Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Generación de Clones de células de cáncer para visualizar que contiene la repetición telomérica ARN TERRA de un telómero solo en las células vivas

doi: 10.3791/58790 Published: January 17, 2019

Summary

Aquí, presentamos un protocolo para generar clones de células de cáncer que contiene una etiqueta de secuencia de MS2 en un sola subteloméricas. Este enfoque, basándose en el sistema MS2-GFP, permite la visualización de los transcritos endógenos de telomeric repetición que contiene ARN (TERRA) de un telómero solo en las células vivas.

Abstract

Los telómeros se transcriben, dando lugar a telomeric repeat-con larga noncoding RNAs (TERRA), que se han propuesto para desempeñar un papel importante en la biología telomérica, incluyendo formación de heterocromatina y homeostasis de longitud telomérica. Recientes descubrimientos revelaron que las moléculas TERRA también interactúan con regiones cromosómicas internas para regular la expresión génica en las células madre embrionarias (ES) de ratón. En consonancia con esta evidencia, RNA fluorescencia en situ del hibridación (pescado de RNA) análisis han demostrado que sólo un subconjunto de TERRA transcripciones localización en los extremos del cromosoma. Una mejor comprensión de la dinámica de las moléculas TERRA le ayudará a definir su función y mecanismos de acción. Aquí, describimos un método para marcar y visualizar las transcripciones TERRA solo telómeros en las células cancerosas mediante el sistema MS2-GFP. Para ello, presentamos un protocolo para generar clones estables, utilizando la línea celular del cáncer de estómago humano AGS, con secuencias de MS2 integradas en una sola subteloméricas. Transcripción de TERRA de telomere tagged MS2 se traduce en la expresión de moléculas etiquetadas MS2 TERRA que se visualizan por microscopia de fluorescencia de células vivas sobre la expresión de una proteína de unión a RNA de MS2 fusionada a GFP (GFP-MS2). Este enfoque permite a los investigadores a estudiar la dinámica de las moléculas TERRA solo telómeros en células cancerosas, y puede ser aplicado a otras líneas celulares.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La larga noncoding TERRA de ARN es transcrito desde la región subteloméricas de los cromosomas y su transcripción procede hacia los extremos del cromosoma, que termina dentro de la zona de repetición telomérica1,2. Por esta razón, las transcripciones TERRA consisten en secuencias subtelomeric deriva en su extremo 5' y terminan con repeticiones teloméricas (UUAGGG en vertebrados)3. Importantes roles han sido propuestos para TERRA, incluyendo la formación de la heterocromatina en telómeros4,5, ADN replicación6, promoviendo la recombinación homóloga entre cromosoma termina7,8 , 9, regulación de telomere estructura10y telómeros longitud homeostasis2,11,12,13. Por otra parte, las transcripciones TERRA interactúan con numerosos sitios de extratelomeric para regular la expresión génica generalizada en ratón de células madre embrionarias (ES)14. En consonancia con estas pruebas en situ hibridación de RNA fluorescencia (RNA-pescado) los análisis han demostrado que sólo un subconjunto de las transcripciones TERRA localizar en los telómeros1,2,15. Además, TERRA se ha divulgado para formar agregados nucleares de la localización en los cromosomas X e Y en células de ratón2,16. Estos resultados indican que las transcripciones TERRA experimentan dinámicas complejas dentro del núcleo. Comprender la dinámica de las moléculas TERRA le ayudará a definir su función y mecanismos de acción.

El sistema MS2-GFP ha sido ampliamente utilizado para visualizar las moléculas de ARN en las células vivas de varios organismos17,18. Este sistema se ha utilizado previamente la etiqueta y visualizar moléculas TERRA solo telómeros en S. cerevisiae12,19. Mediante este sistema, fue demostrado recientemente que las transcripciones TERRA de levadura localización dentro del citoplasma durante la fase de post-diauxic cambio, sugiriendo que TERRA puede ejercer funciones extranuclear20. Recientemente hemos utilizado el sistema MS2-GFP para estudiar las transcripciones TERRA solo telómeros en las células de cáncer21. Para ello, se emplea la herramienta de edición de genoma CRISPR/Cas9 para integrar secuencias MS2 en un telómero solo (telomere 15q, de ahora en adelante Tel15q) y se obtuvieron clones expresando tagged MS2 endógeno Tel15q TERRA (TERRA-MS2 clones). La expresión de una proteína de unión a RNA de MS2 fusionada a GFP (MS2-GFP) que reconoce y se une MS2 ARN secuencias permite visualización de transcripciones TERRA telómero solo en la vida de las células de21. El propósito del protocolo ilustrado aquí es describir en detalle los pasos necesarios para la generación de clones de TERRA-MS2.

Para generar clones de TERRA-MS2, un cassette de MS2 se integra dentro de la región subtelomeric del telomere 15q, aguas abajo del TERRA promotor región y transcripción Inicio. El cassette de MS2 contiene un gen de resistencia a neomicina flanqueado por sitios lox-p, y su integración en subteloméricas 15q se realiza utilizando el sistema CRISPR/Cas9 del22. Después de transfección de MS2 cassette, solo los clones seleccionados e integración subtelomeric del cassette es verificado por PCR, ADN secuenciada y Southern blot. Clones positivos se infectan con un adenovirus que expresan Cre para quitar el marcador de selección en el cassette, dejando solamente secuencias de MS2 y un sitio de solo lox-p en subteloméricas 15q. Expresión de las transcripciones de MS2-tagged TERRA de Tel15q se verifica por RT-qPCR. Por último, se expresa la proteína de la fusión de GFP MS2 en TERRA-MS2 clones mediante infección retroviral para poder visualizar las transcripciones MS2-TERRA por microscopía de fluorescencia. Transcripciones TERRA pueden ser fácilmente detectadas por RNA-peces y proyección de imagen de células vivas mediante telomeric repeat-específico sonda1,2,15,23. Estos enfoques proporcionan información importante sobre la localización de la población total de moléculas TERRA en la resolución de la célula. La generación de clones que contienen secuencias de MS2 en un subteloméricas solo permitirá a los investigadores a estudiar la dinámica de las transcripciones TERRA solo telómeros en las células vivas, que ayudarán a definir la función y mecanismos de acción de TERRA.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Selección de Clones resistentes a la neomicina

  1. Cultivar células AGS en medio F-12_K del jamón (Kaighn) suplementado con 10% suero bovino Fetal (FBS), 2 mM L-glutamina, penicilina (0,5 unidades por mL de medio) y estreptomicina (0.2 μg / mL de medio) a 37 ° C y 5% CO2. Transfectar las células en un 50-60% de confluencia con el sgRNA/Cas9 expresando el vector y el cassette de MS2 en un 1:10 cociente molar21.
    Nota: En un experimento paralelo, comprobar eficacia de transfección transferencia un vector de expresión de GFP (es decir, GFP Cas9 vector). Al menos debe alcanzar el 60-70% de eficiencia de transfección.
  2. Al día siguiente, reemplace el medio de cultivo con medio que contiene neomicina en concentración final de 0.7 μg/mL (medio selectivo).
    Nota: División de las células y les siembra en medio selectivo el día después de la transfección acelerará el proceso de selección. Todas las células transfectadas no va a morir inmediatamente. Si realiza la transfección en 6 placas de pozos, en cuyo caso cada bien en un 60% confluencia contendría aproximadamente 0,7 x 106 células, que las células pueden dividirse de un pozo único a un medio selectivo que contiene 10 cm plato al día siguiente.
  3. Mantener las células en medio selectivo para 7-10 días, cambiando el medio cada uno o dos días, hasta que los clones solo son accesibles.
  4. Selección de clones de células
    1. Preparar un plato bien 96 con 10 μl de tripsina 0.25% en cada pozo.
      Nota: Prepare dos 96 placas bien en caso de que se espera que más de 96 clones recogidos.
    2. Con el uso de un microscopio, marque la posición de cada clon visible en el plato 10 cm haciendo un punto en la parte inferior del plato usando un marcador. Cada punto corresponderá a una colonia a ser recogido.
    3. Reemplazar el medio de cultivo con suficiente fosfato tampón salino (PBS) que forman una fina película de líquido sobre los clones y no dejar que las células secas durante la cosecha de clones.
    4. Escoge solo colonias con una pipeta de 10 μl. Fije la punta con 5 μl de tripsina a la Colonia y suelte lentamente la tripsina que permanecerá localizada en la Colonia. Permiten tripsina separar las células durante 1 minuto, luego raspar la Colonia con la punta y aspirar en la punta.
      Nota: Durante este procedimiento, cambiando el plato un poco de un lado así que disminuir el volumen de PBS alrededor de la Colonia burlan ayudará el proceso de selección evitando diluir la tripsina alrededor de la Colonia. Usando un anillo clon también puede ayudar a recoger solo clones.
    5. Coloque las células de la Colonia en un pocillo de la placa bien 96 con 10 μl de tripsina 0.25%.
    6. Incubar 5 min a temperatura ambiente, luego llene el pozo con 150 μL de medio selectivo (medio Ham F - 12K (Kaighn) suplementado con 10% SFB, 2 mM L-glutamina, penicilina (0,5 unidades por mL de medio), estreptomicina (0.2 μg / mL de medio) y que contienen neomicina en una concentración de 0,7 μg/mL.
      Nota: Durante el tiempo de incubación otros clones se pueden seleccionar. Se recomienda escoger tantos clones como sea posible. Se recogen los clones más mayor será las posibilidades de identificación positivas.
    7. Una vez que todos los clones son seleccionados y transferidos en la placa de la pozo 96, permite a las células a crecer durante unos días en medio selectivo F - 12K de Ham (Kaighn) suplementado con 10% SFB, 2 mM L-glutamina, penicilina (0,5 unidades por mL de medio), estreptomicina (0.2 μg / mL del medio) y que contienen neomicina en una concentración de 0,7 μg/mL a 37 ° C y 5% CO2, hasta llegar a 90% de confluencia.
  5. Partir de los clones
    1. Preparar tres 96 placas bien cubiertas con gelatina por agregar 100 μl de gelatina por pozo, incubar durante 30 min a temperatura ambiente, luego lavar dos veces con PBS. Estas placas se utilizará para la extracción de ADN (placa de ADN) y clon congelación (placas de congelación).
      Nota: La gelatina promoverá la fijación de las células y del ADN en los pocillos. En particular, la capa de gelatina permitirá el ADN pegue en el fondo de los pozos durante la extracción de ADN y lavar procedimientos (discutidos abajo). Durante el procedimiento de separación de clon, es recomendable utilizar una pipeta multicanal.
    2. Una vez que clones alcanzan el 90% de confluencia, aspirar el medio de cada pocillo de la placa de la pozo 96, lavar con PBS, Añadir 30 μl de tripsina 0.25% por pozo e incubar 5 min a 37 ° C.
      Nota: Clones crecerá a tasas diferentes, que también dependerá del número de células recogidas por clon. Por lo tanto, este paso se realizará durante los días cuando los clones diferentes a 90% de confluencia.
    3. Añadir 70 μl de medio selectivo por pozo, desbaratar grumos de células mediante pipeteo arriba y abajo dentro de los pozos, luego transferir 30 μl de 100 μl a la placa de ADN gelatinizada prellenada con 120 μl de medio selectivo por pozo y 30 μL en el ingenio prellenada gelatinizado de congelación las placas h 50 μl de medio (sin selección).
    4. Colocar la placa de la DNA en la incubadora y permitir a las células para crecer a 37 ° C y 5% de CO2 hasta 90% de confluencia.
    5. Añadir 80 μl de helado recién hecho 2 x congelación medio (80% FBS y 20% dimetil sulfóxido (DMSO)) a cada pocillo de la placa de congelación, añadir parafilm (rociado con etanol al 70%) sobre la placa para sellar cada pocillo, coloque la tapa en la parte superior y envolver la placa con papel de aluminio. Coloque las placas de congelación a-80 ° C.
    6. Agregar 90 μl de medio selectivo por bien a la placa bien 96 original que contiene los clones que se han dividido y no se en cultura hasta resultados de PCR. Esta placa se utilizará como placa de respaldo.

2. selección de Clones resistentes a la neomicina

  1. Extracción de ADN de la placa de ADN bien 96.
    1. Una vez que los clones cultivados en la placa de ADN llega a 90% de confluencia, lavar 2 veces con PBS y lyse con 50 μl de tampón de lisis (10 mM Tris, pH 7,5, 10 mM EDTA, 10 mM de NaCl, 0.5% SDS y proteinasa K de 1 mg/mL). Cubra la placa con parafilm, sellando cada pocillo, coloque la tapa, cubierta con el abrigo de saran y colocar a 37 ° C durante la noche.
    2. Añada 100 μl de etanol frío (Et-OH) y una solución de NaCl (0,75 M de NaCl en 100% de etanol) a cada uno bien, precipitar por 6 horas o durante la noche a temperatura ambiente.
      Nota: El protocolo se puede detener aquí.
    3. Quitar el Et-OH/NaCl solución invirtiendo la placa y lavar 3 veces con 200 μL de etanol al 70% por pozo.
    4. Añadir 25 μl de ARNasa A solución en agua destilada e incubar a 37 ° C durante 1 h.
  2. Utilice 3 μl de ADN genómico para la amplificación por PCR. Realizar investigación de la polimerización en cadena de los clones seleccionados usando las cartillas recocido dentro del gen de resistencia a neomicina y subteloméricas 15q. Amplificación por PCR se realiza utilizando enzimas de polimerasa estándar y protocolos PCR21.
    Nota: Las condiciones PCR para cartillas de MS2 (cartilla MS2-subtel15q-primer-S y MS2 como) y cartillas del CTR (primer CTR S y cartilla CTR como) son los siguientes: 98 ° C por 20 s como paso de desnaturalización y luego 34 ciclos a 98 ° C 10 s, 58° C 20 s, 72 ° C 15 s , en 25 μl de enzima polimerasa reacción mezclar (véase Tabla de materiales). Secuencias de la cartilla se indican en la tabla 1.
  3. Ejecutar reacciones de PCR en gel de agarosa y extracto de bandas PCR obtenidas de clones positivos mediante procedimientos de extracción de gel estándar (véase Tabla de materiales reactivos de extracción de gel).
  4. Realizar análisis de la secuencia de ADN del gel extraído del producto de PCR para la confirmación de la presencia de las secuencias de MS221.
    Nota: El análisis de secuencia pueden realizarse utilizando los cebadores utilizados para la detección de PCR.
  5. Proyección de la mancha blanca /negra meridional de clones positivos de PCR
    1. Crecen los clones positivos en PCR y detección de la secuencia de la original 96 bien placa (la copia de seguridad) a 6 platos bien en medio Ham F - 12K (Kaighn) suplementado con 10% SFB, 2 mM L-glutamina, penicilina (0,5 unidades por mL de medio), estreptomicina (0.2 μg por mL de medio) y que contienen neomicina en una concentración de 0,7 μg/mL a 37 ° C 5% CO2.
      Nota: Como alternativa, si algunos de estos clones se han perdido, deshielo de una de las placas de congelación (véase protocolo 2.6).
    2. Una vez que los clones están en 90% de confluencia en la placa bien 6, lavan las células con PBS y añadir 250 μl de tampón de lisis que contienen 0,5 μg de proteinasa K por pozo.
    3. Raspar las células usando un raspador celular y transferir el lisado en un tubo de 1,5 mL.
    4. Incubar a 37 ° C por 16 h.
    5. Añadir 1 mL de etanol al 100%, agitar con fuerza y permitir el ADN precipitado por lo menos 2 horas o toda la noche a-20 ° C.
      Nota: El protocolo se puede detener aquí.
    6. Vuelta a 13.400 x g a 4 ° C por 10 min, descartar el sobrenadante y lavar el pellet con etanol 70%. Deje que el pellets aire seco a temperatura ambiente. Como alternativa, utilice un concentrador de vacío.
    7. Resuspender el pellet de DNA en 50 μl de agua destilada conteniendo Rnasa A e incubar 1 h a 37 ° C.
    8. Digerir el 5-10 μg de DNA genómico con enzimas de restricción Brochothrix y BamHI (dos digestiones independiente) en el volumen de reacción de 100 μl por incubación de las reacciones de digestión a 37 ° C durante la noche.
    9. Ejecutar 4 μL de la digestión en gel de agarosa (agarosa 0,8%) para la confirmación de la digestión completa.
    10. Añadir 1/10 volumen de sodio acetato 3 M solución pH 5.2 y 2 los volúmenes de etanol al 100% a las reacciones de digestión de restricción e incubar por lo menos 2 horas o durante la noche a-20 ° C para precipitar el ADN.
      Nota: El protocolo se puede detener aquí.
    11. Centrifugue a 13.400 x g a 4 ° C por 20 min, descartar el sobrenadante y lavar el pellet con etanol 70%. Dejar secar el pellet al aire a temperatura ambiente. Como alternativa, utilice un concentrador de vacío.
    12. Resuspender el pellet en 20 μl de agua destilada y el ADN digerido en un gel de agarosa al 0,8% de la carga.
      Nota: Para una mejor resolución del ADN digerido, preparar un gel por lo menos 15 cm de largo y correr toda la noche en baja tensión (̴30 v). Debe optimizarse la electroforesis establecida.
    13. Al día siguiente, teñir el gel con un agente etiquetado ADN, como el bromuro de etidio en concentración final de 1 μl/10 mL, 30 min a temperatura ambiente y tomar una foto con una regla cerca el gel en un gel de instrumento de proyección de imagen.
    14. Establecer a la transferencia de ADN a una membrana de nylon y realizar hibridación de la membrana con una sonda de secuencia-específica de MS2 utilizando procedimientos estándar21.
    15. Descongelar los clones que son positivos en PCR, ADN secuenciada y Southern blot de una de las dos placas de congelación (ver siguiente paso).
  6. Descongelación de clones
    1. Preparar un tubo de 15 mL que contiene 5 mL de precalentado Ham F - 12 K medio (de Kaighn) suplementado con 10% SFB, 2 mM L-glutamina, penicilina (0,5 unidades por mL de medio) y estreptomicina (0.2 μg / mL de medio) por cada clon que se descongelarán.
    2. Retire una de las placas de congelación de-80 ° y añadir 100 μl de precalentado F12K medio completo al bien que contiene la copia positiva que se descongelarán.
      Nota: Este procedimiento debe realizarse rápidamente y la placa de la pozo 96 debe colocarse en hielo seco después de cada clon se descongele, para permitir que los otros clones que permanecen congelados. Esto es particularmente importante si necesitan ser descongelado del mismo plato bien 96 múltiples clones.
    3. Transferencia de las células al tubo de 15 mL que contiene 5 mL de medio y centrifugue a 800 x g durante 5 min a temperatura ambiente.
    4. Aspire el medio resuspender las células en 500 μl de medio de F12K completo precalentado y transferir cada clon a un único pozo de una placa bien 12.
  7. Eliminación del gen de resistencia a neomicina del cassette de MS2 integrado en subteloméricas 15q.
    1. Permita que los clones a crecer de una placa bien 12 a un plato de 10 cm en el medio F12K completo.
      Nota: Neomicina no se incluyera en el medio a menos que se indique lo contrario.
    2. Añadir el adenovirus Cre-expresar las células cultivadas en un plato de 10 cm en confluencia de 70% en 10 mL de medio completo F12K.
      Nota: Utilizando un adenovirus expresando GFP Cre permitirá la evaluación de la eficacia de la infección, que debe acercarse al 100%. El adenovirus replicación defectuosa se perderán después de pocos pasos en la cultura.
    3. 48 horas después de la infección, dividir las células en tres platos de 10 cm. Dos platos se utilizará para la verificación de la eliminación del gen neomicina por selección negativa, cultivo de las células que contienen neomicina medio (primer plato) y por Southern blot (segundo plato).
    4. El tercer plato que contiene el clon para congelación de células y la extracción de RNA de la cultura.

3. verificación de la TERRA-MS2 transcripción expresión por RT-qPCR

  1. Previa verificación de la eliminación del gen de neomicina, realizar extracción de RNA total de clones de TERRA-MS2 con solventes orgánicos (fenol y guanidina isothiocynate solución)21.
    1. Resuspender el ARN extraído de un plato de 10 cm en 100 μl de agua de dietil pirocarbonato (DEPC).
    2. Ejecutar 3 μl de ARN en un gel con ácido (MOPS) propanesulfonic denaturating (1% formaldehído que contienen) 1 x 3-(N-Morpholino) para verificar la concentración y la integridad del ARN. También analizar la concentración de RNA usando un espectrofotómetro.
    3. Tratar 3 μg de ARN con DNasa I con 1 unidad de la ADNsa I enzima en el volumen de reacción final de 60 μL.
    4. Incubar la reacción por 1 h a 37 ° C.
  2. Revertir la reacción y qPCR análisis de transcripción
    1. Añadir los siguientes componentes a un tubo de microcentrífuga libre de nucleasas: 2 μl de un 1 primer específico de TERRA μm, 1 μl de mezcla de dNTPs (10 mM), 6 μl de DNasa tratados con ARN (correspondientes a ̴300ng RNA). Ajustar el volumen a 13 μl con 4 μL de agua DEPC.
      Nota: Para que cada RNA a analizar, un segundo tubo que contiene los mismos reactivos pero una cartilla específica de referencia, en vez de primer específico de TERRA, debe estar preparado.
    2. Calienta la mezcla a 65 ° C durante 5 minutos e incubar en hielo durante al menos 1 minuto.
    3. Recoger el contenido de los tubos por centrifugación breve y añadir 4 μL de la enzima RT X 5 Buffer, 1 μl 0.1m dithiothreitol (DTT), 1 μl (4 unidades) de inhibidor de la Rnasa y 1 μl de transcriptasa reversa (véase Tabla de materiales).
    4. Incubar las muestras a 42 ° C durante 60 min, luego use 2 μl de la reacción de RT para análisis de qPCR.
  3. Preparar la mezcla de reacción de qPCR en un volumen final de 20 μl de 10 μl de la mezcla principal de 2 x qPCR, 2 μl de cDNA plantilla, 1 μl de cebador forward (10 μm), 1 μl de cebador reverso (10 μm) y 6 μl de agua.
  4. Realizar la reacción de qPCR en un termociclador usando protocolos estándar21.

4. producción de un Retrovirus expresando GFP MS2

  1. Para generar el retrovirus expresando GFP MS2, transfectar 80% confluente phoenix packaging de células con una proteína de fusión de MS2-GFP expresar vectores de retrovirus (pBabe-MS2-GFP PURO) y un gen env expresando el vector (por ejemplo, pCMV-VSVG) con una relación molar de 4:1 de los dos vectores.
  2. Al día siguiente, reemplace el medio de cultivo (DMEM había suplementado con 10% SFB, 2 mM L-glutamina y pluma/Strep) con fresco medio que contiene 10mM butirato.
  3. Incubar durante 8 h a 37 ° C, 5% CO2, a continuación, sustituir el medio por medio fresco de cultivo desde que el virus será recogido.
  4. Después de 48 h, retire el medio de retrovirus que contienen las células de phoenix. Este medio puede ser utilizado directamente para la infección de clones de TERRA-MS2, en cuyo caso el medio del filtro a través de un filtro de 0.45 μm, agregar polibreno (concentración final de 30 μg/mL) y agregar a las células (en este caso el protocolo continúa en el paso 5). Por otra parte, retrovirus se puede precipitar en un tubo falcon de 50 mL agregando 1/5th volumen 50% PEG-8000/900 mm solución de NaCl y incubando toda la noche a 4 ° C en una rueda de rotor.
  5. Al día siguiente, las partículas de retrovirus de pellets por centrifugación a 2.000 x g durante 30 minutos, retirar el sobrenadante y resuspender el precipitado en F12K medio sin suero.
    Nota: Las partículas de virus pueden se resuspendió en 1/100th del volumen de sobrenadante original. Una prueba de infección debe realizarse para verificar el volumen mínimo de retrovirus necesaria para infectar eficientemente las células.

5. visualización de TERRA-MS2 transcritos en células vivas

  1. TERRA-MS2 clones y células AGS WT en platos con fondo de cristal de la placa. En el día de la infección, añadir polibreno el medio (concentración final de 30 μg/mL) y los retrovirus expresando GFP MS2.
  2. Después de 24 horas, descartar el medio que contiene el virus y añadir medio fresco sin rojo de fenol.
  3. Analizar las células en un microscopio invertido usando el microscopio adecuado. Imagen de las células con un 100 X u objetivo de 60 X con apertura numérica grande (1.4 X) y usando una cámara sensible (EMCCD). Utilizar un sistema de control ambiental para mantener las muestras a 37 ° C y 5% CO2 durante la proyección de imagen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figura 1 representa un resumen de la estrategia experimental. Los principales pasos del protocolo y un calendario indicativo para la generación de clones de TERRA-MS2 en células AGS se muestran (figura 1A). En el día 1, múltiples pocillos de una placa bien 6 son transfectados con el cassette de MS2 y sgRNA/Cas9 expresando vectores (se muestra en la figura 1B). Dos secuencias de 15q-específica guía RNA diferentes subteloméricas se clonan en el Cas9 nickase-expresión pX335 vector, generando dos vectores sgRNA-pX335 que son co transfected con el cassette de MS2. Un pocillo de la placa puede transfectado con un GFP expresión vectorial para verificar la eficiencia de transfección. En el día 2, las células se tripsinizaron y transferidas de un pozo único a un plato de 10 cm conteniendo medio selectivo. En el día 3, se deberá cambiar medio como más untransfected las células muertas. Las células se cultivan en la selección hasta que los clones son visibles y listo para ser recogido. Durante este tiempo, las células no deben se tripsinizaron y medio de cultivo debe ser cambiado cada 1-2 días para la primera semana y luego cada 2-3 días después. Una vez que los clones solo son visibles, son recogidos y transferidos en una placa bien 96 donde se les permite crecer hasta llegar a 80-90% de confluencia. En este punto, clones están divididos en 4 diferentes 96 bien las placas, que están marcadas en la figura 1 con un código de color. Una vez que los clones cultivados en la placa de ADN (verde) llega a 80% de confluencia, lisis y extracción de ADN genómico extraído para PCR de detección; los clones en la placa de respaldo (azul) se mantendrá en cultivo hasta los resultados de la detección de PCR, mientras que las placas de congelación rojo son congeladas a-80 ° C. Figura 2 B muestra resultados representativos de un examen de PCR de clones resistentes a la neomicina. Para esta investigación, se utilizan dos sistemas de cartillas: un cartilla par (cartillas de MS2) recocido dentro de la secuencia de 15q neomicina gene y subteloméricas es utilizado para verificar la presencia de la cassette de MS2 (una imagen representativa de la localización de cartillas se muestra en Figura 2A). Un segundo primer par (cartillas CTR) recocido en una región cromosómica interna se utiliza para verificar la presencia de falsos negativos clones (secuencias de la cartilla se indican en la tabla 1). Clones negativos para la integración de la cinta deben ser negativo a la amplificación de los iniciadores de MS2 y positivo a la amplificación de los iniciadores CTR. Problemas técnicos en la extracción de ADN genómica resultando en la ausencia de ADN genómico o su contaminación impediría la amplificación por PCR de las reacciones de la cartilla de MS2 y CTR. En estos casos, los clones implicados pueden volver a someterse a por PCR en extracción de ADN genómico de la placa de respaldo. Bandas de amplificación de cartillas de MS2 de clones positivos pueden ser gel extraído y secuenciado usando los cebadores MS2, con el fin de confirmar la presencia de secuencias de diez MS2.

Los clones que son positivos en el examen de PCR son cultivados desde la placa bien backup 96 (la placa azul en la figura 1) a una placa bien 6, luego de lisis para análisis de Southern blot y la extracción de ADN genómica. Figura 2 D muestra imágenes representativas de un gel (izquierda) y la membrana hibridada con radiactivo con MS2 secuencia específica sonda (derecha) de una proyección de Southern blot de clones positivos de PCR. Para la confirmación de la integración de secuencias de MS2 en subteloméricas 15q, DNA genomic extraída de cada clon debe ser digerida con dos diferentes enzimas de restricción (Brochothrix y BamHI) en dos reacciones de digestión separada. Las enzimas de restricción Brochothrix y BamHI son convenientes para la verificación de la integración de cassettes de MS2 en subteloméricas 15q. También pueden utilizarse otras enzimas. El gel muestra una digestión completa de la DNA genomic usando la enzima de restricción BamHI, tal como se indica por la presencia de un frotis. Los resultados de Southern blot indican que un clon es positivo para la integración de la cassette de MS2 en subteloméricas 15q mientras varios clones muestran múltiples eventos de integración de la cinta, como se indica por la presencia de varias bandas. Un clon positivo debe analizarse por un segundo Southern blot sobre Brochothrix digestión del ADN genómico21. Una imagen representativa de un cassette subteloméricas 15q que contiene el MS2 y la posición de los sitios de enzimas de restricción BamHI y Brochothrix se muestran en la figura 2C.

Los clones positivos a PCR y Southern blot análisis están infectados con un adenovirus expresando GFP Cre para eliminar el gen de la neomicina presente en la cinta de MS2. Figura 3 A representa un subteloméricas tagged MS2 15q antes y después de la expresión de la Cre. Una imagen de una copia positiva para la integración de cassettes de MS2 en subteloméricas 15q infectados con un Cre-GFP expresión adenovirus se muestra en la figura 3B. Para un retiro completo del gen neomicina en todas las células, la eficacia de infección debe alcanzar aproximadamente 100%. Como se muestra en la figura 3C, con el fin de verificar la eliminación del gen neomicina, células infectada Cre-GFP se dividen en tres placas después de 48 horas de la infección. Una placa se cultivan en presencia de neomicina. Todas las celdas de esta placa deben morir dentro de 6-7 días. En una segunda placa, las células pueden crecer en medio completo sin selección a 80-90% de confluencia. En este punto, la DNA genomic es extraída y analizada por Southern blot. La tercera placa se cultiva en medio completo para permitir la preparación de las acciones congeladas de la copia y para la extracción de RNA y RT-qPCR análisis de expresión de transcripción de TERRA-MS2. Figura 3 D muestra imágenes representativas de los análisis de Southern blot de una copia positiva antes y después de la infección de Cre-GFP. Gel de agarosa del ADN (imagen de la izquierda) confirma la digestión completa de la DNA genomic usando la enzima de la restricción de Brochothrix. Se realizó análisis de Southern blot con una sonda específica de MS2-secuencia radiactivo etiquetados (imagen de la derecha). Este análisis confirma la eliminación del gen de la neomicina. La presencia de un frotis de la muestra de Cre-GFP infectado confirma la integración telomeric de las secuencias de MS2. En la figura 3Ase muestra la posición de los sitios de restricción de Brochothrix dentro subteloméricas 15q.

Una vez confirmada la eliminación del gen de resistencia a neomicina, los clones se pueden probar para la expresión de las transcripciones de TERRA-MS2. Para ello, ARN total es extraído de cada clon y correr en un gel de MOPS denaturating para confirmar su integridad (figura 4A). Bandas de ARN ribosómico deben ser visibles en 4.700 bases (rRNA 28S) y 1.900 bases (rRNA 18S). Reacción de retrotranscripción es realizada usando una cartilla específica de repetición telomeric y referencia gene-específico primer (figura 4B, arriba) mientras que análisis de qPCR de expresión TERRA se realizan con dos sistemas de cartillas: cartilla de uno par de recocido dentro de la secuencia de MS2 y la secuencia subteloméricas 15q; un segundo par de primers recocido dentro subteloméricas 15q. Secuencias de la cartilla se indican en la tabla 1. El gráfico presentado en la figura 4B muestra análisis de RT-qPCR de la expresión de la TERRA de las células de la WT de AGS y dos clones diferentes de TERRA-MS2. Estos análisis confirman la expresión de las transcripciones de TERRA-MS2 en los dos clones a niveles que son comparables a las transcripciones de la TERRA de subteloméricas 15q en células WT. Estos datos indican que los dos clones de TERRA-MS2 seleccionados son adecuados para el análisis de las transcripciones de TERRA-MS2 por proyección de imagen de células vivas.

Para poder visualizar las transcripciones de TERRA-MS2 en células vivas, los clones seleccionados están infectados por un retrovirus que expresan la proteína de la fusión de GFP MS2. Figura 5 A muestra el procedimiento para generar retrovirus expresando GFP MS2, tal como se describe en el paso 4 de protocolo. Infectan a las células AGS WT y clones de TERRA-MS2 en platos con fondo de cristal. Después de 24 h de la infección, las células son analizadas por microscopía de fluorescencia. La especificidad de la señal se confirma por la presencia de focos de TERRA-MS2-GFP en el núcleo de clones de TERRA-MS2 y no en las células AGS WT (figura 5B). En una población de MS2-GFP expresando células, heterogeneidad en términos de niveles de MS2-GFP entre células se espera y las células que expresaban niveles bajos deben elegirse para el análisis de imágenes. Por otra parte, las células expresa GFP MS2 se pueden clasificar por análisis de microscopia previa FACS para recoger la subpoblación de células que expresan bajos niveles de GFP. Previamente hemos detectado focos de TERRA-MS2-GFP en 40% a 60% de las células de AGS TERRA-MS2 clones21. En estas células, una a cuatro focos de TERRA-MS2-GFP se reflejada por la célula. TERRA-MS2-GFP focos mostrando dinámicas y diferentes tamaños pueden ser detectado21. TERRA-MS2 clones pueden utilizarse para estudiar la dinámica de las transcripciones TERRA solo telómeros en las células vivas. Como ejemplo de esta aplicación, la figura 5C muestra imágenes representativas de los análisis de microscopía de un clon de TERRA-MS2 expresando la proteína de la fusión de GFP de MS2 y la proteína telomérica de que TRF2 fusionado a mCherry a fin visualizar transcripciones TERRA tagged MS2 y telómeros en las células vivas. Usando este acercamiento, anteriormente observamos que focos de TERRA-MS2-GFP localización junto con los telómeros en el 44% de las células, lo que indica que las transcripciones TERRA sólo transitoriamente co localización con los extremos del cromosoma en células AGS21.

Figure 1
Figura 1 . Resumen de la estrategia experimental y cronograma indicativo para la generación de TERRA-MS2 clones de células AGS. A) se muestran los pasos descritos en el protocolo y un cronograma indicativo para la selección de TERRA-MS2 clones. Células son transfectados en una placa bien 6 con el cassette de MS2 lineal y sgRNA/Cas9 expresando vectores. Un código de color se utiliza para distinguir la placa de la DNA, la placa de respaldo y las placas de congelación indicaron en la sección de protocolo. B) MS2 el cassette consta de una secuencia de largo subteloméricas 15q nt 800 seguido por 10 repeticiones de las secuencias de MS2 y un gen de resistencia a neomicina flanqueado por lox-p sitios y termina con un tracto repetición telomeric larga 300 del nt en su extremo 3'. vectores de expresión sgRNA/Cas9 fueron generados por clonación de secuencias subteloméricas 15q-específica guía RNA pX335 vector usando el BbsI restricción sitio21,22. Se generaron dos vectores diferentes sgRNA-pX335 y una mezcla 1:1 de los dos vectores se utilizó para la transfección. Las secuencias de la sgRNAs se indican en la tabla 1. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2 . Imágenes representativas de PCR y Southern blot selección de clones resistentes a la neomicina. A) imagen representativa de subteloméricas 15q que contiene el cassette de MS2. Se indica la posición de los iniciadores de MS2 (cartilla MS2-subtel15q-primer-S y MS2 como) utilizado para la detección de PCR. En rojo se muestran los sitios loxP en el cassette. B) imagen representativa de la detección de PCR de clones resistentes a la neomicina utilizando dos cartillas, cartillas de MS2 y cartillas del CTR (primer CTR S y cartilla CTR como). C) imagen representativa de subteloméricas 15q que contiene el cassette de MS2. Sitios de restricción BamHI y Brochothrix y la sonda de MS2, utilizado para la proyección de Southern blot se muestran. D) izquierda: 10 μg de ADN genómico por clon eran digerido con BamHI y correr en un gel de agarosa. La imagen fue adquirida después de una noche a 30 voltios. Derecha: ADN genómico digerido con enzimas de restricción BamHI fue transferido a una membrana de nylon cargada positivamente y cruzado por hibridación con una sonda marcada radiactivamente con MS2 secuencia-específica. El cuadro rojo indica el tamaño esperado de la banda positiva. La flecha roja indica una copia positiva. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3 . Eliminación de los experimentos de resistencia a neomicina gene y validación. A) imagen representativa de subteloméricas 15q que contiene el cassette de MS2 antes y después de la expresión de la Cre. La sonda específica MS2 utilizada para el análisis de Southern blot y Brochothrix enzima de la restricción sitios aparecen. En rojo se muestran los sitios loxP en el cassette. B) análisis de la microscopia de la fluorescencia de un clon de TERRA-MS2 infectado con adenovirus expresando su Cre-GFP. Se muestra imagen representativa en un solo plano focal. MOI, multiplicidad de infección, es la relación entre el número de los virus utilizados para la infección y el número de las células del huésped. Barra de escala: 30 μm C) Resumen de la estrategia experimental para verificar la eliminación del gen de la neomicina. Las células Cre-GFP infectada se dividen en tres placas después de 48 horas de la infección de selección i) negativo, análisis ii) Southern blot y iii) preparación de las poblaciones de células congeladas y la extracción de RNA. D) análisis de Southern blot de un TERRA-MS2 clon antes y después de la infección de adenovirus Cre-GFP. 10 μg de ADN genómico fueron digeridos con la enzima de restricción Brochothrix. Gel de agarosa confirma que la digestión completa se logra en ambos clones (izquierda). El ADN genómico digerido fue transferido a una membrana de nylon cargada positivamente y cruzado por hibridación con una sonda de secuencia-específica de MS2. Eliminación completa del gen neomicina se confirma por la ausencia de la banda específica. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4 . Análisis de RT-qPCR de Tel15q-TERRA y Tel15q-TERRA-MS2 expresión de las transcripciones. A) imagen representativa de un gel de MOPS con ARN total extraído de las células AGS WT y clones de TERRA-MS2. Bandas correspondientes a los RNAs ribosomales 28S y 18S están indicados. B) parte superior: un esquema de la subteloméricas tagged MS2 15q expresando las transcripciones TERRA. Cebadores utilizados para análisis de qPCR de TERRA-Tel15q (azul) y TERRA Tel15q-MS2 (rojo) y TERRA retrotranscripción (amarillo) se muestran. En rojo se muestra el sitio loxP. Abajo: RT-qPCR análisis de expresión de las transcripciones Tel15q TERRA y TERRA Tel15q-MS2 en células AGS WT y TERRA-MS2 clones. p < 0.05, t-test. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5 . Celular directo imágenes análisis de TERRA-MS2 clones. A) un resumen del procedimiento para producir un retrovirus expresando GFP MS2, tal como se describe en el paso 4 de protocolo. Un esquema del MS2-tagged subteloméricas 15q y transcripciones TERRA, reconocidas por la proteína de la fusión de GFP MS2 se muestra a la derecha. B) imagen de microscopía de fluorescencia representante de AGS WT y dos TERRA-MS2 clones expresando GFP MS2. TERRA-MS2-GFP focos están indicados por flechas. Se adquirieron imágenes utilizando un microscopio confocal de disco giratorio equipado con una cámara EMCCD. Las imágenes fueron capturadas utilizando un 100 X / 1.46 apochromat objetivo en una cámara de proyección de imagen se mantiene a 37 ° C con 5% CO2. Un laser de 488 fue utilizado como fuente de luz. Barra de escala: 5 μm. C) celular directo imágenes análisis de focos de TERRA-MS2-GFP y TRF2 mCherry etiquetados los telómeros. Se muestra un evento de colocalización entre un foco de TERRA-MS2-GFP y un telómero solo. Imágenes fueron adquiridas como en B, con 488 y 520 láseres como fuente de luz. Una proyección máxima de un experimento de pila z realizado en una sola vez se muestra el punto del experimento de Time-lapse. Barra de escala: 5 μm. haga clic aquí para ver una versión más grande de esta figura.

Nombre de la cartilla Secuencia de primer Aplicación
MS2-subtel15q-primer-S TGCATTAAAGGGTCCAGTTG Cartilla de MS2 adelante utilizada para la detección de PCR de clones resistentes a la neomicina
Cartilla de MS2 como CCTAACTGACACACATTCCACAGA Cartilla de MS2 inversa utilizada para la detección de PCR de clones resistentes a la neomicina
Cartilla CTR S TGT ACG CCA ACA CAG TGC TG Cartilla CTR adelante utilizada en la detección de PCR de clones resistentes a la neomicina
Cartilla CTR como GCT GGA AGG TGG ACA GCG A Cartilla CTR inversa utilizada en la detección de PCR de clones resistentes a la neomicina
Tel15q-S1 GCAGCGAGATTCTCCCAAGC Primer sentido utilizado para detectar la expresión Tel15q y TERRA Tel15q-MS2 por qPCR
hTel15q-AS TAACCACATGAGCAATGTGGGTG Primer antisentido utilizado para detectar la expresión Tel15q y TERRA Tel15q-MS2 por qPCR
Tel15q-MS2-AS ATGTTTCTGCATCGAAGGCATTAGG Primer antisentido utilizado para detectar la expresión TERRA Tel15q-MS2 por qPCR
TERRA-RT-cartilla CCCTAACCCTAACCCTAACCCTAACCCTAA Cartilla utilizada por retrotranscripción de transcripciones TERRA
sgRNA1 TTGGGAGAATCTCGCTGGCC Secuencia de la guía corta ARN 1 clonado en el vector pX335 y solía dirigir Cas9 nickase actividad enzimática a subteloméricas 15q
sgRNA2 TGCATTAAAGGGTCCAGTTG Secuencia de la guía corta ARN 2 clonado en el vector pX335 y solía dirigir Cas9 nickase actividad enzimática a subteloméricas 15q

Tabla 1 : Lista de los cebadores utilizados en este estudio. Se proporciona una lista de los cebadores y las secuencias de la sgRNAs utilizado en este protocolo. Las secuencias son 5' a 3'.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En este artículo presentamos un método para generar clones de células de cáncer humano que contiene secuencias de MS2 integradas en subteloméricas 15q. Usando estos clones, las moléculas etiquetadas MS2 TERRA transcritas de subteloméricas 15q son detectadas por microscopía de fluorescencia por la expresión de una proteína de la fusión de GFP MS2. Este enfoque permite a los investigadores a estudiar la dinámica de TERRA expresado desde una sola células del telómero en la vida de21. En este protocolo, TERRA-MS2 clones se seleccionan en la línea celular AGS, que representa un interesante sistema de modelo para el estudio de TERRA, como expresión de TERRA es upregulated en el estómago humano cáncer muestras24. Sin embargo, el protocolo descrito aquí puede ser adaptado para la selección de clones de TERRA-MS2 en otras líneas celulares. La integración de las secuencias de MS2 puede en principio promoverse a una diferente del telomere 15q subteloméricas usando un cassette específico de MS2 y estrategia CRISPR. En el método presentado aquí, una enzima de nickase Cas9 y doble guía RNAs son empleados para aumentar la especificidad de la integración22. Usando esta estrategia, un 2% general de clones positivos deben ser identificados en células AGS. Otras versiones de la enzima Cas9 pueden probarse en el intento de aumentar la tasa de éxito de la selección de clones de25. Además, los siguientes pasos del protocolo son críticos a tener en cuenta para maximizar la eficiencia de la selección de clones:

I) con el fin de aumentar las posibilidades de la selección de los clones de TERRA-MS2, es importante lograr una eficacia de transfección alta de los vectores CRISPR y el cassette de MS2. Líneas de células transfected mal probablemente requerirá varias rondas de transfección, selección de clones y proyección para seleccionar clones positivos.

II) es importante determinar la concentración exacta de la neomicina a utilizar para la selección de los clones. De hecho, usando una concentración baja de la droga producirá clones positivos falsos mientras que una concentración alta puede impedir la identificación de clones positivos. La concentración de neomicina indicada en este protocolo es letal para las células AGS dentro de 6-7 días de la adición al medio de cultivo.

III) clon picking es un paso crítico. De hecho, durante este procedimiento se requiere que los clones solos son recogidas. Para ello, las colonias que están muy cerca que entre sí se deben evitar para evitar la mezcla con células de diferentes clones, dando por resultado la selección de una población mixta de clones que pueden contener secuencias de MS2 integrado en múltiples sitios genómicos. Estos eventos deben ser identificados durante la prueba de Southern blot.

IV) la cantidad de DNA genomic extraída de una placa de ADN bien confluentes 96 (protocolo 2) se estima que alrededor de 5 μg y debería bastar para cada clon por PCR y Southern blot con una sola enzima de la restricción digestión de la pantalla. Sin embargo, para confirmar la integración del cassette en el telómero esperado, será importante para cada clon por Southern blot digiriendo el ADN genómico con dos enzimas de restricción diferentes. Para ello, como se indica en el protocolo, los clones positivos en detección de PCR deben ser cultivados en placas de pozos 6. La cantidad de la DNA genomic extraída de un pozo de una placa bien 6 será suficiente para por lo menos dos digestiones de la restricción necesarias para el análisis de Southern blot.

En el protocolo descrito aquí, las secuencias de MS2 se integran dentro subteloméricas 15q por una serie de razones: i) región del promotor TERRA y TERRA transcripción Inicio sitios han sido identificados en este subteloméricas26,27; II) expresión TERRA de subteloméricas 15q ha sido validado mediante el uso de vitro técnicas4,27,28,29,30; III) la región subtelomeric del cromosoma 15q ha sido secuenciada y contiene una única región adyacente a la zona de repetición telomérica que puede orientarse para la integración de la cassette de MS221. Enfoques de Southern blot y PCR fueron desarrollados con el fin de confirmar la integración única de las secuencias de MS2 en 15q subteloméricas en los clones de TERRA-MS2. Sería interesante realizar también experimentos de DNA-FISH de cromosoma se separa para poder visualizar la localización cromosómica de las secuencias de MS2 en cromosomas metafásicos fijo. Sin embargo, las secuencias de la longitud de la 10xMS2 (450 bp) impone el uso de sondas muy corto en comparación con las sondas generalmente utilizadas en los experimentos de DNA-FISH de cromosoma se separa (cósmidos, cromosomas artificiales bacterianos (Bac) y plásmidos)31. Este reto nos ha impedido visualizar las secuencias de MS2 en extensiones de cromosoma que representa una limitación del protocolo. Una limitación adicional del método es el tiempo y el esfuerzo necesario para la selección de los clones de TERRA-MS2. Además, se requiere laboratorio específico establecido y equipo para el uso de virus, material radiactivo y los análisis de microscopía.

El método descrito aquí puede ser implementado para la generación de clones de TERRA-MS2 en diferentes líneas celulares para definir la dinámica de la tierra en diversos contextos biológicos, tales como durante la senescencia de la disfunción o celular telómero, ayudarnos a comprender la función de TERRA en estos procesos. Un desarrollo interesante de este enfoque será la generación de clones de TERRA-MS2 con TetO repite integrado en un subteloméricas específicas, incluyendo el telomere tagged MS2. La expresión de una proteína Tet unida a una proteína fluorescente (es decir, mCherry) permitirá la visualización de este telómero particular en la vida de las células de32. Este enfoque permitirá la investigación de si humanas transcripciones TERRA localizan y actúan en cis en la TERRA transcribir telómeros y cromosoma o en trans reubicando a otros cromosomas. Esta pregunta el biología de TERRA queda por aclararse.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no declaran a intereses financieros que compiten

Acknowledgments

Estamos muy agradecidos al personal de la facilidad avanzada de la proyección de imagen del CIBIO en la Universidad de Trento y la instalación de microscopía de luz de BioOptics en el Max F. Perutz laboratorios (MFPL) en Viena. La investigación conduce a estos resultados ha recibido no financiación de la Stiftung Mahlke Obermann y séptimo programa marco de la Unión Europea para la investigación, desarrollo tecnológico y demostración en convenio de subvención 609431 de la CE. CE es apoyado por una beca Montalcini del Ministerio italiano de la Universidad de la educación y la investigación (MIUR).

Materials

Name Company Catalog Number Comments
AGS cells - - Gift from Christian Baron (Université de Montréal).
F12K Nut Mix 1X GIBCO 21127022 Culturing medium for AGS cells
L-Glutamine  CORNING MT25005CI Component of cell culturing medium
Penicillin Streptomycin Solution CORNING 30-002-CI Component of cell culturing medium
Fetal Bovine Serum Sigma Aldrich F2442 Component of cell culturing medium
DMEM 1X GIBCO 21068028 culturing medium for phoenix cell
CaCl2 Sigma Aldrich C1016 used in phoenix cell transfection
HEPES Sigma Aldrich H3375 used in phoenix cell transfection (HBS solution)
KCl Sigma Aldrich P9333 used in phoenix cell transfection (HBS solution)
Dextrose Sigma Aldrich D9434 used in phoenix cell transfection (HBS solution)
NaCl Sigma Aldrich S7653 used in phoenix cell transfection (HBS solution) and retrovirus precipitation
Na2HPO4 Sigma Aldrich S3264 used in phoenix cell transfection (HBS solution)
TRYPSIN EDTA SOLUTION 1X CORNING 59430C used in cell split
DPBS 1X GIBCO 14190250 Dulbecco's Phosphate Buffered Saline
DMSO Sigma Aldrich D8418 Component of cell freezing medium (80% FBB and 20% DMSO)
G-418 Disulphate Formedium G4185 selection drug for 
Gelatin solution Bioreagent Sigma Aldrich G1393 cotaing of 96 well DNA plate and freezing plate
Tris-base Fisher BioReagents 10376743 Component of Cell lysis buffer for genomic DNA extraction
EDTA Sigma Aldrich E6758 Component of Cell lysis buffer for genomic DNA extraction
SDS Sigma Aldrich 71729 Component of Cell lysis buffer for genomic DNA extraction
Proteinase K Thermo Fisher AM2546 Component of Cell lysis buffer for genomic DNA extraction
RNAse A Thermo Fisher 12091021 RNA degradation during DNA extraction
Agarose Sigma Aldrich A5304 DNA gel preparation
Atlas ClearSight Bioatlas BH40501 Stain reagent used for detecting DNA and RNA samples in agarose gel
ethanol Fisher BioReagents BP28184 DNA precipitation
Sodium Acetate  Sigma Aldrich 71196 Used for DNA precipitation at a 3M concentration pH5.2
Wizard SV Gel and PCR clean-Up system Promega A9282 Extraction of PCR fragments from agarose gel during PCR screening of neomycin positive clones
Trizol AMBION 15596018 Organic solvent used for RNA extraction
Dnase I THERMO SCIENTIFIC 89836 degradation of genomic DNA from RNA 
dNTPs mix Invitrogen 10297018 used in RT and PCR reactions
DTT Invitrogen 707265ML used in RT reactions
diethyl pyrocarbonate Sigma Aldrich D5758 used to inactivate RNAses in water (1:1000 dilution)
Ribolock Thermo Fisher EO0381 RNase inhibitor
MOPS Sigma Aldrich M9381 preparation of RNA gel
Paraformaldehyde Electron Microscopy Sciences 15710 preparation of denaturating RNA gel (1% PFA in 1x MOPS)
Superscript III Reverse transcriptase Invitrogen 18080-093 Retrotranscription reaction
Pfu DNA polymerase (recombinant) Thermo Scientific EP0501 PCR reaction
2X qPCRBIO SyGreen Mix Separate-ROX PCR BIOSYSTEMS PB 20.14 qPCR reaction
Cre-GFP adenovirus https://medicine.uiowa.edu/vectorcore 1174-HT used to infect TERRA-MS2 clones in order to remove the neomycn gene
Sodium Butyrate Sigma Aldrich B5887 used to promote retrovirus particles production in phoenix cells
PEG8000 Sigma Aldrich 89510 Precipitation of retrovirus partcles
35µ-Dish Glass Bottom Ibidi 81158 used in live cell imaging analyses of TERRA-MS2 clones

DOWNLOAD MATERIALS LIST

References

  1. Azzalin, C. M., Reichenbach, P., Khoriauli, L., Giulotto, E., Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science. 318, (5851), 798-801 (2007).
  2. Schoeftner, S., Blasco, M. A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nature Cell Biology. 10, (2), 228-236 (2008).
  3. Diman, A., Decottignies, A. Genomic origin and nuclear localization of TERRA telomeric repeat-containing RNA: from Darkness to Dawn. FEBS Journal. (2017).
  4. Arnoult, N., Van Beneden, A., Decottignies, A. Telomere length regulates TERRA levels through increased trimethylation of telomeric H3K9 and HP1alpha. Nature Structural & Molecular Biology. 19, (9), 948-956 (2012).
  5. Montero, J. J., et al. TERRA recruitment of polycomb to telomeres is essential for histone trymethylation marks at telomeric heterochromatin. Nature Communications. 9, (1), 1548 (2018).
  6. Beishline, K., et al. CTCF driven TERRA transcription facilitates completion of telomere DNA replication. Nature Communications. 8, (1), 2114 (2017).
  7. Arora, R., et al. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nature Communications. 5, 5220 (2014).
  8. Balk, B., et al. Telomeric RNA-DNA hybrids affect telomere-length dynamics and senescence. Nature Structural & Molecular Biology. 20, (10), 1199-1205 (2013).
  9. Graf, M., et al. Telomere Length Determines TERRA and R-Loop Regulation through the Cell Cycle. Cell. 170, (1), 72-85 (2017).
  10. Lee, Y. W., Arora, R., Wischnewski, H., Azzalin, C. M. TRF1 participates in chromosome end protection by averting TRF2-dependent telomeric R loops. Nature Structural & Molecular Biology. (2018).
  11. Moravec, M., et al. TERRA promotes telomerase-mediated telomere elongation in Schizosaccharomyces pombe. EMBO Reports. 17, (7), 999-1012 (2016).
  12. Cusanelli, E., Romero, C. A., Chartrand, P. Telomeric noncoding RNA TERRA is induced by telomere shortening to nucleate telomerase molecules at short telomeres. Molecular Cell. 51, (6), 780-791 (2013).
  13. Moradi-Fard, S., et al. Smc5/6 Is a Telomere-Associated Complex that Regulates Sir4 Binding and TPE. PLoS Genetics. 12, (8), e1006268 (2016).
  14. Chu, H. P., et al. TERRA RNA Antagonizes ATRX and Protects Telomeres. Cell. 170, (1), 86-101 (2017).
  15. Lai, L. T., Lee, P. J., Zhang, L. F. Immunofluorescence protects RNA signals in simultaneous RNA-DNA FISH. Experimental Cell Research. 319, (3), 46-55 (2013).
  16. Zhang, L. F., et al. Telomeric RNAs mark sex chromosomes in stem cells. Genetics. 182, (3), 685-698 (2009).
  17. Gallardo, F., Chartrand, P. Visualizing mRNAs in fixed and living yeast cells. Methods in Molecular Biology. 714, 203-219 (2011).
  18. Querido, E., Chartrand, P. Using fluorescent proteins to study mRNA trafficking in living cells. Methods in Cell Biology. 85, 273-292 (2008).
  19. Cusanelli, E., Chartrand, P. Telomeric noncoding RNA: telomeric repeat-containing RNA in telomere biology. Wiley Interdisciplinary Reviews: RNA. 5, (3), 407-419 (2014).
  20. Perez-Romero, C. A., Lalonde, M., Chartrand, P., Cusanelli, E. Induction and relocalization of telomeric repeat-containing RNAs during diauxic shift in budding yeast. Current Genetics. (2018).
  21. Avogaro, L., et al. Live-cell imaging reveals the dynamics and function of single-telomere TERRA molecules in cancer cells. RNA Biology. 1-10 (2018).
  22. Ran, F. A., et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell. 154, (6), 1380-1389 (2013).
  23. Yamada, T., et al. Spatiotemporal analysis with a genetically encoded fluorescent RNA probe reveals TERRA function around telomeres. Scientific Reports. 6, 38910 (2016).
  24. Deng, Z., et al. Formation of telomeric repeat-containing RNA (TERRA) foci in highly proliferating mouse cerebellar neuronal progenitors and medulloblastoma. Journal of Cell Science. 125, (Pt 18), 4383-4394 (2012).
  25. Casini, A., et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nature Biotechnology. 36, (3), 265-271 (2018).
  26. Nergadze, S. G., et al. CpG-island promoters drive transcription of human telomeres. RNA. 15, (12), 2186-2194 (2009).
  27. Porro, A., et al. Functional characterization of the TERRA transcriptome at damaged telomeres. Nature Communications. 5, 5379 (2014).
  28. Farnung, B. O., Brun, C. M., Arora, R., Lorenzi, L. E., Azzalin, C. M. Telomerase efficiently elongates highly transcribing telomeres in human cancer cells. PLoS One. 7, (4), e35714 (2012).
  29. Flynn, R. L., et al. Alternative lengthening of telomeres renders cancer cells hypersensitive to ATR inhibitors. Science. 347, (6219), 273-277 (2015).
  30. Scheibe, M., et al. Quantitative interaction screen of telomeric repeat-containing RNA reveals novel TERRA regulators. Genome Research. 23, (12), 2149-2157 (2013).
  31. Bolland, D. J., King, M. R., Reik, W., Corcoran, A. E., Krueger, C. Robust 3D DNA FISH using directly labeled probes. Journal of Visualized Experiments. (78), (2013).
  32. Masui, O., et al. Live-cell chromosome dynamics and outcome of X chromosome pairing events during ES cell differentiation. Cell. 145, (3), 447-458 (2011).
Generación de Clones de células de cáncer para visualizar que contiene la repetición telomérica ARN TERRA de un telómero solo en las células vivas
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).More

Avogaro, L., Oss Pegorar, C., Bettin, N., Cusanelli, E. Generation of Cancer Cell Clones to Visualize Telomeric Repeat-containing RNA TERRA Expressed from a Single Telomere in Living Cells. J. Vis. Exp. (143), e58790, doi:10.3791/58790 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter