Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

डीएनए किनारा विनिमय प्रतिक्रिया की वास्तविक समय अवलोकन Rad51 द्वारा मध्यस्थता

doi: 10.3791/59073 Published: February 13, 2019

Summary

प्रतिदीप्ति अनुनाद ऊर्जा स्थानांतरण आधारित डीएनए किनारा विनिमय प्रतिक्रिया Rad51 द्वारा मध्यस्थता की वास्तविक समय प्रेक्षण प्रणालियों विकसित किए गए थे. यहां प्रस्तुत प्रोटोकॉल का उपयोग कर, हम प्रतिक्रिया मध्यवर्ती और उत्पादों में उनके रूपांतरण के गठन का पता लगाने में सक्षम हैं, जबकि भी प्रतिक्रिया के एंजाइमी कैनेटीक्स का विश्लेषण ।

Abstract

डीएनए किनारा विनिमय प्रतिक्रिया Rad51 द्वारा मध्यस्थता मुताबिक़ पुनर्संयोजन का एक महत्वपूर्ण कदम है. इस प्रतिक्रिया में, Rad51 एकल-कतरा डीएनए पर एक nucleoprotein रेशा रूपों (ssDNA) और कब्जा डबल-असहाय डीएनए (dsDNA) गैर विशेष रूप से यह एक मुताबिक़ अनुक्रम के लिए पूछताछ करने के लिए । समरूपता मुठभेड़ के बाद, Rad51 catalyzes डीएनए किनारा विनिमय dsDNA के पूरक किनारा के साथ ssDNA के बाँधना मध्यस्थता करने के लिए. यह प्रतिक्रिया बहुत vivo मेंकई accesser प्रोटीन द्वारा विनियमित है । हालांकि पारंपरिक जैव रासायनिक परख सफलतापूर्वक इन विट्रो मेंइस तरह के गौण प्रोटीन की भूमिका की जांच करने के लिए नियोजित किया गया है, मध्यवर्ती गठन के काइनेटिक विश्लेषण और एक अंतिम उत्पाद में अपनी प्रगति के कारण चुनौतीपूर्ण साबित हो गया है प्रतिक्रिया मध्यवर्ती की अस्थिर और क्षणिक प्रकृति. समाधान में इन प्रतिक्रिया कदम सीधे निरीक्षण करने के लिए, प्रतिदीप्ति अनुनाद ऊर्जा हस्तांतरण (झल्लाहट)-इस प्रतिक्रिया के वास्तविक समय प्रेक्षण प्रणालियों आधारित स्थापित किए गए थे । वास्तविक समय टिप्पणियों के काइनेटिक विश्लेषण से पता चलता है कि डीएनए किनारा विनिमय प्रतिक्रिया Rad51 द्वारा मध्यस्थता एक तीन कदम प्रतिक्रिया एक तीन-किनारा डीएनए मध्यवर्ती, इस मध्यवर्ती की परिपक्वता, और ssDNA की रिहाई से जुड़े मॉडल का पालन करता है परिपक्व मध्यवर्ती । Swi5-Sfr1 परिसर, एक accessed प्रोटीन eukaryotes में संरक्षित, दृढ़ता से इस प्रतिक्रिया के दूसरे और तीसरे कदम को बढ़ाता है । झल्लाहट आधारित परख यहां प्रस्तुत हमें आणविक तंत्र है जो के माध्यम से पुनर्संयोजन पहुंच प्रोटीन Rad51 के डीएनए किनारा विनिमय गतिविधि को उत्तेजित उजागर करने के लिए सक्षम करें । इस प्रोटोकॉल का प्राथमिक लक्ष्य मुताबिक़ पुनर्संयोजन, विशेष रूप से Schizosaccharomyces pombeके अलावा अंय प्रजातियों से प्रोटीन के साथ काम कर रहे लोगों के क्षेत्र में शोधकर्ताओं के लिए उपलब्ध तकनीकों की प्रदर्शनियों को बढ़ाने के लिए है, ताकि यहां प्रस्तुत निष्कर्षों के विकासवादी संरक्षण का निर्धारण किया जा सकता है ।

Introduction

मुताबिक़ पुनर्संयोजन (मानव संसाधन) दो अलग डीएनए अणुओं के बीच आनुवंशिक जानकारी के फेरबदल की सुविधा । मानव संसाधन दो मौलिक जैविक घटना के लिए आवश्यक है: gametogenesis1 के दौरान आनुवंशिक विविधता की पीढ़ी और डीएनए की मरंमत डबल-किनारा टूटता है (DSBs)2 बँटवारा के दौरान । DSBs डीएनए क्षति का सबसे गंभीर रूप है और गुणसूत्र में एक टूटना गठन । DSBs की गलत मरंमत व्यापक गुणसूत्र पुनर्व्यवस्था और जीनोमिक अस्थिरता, जो दोनों कैंसर3की पहचान कर रहे है कारण हो सकता है ।

डीएनए किनारा विनिमय प्रतिक्रिया एचआर के मध्य चरण है । Rad51 प्रोटीन, जो recombinases के अत्यधिक संरक्षित RecA-प्रकार के परिवार का सदस्य है, प्रमुख प्रोटीन है जो eukaryotes4,5में इस प्रतिक्रिया को catalyzes है । इस प्रतिक्रिया में, Rad51 DSB अंत के nucleolytic प्रसंस्करण द्वारा उत्पन्न एकल-असहाय डीएनए (ssDNA) करने के लिए बांधता है और एक पेचदार nucleoprotein जटिल presynaptic रेशा के रूप में शब्द । यह रेशा बरकरार डबल फंसे डीएनए (dsDNA) विशेष रूप से एक मुताबिक़ अनुक्रम के लिए खोज करने के लिए । जब रेशा एक मुताबिक़ अनुक्रम पाता है, एक रिएक्शन मध्यवर्ती युक्त तीन-असहाय डीएनए बनता है और इस संरचना के भीतर Rad51 रेशा मध्यस्थता कतरा विनिमय6,7,8. इस प्रतिक्रिया कुशलता से पूरा करने के लिए, Rad51 BRCA1 और BRCA2 जैसे गौण प्रोटीन के कई प्रकार की आवश्यकता है, स्तन कैंसर झेलते जीन के उत्पादों9,10.

समझ कैसे गौण कारकों Rad51 विनियमित tumorigenesis के दौरान जीनोमिक अस्थिरता के कारणों को उजागर करने में एक अभिंन कदम है । हालांकि बहुत अनुसंधान presynaptic रेशा गठन और स्थिरता पर इन कारकों के प्रभाव के साथ संबंध है11,12,13,14,15,16, इन कारकों में से तीन-किनारा मध्यवर्ती और अंतिम उत्पाद में अपनी प्रोसेसिंग के गठन के लिए योगदान अभी भी अस्पष्ट है । पारंपरिक जैव रासायनिक प्रयोगों के माध्यम से इन प्रतिक्रिया कदम देख बहुत मुश्किल है क्योंकि तीन-कतरा मध्यवर्ती अस्थिर है और इस तरह के नमूनों की deproteinization के रूप में आम प्रयोगात्मक जोड़तोड़ से पतन की संभावना है या वैद्युतकणसंचलन.

इस समस्या को दूर करने के लिए, हम दो पहले से विकसित डीएनए किनारा विनिमय प्रतिक्रिया के वास्तविक समय प्रेक्षण प्रणालियों प्रतिदीप्ति अनुनाद ऊर्जा स्थानांतरण (झल्लाहट) का उपयोग कर अनुकूलित: डीएनए किनारा बाँधना और डीएनए किनारा विस्थापन परख17, 18 (चित्रा 1). डीएनए किनारा बाँधना परख में, Rad51 रूपों fluorescein amidite (FAM) के साथ एक presynaptic रेशा-लेबल ssDNA और फिर मुताबिक़ carboxy-x-rhodamine (ROX)-लेबल dsDNA कतरा विनिमय प्रतिक्रिया आरंभ करने के लिए जोड़ा गया है. जब रेशा ROX-लेबल dsDNA को पकड़ता है और तीन-कतरा मध्यवर्ती रूपों, दो fluorophores के करीब निकटता और प्रतिदीप्ति उत्सर्जन में आ FAM ROX (चित्रा 1a) द्वारा बुझती है । डीएनए किनारा विस्थापन परख में, unlabelेड ssDNA पर गठित एक presynaptic रेशा FAM और ROX डबल लेबल dsDNA के साथ मशीन है । जब किनारा विनिमय पूरा हो गया है और FAM लेबल ssDNA तीन से जारी है-किनारा मध्यवर्ती, FAM के उत्सर्जन बढ़ जाती है क्योंकि FAM अब करीब निकटता में ROX (आंकड़ा 1b) के लिए नहीं है । इन परख हमें वास्तविक समय में अंतिम उत्पादों में तीन-कतरा मध्यवर्ती और उनके प्रसंस्करण के गठन का निरीक्षण करने के लिए सक्षम प्रतिक्रिया के लिए किसी भी गड़बड़ी के बिना ।

इस वास्तविक समय अवलोकन प्रणाली का प्रयोग, हमने पाया है कि डीएनए किनारा विनिमय प्रतिक्रिया तीन चरणों में Rad51 आय द्वारा मध्यस्थता की पहली प्रतिक्रिया मध्यवर्ती (C1) के गठन सहित कदम, पहली मध्यवर्ती के एक दूसरे मध्यवर्ती में संक्रमण (c2), और c2 से ssDNA की रिलीज़19. हम यह भी पाया कि विखंडन खमीर (एस pombe) Swi5-Sfr1, जो एक evolutionarily संरक्षित Rad51 गौण प्रोटीन जटिल13,16,20,21,22, उत्तेजित करता है C1-c2 संक्रमण और ssDNA की रिलीज़ C2 से जो एटीपी-hydrolysis पर निर्भर है एक तरीके से Rad5119.

क्या इन निष्कर्षों evolutionarily संरक्षित कर रहे है अज्ञात रहता है । इस प्रोटोकॉल आशा है कि मानव संसाधन के क्षेत्र में शोधकर्ताओं, विशेष रूप से एस pombeके अलावा अन्य जीवों से प्रोटीन के साथ काम करने वालों के साथ प्रदान की जाती है, इन तकनीकों को लागू करने के लिए किस हद तक Rad51 के आणविक तंत्र को निर्धारित कर सकते हैं-संचालित किनारा विनिमय संरक्षित है । इसके अलावा, इन तकनीकों एस pombe Swi5-Sfr1 की भूमिका का निर्धारण करने में अत्यधिक सफल साबित कर दिया है । इस प्रकार, यह एक तर्कसंगत भविष्यवाणी है कि इन तकनीकों अंय मानव संसाधन गौण कारकों की सटीक भूमिकाओं को उजागर करने में अमूल्य होगा ।

Protocol

1. प्रोटीन और डीएनए सब्सट्रेट की तैयारी

  1. शुद्ध एस pombe Rad51 और Swi5-Sfr1 प्रोटीन की एकरूपता के लिए (Coomassie दाग से ंयाय), के रूप में पहले13,21की सूचना दी ।
  2. oligonucleotide डीएनए सब्सट्रेट तालिका 118में सूचीबद्ध तैयार करें ।
    नोट: oligonucleotides खरीदे गए थे ( सामग्री की तालिकादेखें) और HPLC ग्रेड में संश्लेषित । डीएनए किनारा बाँधना रिएक्शन के लिए, oligonucleotides 16FA (-), 16A (-) _40bp और 16AR (+) _40bp की आवश्यकता होती है । डीएनए विस्थापन परख के लिए, oligonucleotides 16A (-), 16FA (-) _40bp और 16AR (+) _40bp (चित्रा 1 और तालिका 1) की आवश्यकता है । इस प्रोटोकॉल में सभी डीएनए सांद्रता न्यूक्लियोटाइड सांद्रता के विरोध के रूप में टुकड़ा सांद्रता को देखें ।
  3. फार्म दाता dsDNA, एनीलिंग बफर (10 मिमी Tris-एचसीएल पीएच ७.५, १०० मिमी NaCl, 10 मिमी MgCl2) के साथ एक पतली दीवारों पीसीआर ट्यूब में पूरक किस्में की equimolar मात्रा में मिश्रण, 20 µ एल से अधिक एक कुल मात्रा सुनिश्चित करने पर एक ठंडा धातु रैक पर इस मिश्रण प्रदर्शन बर्फ (2 डिग्री सेल्सियस और 4 डिग्री सेल्सियस के बीच) ।
    नोट: युग्मन परख के लिए oligonucleotides के संयोजन 16A (-) _40bp और 16AR (+) _40bp हैं । विस्थापन परख के लिए, ऐनी oligonucleotides 16FA (-) _40bp और 16AR (+) _40bp ।
  4. 5 मिनट के लिए ९० ° c पर एनीलिंग मिश्रण को गर्म करें और एक पीसीआर मशीन का उपयोग करके 3 h से 30 डिग्री सेल्सियस पर ठंडा करें । -20 डिग्री सेल्सियस पर annealed डीएनए स्टोर ।

2. डीएनए किनारा बाँधना और विस्थापन परख

  1. डीएनए किनारा बाँधना परख प्रदर्शन.
    1. एक (30 मिमी HEPES-KOH पीएच ७.५, प्रतिक्रिया बफर के १.६ मिलीलीटर तैयार 1 मिमी dithiothreitol [डीटीटी], 15 मिमी MgCl2, ०.२५ मिमी एटीपी, ०.१ मिलीग्राम/एमएल गोजातीय सीरम एल्ब्युमिन [BSA], और ०.००७५% polyoxyethylenesorbitan monolaurate) युक्त ३६ एनएम 16FA (-) एक २.० मिलीलीटर माइक्रो-केंद्रापसारक में प्लास्टिक ट्यूब () और पूर्व यह 5 मिनट के लिए ३७ ° c पर गर्मी ।
    2. Rad51-ssDNA रेशा बनाने के लिए, पूर्व में १.५ µ मीटर की एक अंतिम एकाग्रता के लिए Rad51 प्रोटीन की प्रतिक्रिया बफर जोड़ें और 5 मिनट के लिए ३७ डिग्री सेल्सियस पर यह मशीन ।
    3. ०.१५ µ मीटर के अंतिम एकाग्रता के मिश्रण करने के लिए Swi5-Sfr1 प्रोटीन जोड़ें और एक आगे 5 मिनट के लिए ३७ डिग्री सेल्सियस पर यह मशीन ।
    4. मिश्रण के १.५ मिलीलीटर ले लो और यह एक १.० x १.० सेमी क्वार्ट्ज cuvette एक चुंबकीय सरगर्मी युक्त में स्थानांतरण और एक spectrofluorometer में cuvette सेट । ३७ डिग्री सेल्सियस के लिए spectrophotometer के peltier तापमान नियंत्रक विन्यस्त और इंजेक्शन नमूना का तेजी से मिश्रण को सुनिश्चित करने के लिए ४५० rpm को चुंबकीय सरगर्मी सेट ।
    5. ४९३ एनएम (बैंडविड्थ: 1 एनएम) पर उत्तेजना पर ५२५ एनएम (बैंडविड्थ: 20 एनएम) पर FAM के प्रतिदीप्ति उत्सर्जन को मापने शुरू । हर सेकंड डेटा एकत्र करें ।
    6. १०० एस के लिए माप शुरू करने के बाद, ROX सुई-लेबल दाता dsDNA के मिश्रण में ३६ एनएम के एक अंतिम एकाग्रता के लिए एक सिरिंज का उपयोग और एक और 30 मिनट के लिए 1 s अंतराल पर उत्सर्जन में परिवर्तन को मापने ।
  2. डीएनए किनारा विस्थापन परख प्रदर्शन ।
    1. एक २.० मिलीलीटर माइक्रो-केंद्रापसारक प्लास्टिक ट्यूब और 5 मिनट के लिए ३७ ° c में इसे पूर्व-मशीन में एक युक्त ३६ एनएम 16A (-) की प्रतिक्रिया बफर के १.६ मिलीलीटर तैयार करें ।
    2. ३७ डिग्री सेल्सियस पर Swi5-Sfr1 की उपस्थिति में Rad51-ssDNA रेशा रूप, चरणों में वर्णित के रूप में 2.1.2. और 2.1.3 ।
    3. मिश्रण के १.५ मिलीलीटर ले लो और यह क्वार्ट्ज एक चुंबकीय सरगर्मी युक्त cuvette में स्थानांतरण और spectrophotometer में cuvette सेट, के रूप में कदम 2.1.4 में वर्णित है ।
    4. प्रतिदीप्ति उत्सर्जन को मापने शुरू और १०० एस के बाद, इंजेक्षन FAM-और ROX-लेबल दाता dsDNA चरण 2.1.6 में वर्णित के रूप में । एक और 30 मिनट के लिए 1 s अंतराल पर प्रतिदीप्ति उत्सर्जन में परिवर्तन को मापने ।

3. बाँधना और विस्थापन परख से प्रयोगात्मक डेटा का विश्लेषण

  1. अधिकतम झल्लाहट क्षमता का अनुमान लगाएं ।
    1. 16FA (-) annealed के साथ 16AR (+) _40bp और 16FA (-) _40bp annealed के साथ 16AR (+) _40bp चरण १.३ और १.४ में वर्णित एक ही कार्यविधि का उपयोग कर तैयार करें ।
    2. 16FA (-), 16FA (-) annealed के साथ 16AR (+) _40bp, 16FA (-) _40bp annealed के साथ 16AR (+) _40bp या 16FA (-) _40bp एक ०.२ x १.० सेमी क्वार्ट्ज cuvette में एक युक्त ३६ एनएम की प्रतिक्रिया बफर के १३० μL तैयार करें ।
    3. spectrofluorometer में cuvette सेट और 5 मिनट के लिए ३७ ° c पर मशीन ।
    4. मापने प्रतिदीप्ति स्पेक्ट्रा ५०० से ६०० एनएम पर उत्तेजना पर ४९३ एनएम ।
    5. FAM के उत्सर्जन और ROX द्वारा FAM के शमन पर Rad51 के प्रभाव का परीक्षण करने के लिए, मिश्रण करने के लिए १.५ माइक्रोन की एक अंतिम एकाग्रता के लिए Rad51 जोड़ें और 5 मिनट के लिए ३७ डिग्री सेल्सियस पर मशीन ।
    6. मापने प्रतिदीप्ति स्पेक्ट्रा ५०० से ६०० एनएम पर उत्तेजना पर ४९३ एनएम ।
    7. गणना अधिकतम झल्लाहट दक्षता (ईअधिकतम) नीचे वर्णित समीकरण का उपयोग कर:
      अधिकतम = (दोनों FAM और ROX के साथ लेबल dsDNA के ५२५ एनएम पर प्रतिदीप्ति तीव्रता)/(प्रतिदीप्ति लेबल FAM के ५२५ समुद्री मील की तीव्रता पर)
  2. विस्थापन परख से प्रयोगात्मक डेटा का विश्लेषण ।
    1. प्रतिदीप्ति में परिवर्तन अंतिम उत्पाद की राशि में परिवर्तन करने के लिए विस्थापन परख में परिवर्तित करने के लिए, कच्चे प्रयोगात्मक इस समीकरण का उपयोग कर परख से प्राप्त आंकड़ों को सामांय नीचे, जहां एफकच्चे प्रतिदीप्ति तीव्रता से है रॉ डेटा और एफसामान्यीकृत निंनलिखित समीकरण द्वारा गणना प्रतिदीप्ति में परिवर्तन है ।
      सामान्यीकृत = ([समय x पर एफरॉ ]-[fरॉ समय पर 0])/(([समय पर एफरॉ 0]/Eअधिकतम)-[समय पर एफरॉ 0])
      एफरॉ समय 0 में औसत प्रतिदीप्ति पहले 5 एस के लिए मृत समय के बाद निगरानी की है (यानी, एक इंजेक्शन के बाद मिश्रण के लिए आवश्यक समय cuvette में पेश किया है) ।
    2. photobleaching और सहज विस्थापन के प्रभाव को बाहर करने के लिए, एफ के नमूने केसामान्यीकृत से प्रोटीन के बिनासामान्यीकृत fडी, जो इस परख में अंतिम उत्पाद की मात्रा में परिवर्तन है प्राप्त करने के लिए ।
      fD = [fnormaled of sample]-[fसामान्यीकृत प्रोटीन के बिना]
  3. युग्मन परख से प्रयोगात्मक डेटा का विश्लेषण ।
    1. सामांय प्रयोगात्मक बांधना परख से प्राप्त के समीकरण का उपयोग कर नीचे वर्णित है, जहां एफरॉ कच्चे डेटा और एफसामान्यीकृत से प्रतिदीप्ति तीव्रता है मानक प्रतिदीप्ति में परिवर्तन निंनलिखित समीकरण द्वारा गणना की है ।
      सामान्यीकृत = (समय x पर fरॉ )/(0 समय पर एफरॉ )
      एफ 0 समय पररॉ औसत प्रतिदीप्ति पिछले 20 एस के लिए निगरानी dsDNA सब्सट्रेट इंजेक्शन द्वारा प्रतिक्रिया आरंभ करने से पहले है ।
    2. परिवर्तन में प्रतिदीप्ति में परिवर्तन सब्सट्रेट की राशि में परिवर्तित करने के लिए और photobleaching और सहज बाँधना के प्रभाव को बाहर करने के लिए, मानक के अनुसार नमूना का उपयोग करने के लिए नीचे वर्णित समीकरण, जहां एफपी की राशि में परिवर्तन है इस परख में सब्सट्रेट ।
      fP = 1-(([fसामान्यीकृत प्रोटीन के बिना]-[नमूना के fसामान्यीकृत ])/[1-Eअधिकतम])
    3. डीएनए कतरा एक्सचेंज की प्रतिक्रिया कैनेटीक्स की जांच करने के लिए, गैर रेखीय अंतिम-वर्ग प्रतिगमन विश्लेषण युग्मन प्रतिक्रिया का उपयोग कर विश्लेषण कार्यक्रम23 (देखें सामग्री की तालिका) ।
      1. . txt स्वरूप में एक फ़ाइल तैयार करें जिसमें FPका समय पाठ्यक्रम डेटा हो.
      2. प्रोग्राम प्रारंभ करें और पूरक कोड फ़ाइल में स्क्रिप्ट प्रोग्राम की एक विंडो में चिपकाएँ:
      3. गैर-रेखीय अंतिम-वर्ग प्रतीपगमन विश्लेषण प्रारंभ करें । इस विश्लेषण के परिणाम उसी विंडो में प्रदर्शित किए जाएंगे ।

Representative Results

आदेश में प्रभावी ढंग से बाँधना और विस्थापन परख से प्रयोगात्मक डेटा का विश्लेषण करने के लिए, यह परिभाषित करने के लिए कैसे FAM के प्रतिदीप्ति उत्सर्जन में एक परिवर्तन के उत्पादों में डीएनए सब्सट्रेट का रूपांतरण करने के लिए संगत आवश्यक है । इस लक्ष्य को प्राप्त करने के लिए, प्रतिदीप्ति तीव्रता के प्रासंगिक रेंज निर्धारित किया जाना चाहिए । बाँधना परख के लिए, 16FA के प्रतिदीप्ति उत्सर्जन (-), जो ssDNA सब्सट्रेट करने के लिए मेल खाती है, 16FA के उत्सर्जन के साथ तुलना में है (-) annealed 16AR के साथ (+) _40bp, जो इस प्रतिक्रिया के अंतिम उत्पादों से मेल खाती है (चित्रा 2a). यह अधिकतम झल्लाहट दक्षता और इसलिए प्रतिदीप्ति तीव्रता में अधिकतम कमी है कि अगर सभी ssDNA सब्सट्रेट dsDNA उत्पाद में परिवर्तित किया गया था की उंमीद होगी समानताएं । विस्थापन परख के लिए, 16FA के उत्सर्जन (-) 16AR के साथ _40bp annealed (+) _40bp, जो सब्सट्रेट से मेल खाती है, 16FA के उत्सर्जन के साथ तुलना में है (-) _40bp, जो अंतिम उत्पाद (चित्रा बी) से मेल खाती है । इस मामले में, FAM के प्रतिदीप्ति तीव्रता में अधिकतम वृद्धि एक परिदृश्य है जिसमें dsDNA सब्सट्रेट के सभी ssDNA उत्पाद में बदल दिया है । एस pombe Rad51 दोनों परख (चित्रा 2) में FAM द्वारा FAM या ROX की शमन क्षमता के प्रतिदीप्ति उत्सर्जन को प्रभावित नहीं किया । यह oligonucleotides की लेबलिंग दक्षता पर निर्भर है के रूप में अधिकतम झल्लाहट दक्षता oligonucleotides की प्रत्येक नई तैयारी के साथ फिर से मापा जाना चाहिए.

डीएनए किनारा बाँधना और विस्थापन प्रतिक्रियाओं के प्रतिनिधि डेटा चित्रा 3में दिखाया गया है । सब्सट्रेट DNAs और photobleaching के बीच सहज प्रतिक्रियाओं के प्रभाव दोनों परख में छोटे थे, के रूप में नगण्य Rad51 के बिना FAM के उत्सर्जन में देखा Rad51 के साथ देखा पर्याप्त परिवर्तन की तुलना में परिवर्तन से पता चला (3 ए आंकड़ा और चित्र बी) । चित्रा 3 ए या चित्रा बीमें दिखाए गए आंकड़ों के आधार पर, प्रतिदीप्ति में परिवर्तन सब्सट्रेट (एफपी) या अंतिम उत्पाद (एफडी) की मात्रा में परिवर्तन में परिवर्तित किया गया था, क्रमशः, चरणों में वर्णित समीकरणों का उपयोग कर 3.2.2 या 3.3.2 ( चित्र 3 सी और चित्रा 3d) ।

बाँधना प्रतिक्रिया एक अनुक्रमिक तीन कदम प्रतिक्रिया मॉडल का उपयोग कर, पहले तीन-किनारा मध्यवर्ती (c1), पहले मध्यवर्ती के दूसरे मध्यवर्ती (c1-C2), और ssDNA की रिहाई में संक्रमण के गठन से मिलकर अनुकरण किया गया था दूसरा मध्यवर्ती से दो उत्पादों (डी + ई) (चित्रा 3E) के रूप में । परीक्षण करने के लिए कि क्या अनुकरण एक अनुक्रमिक तीन कदम प्रतिक्रिया मॉडल का उपयोग प्रयोगात्मक डेटा फिट, डीएनए किनारा बाँधना परख और एक सैद्धांतिक अनुकरण द्वारा प्राप्त वक्र के प्रयोगात्मक डेटा के बीच अवशिष्ट गणना (चित्रा 3F) थे । इसके अलावा, युग्मन प्रतिक्रिया और एक सैद्धांतिक एक अनुक्रमिक दो कदम प्रतिक्रिया मॉडल का उपयोग कर उत्पंन वक्र के बीच अवशिष्ट भी गणना की गई (आंकड़ा 3 जी) । युग्मन प्रतिक्रिया के लिए अवशिष्ट और दो-चरणीय मॉडल प्रारंभिक चरण में व्यवस्थित विचलन दिखाते हैं, जबकि युग्मन प्रतिक्रिया के लिए अवशिष्ट और तीन-चरणीय मॉडल ऐसे विचलन नहीं दिखाते हैं. यह इंगित करता है कि तीन-चरणीय मॉडल युग्मन प्रतिक्रिया का अनुकरण करने के लिए दो-चरणीय मॉडल की तुलना में बेहतर फ़िट है.

परीक्षण करने के लिए कि तीन कदम मॉडल विस्थापन प्रतिक्रिया है कि डीएनए किनारा विनिमय के देर से कदम का पता लगाता है के साथ संगत है, हम विस्थापन के अनुकरण से प्राप्त काइनेटिक मापदंडों का उपयोग कर विस्थापित प्रतिक्रिया का एक सैद्धांतिक वक्र उत्पन्न चित्र 3 सी में दिखाया गया है और यह चित्रा 3d (चित्रा 3H) में दिखाया गया विस्थापन प्रतिक्रिया के प्रायोगिक डेटा के साथ तुलना में । सैद्धांतिक वक्र विस्थापन परख के प्रयोगात्मक डेटा फिट । इन परिणामों से, हम निष्कर्ष निकालना है कि तीन कदम मॉडल का उपयोग करने के लिए यथोचित डीएनए कतरा विनिमय Rad51 द्वारा मध्यस्थता प्रतिक्रिया का मूल्यांकन करने में सक्षम है ।

डीएनए किनारा Rad51 और Swi5-Sfr1 परिसर, Rad51 के एक पहुंच प्रोटीन युक्त प्रतिक्रिया युग्मन के प्रतिनिधि डेटा, चित्रा 4aमें दिखाए जाते हैं । Swi5-Sfr1 परिसर दृढ़ता से Rad51 के बाँधना गतिविधि उत्तेजित । के रूप में Swi5-Sfr1 के अभाव में देखा गया था, बाँधना प्रतिक्रिया बेहतर Swi5-Sfr1 (चित्रा 4B) की उपस्थिति में दो कदम मॉडल की तुलना में तीन कदम मॉडल फिट. तीन कदम मॉडल का उपयोग प्रतिक्रिया के अनुकरण के माध्यम से, प्रत्येक प्रतिक्रिया कदम के साथ या बिना Swi5-Sfr1 की प्रतिक्रिया संतुलन स्थिरांकों की गणना की गई. प्रतिक्रिया संतुलन लगातार संकेत दिया है कि Swi5-Sfr1 परिसर पहली प्रतिक्रिया कदम उत्तेजित नहीं करता है (आंकड़ा 4c, पैनल ए), जिसमें एक तीन-किनारा मध्यवर्ती का गठन किया है, लेकिन दृढ़ता से c1-C2 संक्रमण को उत्तेजित ( चित्र 4c, पेनल b) और C2 मध्यवर्ती (आरेख 4c, पेनल c) से ssDNA की रिलीज़ ।

Figure 1
चित्रा 1: डीएनए किनारा बाँधना और विस्थापन परख के प्रायोगिक डिजाइन । डीएनए किनारा बाँधना () और विस्थापन की योजनाबद्धता () परख. पीले घेरे Rad51 मोनोमर प्रतिनिधित्व करते हैं । "F" वाले हरे वृत्त और "R" वाले लाल वृत क्रमशः fluorescein amidite (FAM) और carboxy-X-rhodamine (ROX) का प्रतिनिधित्व करते हैं । काले डीएनए किस्में अनुक्रम में समान है और नीले डीएनए किस्में के पूरक हैं । ऐरोहेड के साथ पतली काली रेखाएं प्रत्येक oligonucleotide के नाम को इंगित करती हैं, जैसा तालिका 1में दर्शाया गया है । यह आंकड़ा इतो एट अल से अनुकूलित किया गया है । 19 और संशोधित । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: बाँधना और विस्थापन परख की अधिकतम झल्लाहट दक्षता की माप. (एक) ssDNA सब्सट्रेट, 16FA के बीच प्रतिदीप्ति स्पेक्ट्रा की तुलना (-), और dsDNA उत्पाद, 16FA (-) 16AR के साथ जोड़ा (+) _40bp, बाँधना परख के. नीले और लाल लाइनों के बिना और Rad51 के साथ, क्रमशः सब्सट्रेट के प्रतिदीप्ति स्पेक्ट्रा प्रतिनिधित्व करते हैं । हरे और बैंगनी लाइनों प्रतिदीप्ति स्पेक्ट्रा अंतिम उत्पाद के बिना और Rad51 के साथ क्रमशः दिखा । () dsDNA सब्सट्रेट, 16FA के बीच प्रतिदीप्ति स्पेक्ट्रा की तुलना (-) 16AR के साथ युग्मित _40bp (+) _40bp, और ssDNA उत्पाद, विस्थापन परख के 16FA (-) _40bp,. नीले और लाल लाइनों के बिना और Rad51 के साथ, क्रमशः अंतिम उत्पाद के प्रतिदीप्ति स्पेक्ट्रा प्रतिनिधित्व करते हैं । हरे और बैंगनी लाइनों के बिना और Rad51 के साथ, क्रमशः सब्सट्रेट के प्रतिदीप्ति स्पेक्ट्रा दिखाते हैं । यह आंकड़ा इतो एट अल से अनुकूलित है । 19 और संशोधित । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3: डीएनए किनारा बाँधना और विस्थापन प्रतिक्रियाओं Rad51 द्वारा मध्यस्थता. (A) Rad51 के साथ या उसके बिना युग्मन प्रतिक्रिया के सामान्यीकृत प्रतिदीप्ति का समय पाठ्यक्रम. () Rad51 के साथ या उसके बिना विस्थापन प्रतिक्रिया के सामान्यीकृत प्रतिदीप्ति का समय पाठ्यक्रम. () Rad51 के साथ बाँधना प्रतिक्रिया में सब्सट्रेट की राशि में परिवर्तन के समय पाठ्यक्रम. () Rad51 के साथ विस्थापन प्रतिक्रिया में सब्सट्रेट की राशि में परिवर्तन का समय पाठ्यक्रम. () अनुक्रमिक तीन कदम प्रतिक्रिया मॉडल की एक योजनाबद्ध । A और B के अनुरूप presynaptic रेशा और दाता dsDNA । C1 पहले से मेल खाती है (अपरिपक्व) तीन-किनारा मध्यवर्ती. C2 से मेल खाती है दूसरी (परिपक्व) तीन-किनारा मध्यवर्ती. डी और ई एक heteroduplex और C2 से जारी ssDNA के अनुरूप है । (एफ और जी) डीएनए किनारा बांधने की परख और एक सैद्धांतिक वक्र या तो तीन कदम (F) या दो कदम (जी) मॉडल का उपयोग करके प्राप्त की प्रयोगात्मक डेटा के बीच अवशिष्ट । () लाल डॉट्स पैनल D. Blue रेखा में दिखाया Rad51 के साथ विस्थापन प्रतिक्रिया से प्रयोगात्मक डेटा का संकेत अंतिम उत्पादों की सैद्धांतिक वक्र इंगित करता है । सैद्धांतिक वक्र प्रतिक्रिया दर लगातार पैनल सीमें दिखाया गया है परख बाँधना से प्राप्त का उपयोग सिमुलेशन द्वारा उत्पंन किया गया था । यह आंकड़ा इतो एट अल से अनुकूलित है । 19 और संशोधित । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्रा 4: Swi5-Sfr1 डीएनए किनारा विनिमय प्रतिक्रिया के दूसरे और तीसरे कदम को उत्तेजित करता है । (एक) Swi5-Sfr1 (S5S1) के साथ या बिना बाँधना प्रतिक्रिया में सब्सट्रेट की राशि में परिवर्तन का समय पाठ्यक्रम. () डीएनए किनारा Swi5-Sfr1 और एक सैद्धांतिक दो कदम (नीली रेखा) या तीन कदम (लाल रेखा) मॉडल का उपयोग सिमुलेशन द्वारा प्राप्त की वक्र के साथ परख युग्मन के प्रयोगात्मक डेटा के बीच अवशिष्ट । () चित्रा 4a में दिखाया बाँधना प्रतिक्रिया तीन कदम विश्लेषण कार्यक्रम23 का उपयोग कर मॉडल द्वारा नकली था ( सामग्री की तालिकादेखें). प्रत्येक प्रतिक्रिया चरण की प्रतिक्रिया संतुलन स्थिरांक, K1 (a), K2 (b), और K3 (c), अनुकरण से प्राप्त किए गए थे । यह आंकड़ा इतो एट अल से अनुकूलित है । 19 और संशोधित । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

डीएनए किनारा बाँधना परख के लिए Oligonucleotides
16FA (-) 5 '-[FAM]-AAATGAACATAAAGTAAATAAGTATAAGGATAATACA
AAATAAGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT एएए-3 '
16A (-) _40bp 5 '-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3 '
16AR (+) _40bp 5 '-TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX]-3 '
डीएनए किनारा विस्थापन परख के लिए Oligonucleotides
16A (-) 5 '-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAATA
AGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT एएए-3 '
16FA (-) _40bp 5 '-[FAM]-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3 '
16AR (+) _40bp 5 '-TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX]-3 '

तालिका 1: डीएनए किनारा बाँधना और विस्थापन परख में इस्तेमाल oligonucleotides की एक सूची. जहां लागू हो, fluorophores (fluorescein amidite, FAM; carboxy-x-rhodamine, ROX) की स्थितियां वर्गाकार लघुकोष्ठकों में दर्शाई गई हैं ।

Discussion

यहाँ, हम वास्तविक समय में Rad51 संचालित डीएनए कतरा विनिमय को मापने के लिए झल्लाहट का उपयोग करता है कि एक विस्तृत प्रोटोकॉल का वर्णन किया है. महत्वपूर्ण बात, इन माप प्रतिक्रिया कैनेटीक्स के निर्धारण के लिए अनुमति देते हैं । जबकि ऊपर दिए गए विवरण हमारे प्रकाशित परिणामों को पुन: उत्पंन करने के लिए पर्याप्त हैं, वहां कई महत्वपूर्ण बताते है कि इस खंड में वर्णित किया जाएगा रहे हैं । इसके अलावा, लाभ और झल्लाहट के नुकसान-डीएनए किनारा विनिमय के अध्ययन के लिए आधारित तरीकों पर चर्चा की जाएगी, इस तरह की तकनीक के आवेदन के साथ साथ डीएनए चयापचय के अंय पहलुओं का अध्ययन ।

सभी जैव रासायनिक पुनर्गठन के साथ के रूप में, सुनिश्चित करना है कि सभी प्रतिक्रिया सब्सट्रेट उच्च शुद्धता के हैं आवश्यक है । यह लापरवाही है एक प्रोटीन Coomassie धुंधला द्वारा ंयाय की तैयारी की स्पष्ट शुद्धता पर आधारित प्रदूषित गतिविधियों के अभाव ग्रहण । विशेष रूप से, nucleases या helicases की मात्रा का पता लगाने की उपस्थिति काफी बाँधना और विस्थापन परख के परिणामों को प्रभावित कर सकते हैं । इस प्रकार, हम दृढ़ता से इस तरह की गतिविधियों के लिए हर बार प्रोटीन का एक नया बैच शुद्ध है परीक्षण प्रोत्साहित करते हैं । इसके अलावा, यह देशी polyacrylamide जेल ट्रो द्वारा संश्लेषित डीएनए सब्सट्रेट की शुद्धता की जांच करने के लिए विवेकपूर्ण है । कई कंपनियों oligonucleotides की शुद्धता की गारंटी के बावजूद, हम अक्सर हमारे अपने परीक्षण के माध्यम से पाया है कि संश्लेषित डीएनए की शुद्धता बैचों के बीच भिंन हो सकते हैं ।

यह महत्वपूर्ण है कि निंनलिखित दो बिंदुओं पर विचार जब क्वार्ट्ज cuvettes के साथ प्रयोगों का आयोजन । सबसे पहले, कुछ प्रोटीन से बाइंड क्वार्ट्ज cuvettes का खतरा है । इस काउंटर करने के लिए, BSA और polyoxyethylenesorbitan monolaurate प्रतिक्रिया बफ़र्स में शामिल हैं । दूसरे, तापमान प्रतिक्रिया की गति और प्रतिदीप्ति तीव्रता पर एक कठोर प्रभाव पड़ता है । इस प्रभाव को कम करने के लिए, क्वार्ट्ज cuvette का उपयोग करने से पहले ३७ ° c पर पूर्व-मशीन होना चाहिए ।

हालांकि पारंपरिक जैव रासायनिक परख है डीएनए कतरा विनिमय अध्ययन में बेहद उपयोगी है, वे कई कमियां है । एक ठेठ समय पाठ्यक्रम प्रयोग में, एक प्रतिक्रिया एक निश्चित तापमान पर मशीन है और aliquots वांछित timepoints पर वापस ले लिया और डिटर्जेंट और प्रतिक्रिया समाप्त करने के लिए चिढ़ाने के साथ उपचार द्वारा किया जाता है । समय-पाठ्यक्रम के पूरा होने पर, नमूने तो उत्पादों से डीएनए सब्सट्रेट अलग करने के लिए ट्रो के अधीन हैं. यहां वर्णित विधि का प्रमुख लाभ यह है कि यह बिना किसी गड़बड़ी के प्रतिक्रिया के वास्तविक समय अवलोकन के लिए अनुमति देता है । प्रतिक्रिया के दौरान किसी भी timepoint प्रतिक्रिया ही व्यवधान के बिना निरीक्षण किया जा सकता है और कोई नमूने deproteinize या उंहें ट्रो की संभावित विघटनकारी बलों के अधीन करने की आवश्यकता है । यह विशेष रूप से प्रासंगिक है जब निगरानी labile डीएनए संरचनाओं ।

पारंपरिक परख पर इन शक्तियों के बावजूद, विधि यहां वर्णित कुछ नुकसान है । जबकि कतरा विनिमय के लिए oligonucleotide डीएनए सब्सट्रेट के उपयोग के परिणामों की व्याख्या को सरल करता है, यह याद रखना महत्वपूर्ण है कि ऐसे सब्सट्रेट डीएनए में कोशिका में शामिल मानव संसाधन के समान नहीं है । कुछ पारंपरिक परख प्लाज्मिड का उपयोग डीएनए सब्सट्रेट, जो और अधिक आधार की संख्या को प्रतिबिंबित करने की संभावना है आकार-जोड़े कि vivo मेंविमर्श कर रहे हैं । इसके अलावा, पारंपरिक परख के एक सबसेट में topologically के लिए विवश परिपत्र dsDNA सब्सट्रेट का उपयोग कर सकते है कम से आंशिक शारीरिक डीएनए में तनाव विश्राम ।

विधि के आवेदन यहां वर्णित Rad51 के आणविक तंत्र-डीएनए किनारा विनिमय संचालित सुलझाना शुरू कर दिया है । इसके बावजूद, कई दिलचस्प सवाल है कि रहने के लिए जवाब दिया जाता है । वहां स्पष्ट सबूत है कि अर्धसूत्रीविभाजन के दौरान मानव संसाधन दोनों Rad51 और Dmc1, RecA24में अर्धसूत्रीविभाजन-विशिष्ट recombinase प्रकार eukaryotes की आवश्यकता है । हालांकि, इन दो recombinases के बीच प्रमुख जैव रासायनिक मतभेदों की कमी के क्षेत्र में वर्षों के लिए शोधकर्ताओं चकित है । इसके अलावा, संयोजन गौण कारकों के कई अलग समूहों की भूमिका मानव संसाधन के क्षेत्र में एक अनुसंधान का केंद्र विषय रहा है । Rad51 और Dmc1 के बीच जैव रासायनिक मतभेदों को elucidating के अलावा, हम तत्काल भविष्य में डीएनए किनारा विनिमय के कैनेटीक्स पर अलग पुनर्संयोजन गौण कारकों के प्रभाव की जांच और तुलना करने का लक्ष्य है । अंत में, यह तनाव महत्वपूर्ण है कि झल्लाहट आधारित पद्धति यहां वर्णित डीएनए कतरा विनिमय के अध्ययन तक ही सीमित नहीं है । अपेक्षाकृत मामूली संशोधनों के साथ, हम कार्यात्मक विविध डीएनए चयापचय25,26,27,28में शामिल प्रोटीन की जांच में इस तकनीक के लिए आवेदनों के कई प्रकार कल्पना । हमें उंमीद है कि यहां वर्णित घटनाओं के कई विभिंन विषयों से संबंधित शोधकर्ताओं को और अधिक विकल्प प्रदान करेगा ।

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

यह काम अनुदान के द्वारा वित्त पोषित किया गया था वैज्ञानिक अनुसंधान के लिए सहायता (क) (18H03985) और अभिनव क्षेत्रों पर (15H05974) के लिए हाय, युवा वैज्ञानिकों (बी) (17K15061) के लिए बीए, और वैज्ञानिक अनुसंधान (बी) (18H02371) के लिए जापान सोसायटी से एचटी को विज्ञान के संवर्धन के लिए ( JSPS) ।

Materials

Name Company Catalog Number Comments
0.2 x 1.0 cm quartz cuvette Hellma Analytics 105-250-15-40
1.0 x 1.0 cm quartz cuvette Hellma Analytics 101-10-40
adenosine triphosphate (ATP) Sigma A2383
DynaFit BioKin, Ldt. DynaFit is a program to analyze kinetics of biochemical reactions.
Fluorescent labeled and non-labeled oligonucleotides Eurofins Genomics The sequences of oligos are listed in Table. 1.
Magnetic stirrer Aisis (Japan) CM1609
PCR machine TAKARA (Japan) TP600 TAKARA PCR Thermal Cycler Dice
Spectrofluorometer JASCO FP8300 Contains a peltier temperature controller and magnetic stirrer system
Syringe HAMILTON 1702RN 25ul SYR (22s/2"/2)

DOWNLOAD MATERIALS LIST

References

  1. Camerini-Otero, R. D., Hsieh, P. Homologous recombination proteins in prokaryotes and eukaryotes. Annual Review of Genetics. 29, (1), 509-552 (1995).
  2. Cromie, G. A., Connelly, J. C., Leach, D. R. Recombination at double-strand breaks and DNA ends: conserved mechanisms from phage to humans. Molecular Cell. 8, (6), 1163-1174 (2001).
  3. Pierce, A. J., et al. Double-strand breaks and tumorigenesis. Trends in cell biology. 11, (11), S52-S59 (2001).
  4. Haber, J. E. Genome Stability. Garland Science. (2013).
  5. Kowalczykowski, S. C. An Overview of the Molecular Mechanisms of Recombinational DNA Repair. Cold Spring Harbor perspectives in biology. 7, (11), a016410 (2015).
  6. Bianco, P. R., Tracy, R. B., Kowalczykowski, S. C. DNA strand exchange proteins: a biochemical and physical comparison. Frontiers in bioscience: a journal and virtual library. 3, D570-D603 (1998).
  7. Renkawitz, J., Lademann, C. A., Jentsch, S. Mechanisms and principles of homology search during recombination. Nature Reviews Molecular Cell Biology. 15, (6), 369-383 (2014).
  8. Greene, E. C. DNA Sequence Alignment during Homologous Recombination. The Journal of biological chemistry. 291, (22), 11572-11580 (2016).
  9. Sung, P., Krejci, L., Van Komen, S., Sehorn, M. G. Rad51 recombinase and recombination mediators. Journal of Biological Chemistry. 278, (44), 42729-42732 (2003).
  10. Prakash, R., Zhang, Y., Feng, W., Jasin, M. Homologous recombination and human health: the roles of BRCA1, BRCA2, and associated proteins. Cold Spring Harbor perspectives in biology. 7, (4), a016600 (2015).
  11. Sung, P. Function of yeast Rad52 protein as a mediator between replication protein A and the Rad51 recombinase. Journal of Biological Chemistry. 272, (45), 28194-28197 (1997).
  12. Sung, P. Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase. Genes & Development. 11, (9), 1111-1121 (1997).
  13. Kurokawa, Y., Murayama, Y., Haruta-Takahashi, N., Urabe, I., Iwasaki, H. Reconstitution of DNA strand exchange mediated by Rhp51 recombinase and two mediators. PLoS biology. 6, (4), e88 (2008).
  14. Jensen, R. B., Carreira, A., Kowalczykowski, S. C. Purified human BRCA2 stimulates RAD51-mediated recombination. Nature. 467, (7316), 678-683 (2010).
  15. Liu, J., et al. Rad51 paralogues Rad55-Rad57 balance the antirecombinase Srs2 in Rad51 filament formation. Nature. 479, (7372), 245-248 (2011).
  16. Lu, C. -H., et al. Swi5-Sfr1 stimulates Rad51 recombinase filament assembly by modulating Rad51 dissociation. Proceedings of the National Academy of Sciences of the United States of America. (2018).
  17. Bazemore, L. R., Takahashi, M., Radding, C. M. Kinetic analysis of pairing and strand exchange catalyzed by RecA. Detection by fluorescence energy transfer. Journal of Biological Chemistry. 272, (23), 14672-14682 (1997).
  18. Gupta, R. C., Bazemore, L. R., Golub, E. I., Radding, C. M. Activities of human recombination protein Rad51. Proceedings of the National Academy of Sciences. 94, (2), 463-468 (1997).
  19. Ito, K., Murayama, Y., Takahashi, M., Iwasaki, H. Two three-strand intermediates are processed during Rad51-driven DNA strand exchange. Nature Structural & Molecular Biology. 25, (1), 29-36 (2018).
  20. Akamatsu, Y., Dziadkowiec, D., Ikeguchi, M., Shinagawa, H., Iwasaki, H. Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proceedings of the National Academy of Sciences. 100, (26), 15770-15775 (2003).
  21. Haruta, N., et al. The Swi5-Sfr1 complex stimulates Rhp51/Rad51- and Dmc1-mediated DNA strand exchange in vitro. Nature Structural & Molecular Biology. 13, (9), 823-830 (2006).
  22. Argunhan, B., Murayama, Y., Iwasaki, H. The differentiated and conserved roles of Swi5-Sfr1 in homologous recombination. FEBS Letters. 591, (14), 2035-2047 (2017).
  23. Kuzmic, P. Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase. Analytical biochemistry. 237, (2), 260-273 (1996).
  24. Brown, M. S., Bishop, D. K. DNA strand exchange and RecA homologs in meiosis. Cold Spring Harbor perspectives in biology. 7, (1), a016659 (2014).
  25. Rudert, W. A., et al. Double-labeled fluorescent probes for 5' nuclease assays: purification and performance evaluation. BioTechniques. 22, (6), 1140-1145 (1997).
  26. Xiao, J., Singleton, S. F. Elucidating a key intermediate in homologous DNA strand exchange: structural characterization of the RecA-triple-stranded DNA complex using fluorescence resonance energy transfer. Journal of Molecular Biology. 320, (3), 529-558 (2002).
  27. Grimme, J. M., et al. Human Rad52 binds and wraps single-stranded DNA and mediates annealing via two hRad52-ssDNA complexes. Nucleic Acids Research. 38, (9), 2917-2930 (2010).
  28. Algasaier, S. I., et al. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction. The Journal of biological chemistry. 291, (15), 8258-8268 (2016).
डीएनए किनारा विनिमय प्रतिक्रिया की वास्तविक समय अवलोकन Rad51 द्वारा मध्यस्थता
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).More

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter