlige klatt av fordøye genomisk DNA med to forskjellige begrensning enzymer. Til dette målet, som angitt i protokollen, bør kloner positivt på PCR screening være dyrket i 6 bra plater. Mengden av genomisk DNA Hentet fra en godt av en 6 godt plate vil være tilstrekkelig for minst to begrensning digestions kreves for sørlige blot analysene.

I protokollen beskrevet her, MS2 sekvensene er integrert i subtelomere 15q for en rekke årsaker: jeg) TERRA promoter regionen og TERRA transkripsjon start nettsteder er identifisert på denne subtelomere26,27; II) TERRA uttrykk fra subtelomere 15q er validert ved hjelp av vitro teknikker4,27,28,29,30; III) subtelomeric regionen av kromosom 15q har blitt sekvensert, og den inneholder et unikt område ved siden av det telomeric gjentatte spor som kan målrettes for integrering av MS2-kassett21. PCR og sørlige blot tilnærminger ble utviklet for å bekrefte enkel integrering av MS2 sekvenser i subtelomere 15q i TERRA-MS2 kloner. Det ville være interessant også foreta DNA-fisk eksperimenter på kromosom oppslag for å visualisere den chromosomal lokaliseringen av MS2 sekvenser i fast metaphase kromosomer. Men lengden på 10xMS2 sekvenser (450 bp) medfører bruk av kort sonder i forhold til sonder vanligvis brukes i DNA-fisk eksperimenter på kromosom oppslag (bakteriell kunstig kromosomene (Bac), cosmids eller plasmider)31. Denne tekniske utfordringen har forhindret oss fra visualisere MS2 sekvenser på kromosom oppslag som representerer en begrensning av protokollen. En ytterligere begrensning av metoden er tiden og innsatsen som kreves for å velge TERRA-MS2 kloner. I tillegg er bestemt laboratorium satt opp og utstyr for bruk av virus, radioaktivt materiale og mikroskopi analyser nødvendig.

Metoden beskrevet her kan implementeres for generering av TERRA-MS2 kloner i ulike linjer for å definere dynamikken i TERRA i ulike biologiske sammenhenger, som under telomere dysfunction eller cellular senescence, hjelper oss å forstå funksjonen til TERRA prosesser. En interessant utvikling av denne tilnærmingen blir generering av TERRA-MS2 kloner som inneholder Tejo gjentar integrert på en bestemt subtelomere, inkludert MS2-merket telomere. Uttrykk for et TetR protein smeltet til et fluorescerende protein (dvs. mCherry) vil tillate visualisering av dette bestemt telomere i levende celler32. Denne tilnærmingen gjør om menneskelig TERRA transkripsjoner lokalisere og handle i cis på TERRA transkribere telomere og kromosom, eller i trans ved å flytte til andre kromosomer. Dette spørsmålet i biologi av TERRA gjenstår å bli avklart.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklære noen konkurrerende økonomiske interesser

Acknowledgments

Vi er takknemlige til ansatte i avansert tenkelig anlegget i CIBIO ved Universitetet i Trento og BioOptics lys mikroskopi anlegget på Max F. Perutz Laboratories (MFPL) i Wien. Forskningen førte til disse resultatene har fått støtte fra Mahlke-SS-Obermann-Stiftung og EUs syvende rammeprogram for forskning og teknologiutvikling demonstrasjon grant avtalen ingen 609431 til EC. EC støttes av en Rita Levi Montalcini fellowship fra det italienske Forsvarsdepartementet utdanning universitet og forskning (MIUR).

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
Generering av kreft cellen kloner å visualisere Telomeric gjenta inneholder RNA TERRA uttrykt fra en enkelt Telomere i levende celler
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter