Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biochemistry

Observation en temps réel de la réaction d’échange de brin ADN médiée par Rad51

doi: 10.3791/59073 Published: February 13, 2019

Summary

Fluorescence par résonance énergétique axée sur le transfert en temps réel observation systems de l’ADN brin réaction d’échange médiée par Rad51 ont été développés. En utilisant les protocoles présentés ici, nous sommes en mesure de détecter la formation des intermédiaires réactionnels et leur transformation en produits, tout en également analyser la cinétique enzymatique de la réaction.

Abstract

La réaction d’échange de brin ADN médiée par Rad51 est une étape cruciale de la recombinaison homologue. Dans cette réaction, Rad51 forme un filament de nucléoprotéine sur ADN simple brin (ssDNA) et capture l’ADN à double brin (dsDNA) non spécifiquement pour interroger pour une séquence homologue. Après avoir rencontré une homologie, Rad51 catalyse échange brin ADN pour atténuer l’appariement avec le brin complémentaire de l’ADN double brin de l’ADN simple brin. Cette réaction est fortement réglementée par nombreuses protéines accessary in vivo. Bien que des épreuves biochimiques conventionnels ont été avec succès employés pour examiner le rôle de cette protéine accessoire in vitro, analyse de la cinétique de formation intermédiaire et sa progression dans un produit final s’est avérée difficile due à la intermédiaires de nature instable et transitoire de la réaction. D’observer ces étapes réactionnelles directement dans la solution, transfert d’énergie de fluorescence par résonance (FRET)-observation en temps réel de systèmes de cette réaction ont été mis en place. L’analyse cinétique des observations en temps réel montre que la réaction d’échange de brin ADN médiée par Rad51 obéit à un modèle de triple réaction impliquant la formation d’un intermédiaire trois brins de l’ADN, la maturation de cet intermédiaire et la libération d’ADN simple brin de l’intermédiaire mature. Le complexe Swi5-1 francs suisses, une protéine accessary conservée chez les eucaryotes, améliore fortement les deuxième et troisième étapes de cette réaction. Les frette-analyses présentés ici permettent de découvrir les mécanismes moléculaires par lequel recombinaison accessary protéines stimulent l’activité d’échange brin ADN de Rad51. Le principal objectif du présent protocole est de renforcer le répertoire des techniques disponibles aux chercheurs dans le domaine de la recombinaison homologue, particulièrement ceux qui travaillent avec des protéines d’espèces autres que les Schizosaccharomyces pombe, afin que le conservation évolutive des conclusions présentées ici peut être déterminée.

Introduction

Recombinaison homologue (HR) facilite le brassage de l’information génétique entre deux molécules d’ADN différents. Ressources humaines est essentiel pour deux phénomènes biologiques fondamentaux : la génération de la diversité génétique au cours de la gamétogenèse1 ainsi que la réparation de l’ADN double-brin tombe (CDB)2 au cours de la mitose. CDB est la forme la plus grave de dommages à l’ADN et constitue une rupture dans le chromosome. Une réparation incorrecte des CDB peut causer des réarrangements chromosomiques et instabilité génomique, qui sont les deux caractéristiques de cancer3.

La réaction d’échange de brin ADN est la phase centrale des ressources humaines. La protéine Rad51, qui est membre de la famille de RecA type hautement conservée de recombinases, est la protéine clé qui catalyse cette réaction dans eukaryotes4,5. Dans cette réaction, Rad51 se lie à l’ADN simple brin (ssDNA) généré par nucléolytiques traitement de la fin de l’ORD et formes une nucléoprotéine hélicoïdale complexe appelé le filament présynaptique. Ce filament contracte intacte ADN à double brin (dsDNA) non spécifique pour rechercher une séquence homologue. Quand le filament trouve une séquence homologue, une réaction intermédiaire contenant trois brins ADN est formée et le filament de Rad51 Médie brin échange au sein de cette structure6,7,8. Pour accomplir efficacement cette réaction, Rad51 nécessite plusieurs types de protéines accessoires tels que les gènes BRCA1 et BRCA2, produits de breast cancer susceptibility gènes9,10.

Comprendre comment les facteurs accessoires réglementent Rad51 est une étape intégrale en découvrant les causes de l’instabilité génomique au cours de la tumorigenèse. Bien que beaucoup de recherche est centré sur les effets de ces facteurs sur la formation des filaments présynaptique et stabilité11,12,13,14,15,16, la contribution de ces facteurs de formation de l’intermédiaire de trois brins et sa transformation en produit final est encore incertaine. Observer ces étapes réactionnelles grâce à des expériences biochimiques conventionnels est très difficile parce que l’intermédiaire de trois brins est instable et sujette à s’effondrer par des manipulations expérimentales courantes comme la déprotéinisation des échantillons ou électrophorèse.

Pour contourner ce problème, nous avons adapté les deux systèmes d’observation en temps réel développé antérieurement de la réaction d’échange de brin ADN à l’aide de transfert d’énergie de fluorescence par résonance (FRET) : l’ADN brin appariement et ADN chapelet déplacement dosages17, 18 (figure 1). Dans le brin d’ADN appariement dosage, Rad51 formes un filament présynaptique à la fluorescéine amidite (FAM) - nommé ADN simple brin et puis homologue carboxy-x-rhodamine (ROX) - étiqueté dsDNA est ajouté pour initier la réaction d’échange de brin. Quand le filament intercepte le dsDNA ROX-étiquetés et forme l’intermédiaire de trois brins, les deux fluorophores entrent en proximité et émission de fluorescence de FAM est piégée par ROX (Figure 1 a). Dans l’essai de déplacement DNA strand, un filament présynaptique formé sur non-marqué ssDNA est incubé avec FAM et ROX dsDNA marqués au double. Lorsque brin exchange est terminée et le FAM étiqueté ssDNA est libéré par les trois brins intermédiaire, l’émission de FAM augmente car FAM n’est plus à proximité de ROX (Figure 1 b). Ces tests permettent d’observer la formation d’intermédiaires de trois brins et leur transformation en produits finis en temps réel sans aucune perturbation à la réaction.

Grâce à ce système d’observation en temps réel, nous avons constaté que la réaction d’échange de brin ADN médiée par Rad51 procède en trois étapes-y compris la formation de la première réaction intermédiaire (C1), transitioning de premier intermédiaire dans un deuxième intermédiaire (C2) et la libération de l’ADN simple brin du C219. Nous avons également constaté que la levure fission (S. pombe) Swi5-1 francs suisses, qui est un évolutivement conservés Rad51 protéine complexe13,16,20,21,22, stimule la transition de C1-C2 et libération d’ADN simple brin par C2 d’une manière qui est tributaire de l’hydrolyse de l’ATP par Rad5119.

Si ces résultats sont évolutivement conservés reste inconnu. Ce protocole est fourni avec l’espoir que les chercheurs dans le domaine des ressources humaines, en particulier ceux qui travaillent avec des protéines provenant d’organismes autres que S. pombe, peuvent appliquer ces techniques pour déterminer la mesure dans laquelle le mécanisme moléculaire axée sur la Rad51 échange de brin est conservée. En outre, ces techniques ont prouvé très efficace pour déterminer le rôle de S. pombe Swi5-1 francs suisses. Ainsi, c’est une prédiction rationnelle que ces techniques seront inestimables en découvrant les rôles précis des autres facteurs accessoires HR.

Protocol

1. préparation des protéines et l’ADN des substrats

  1. Purifier les protéines S. pombe Rad51 et Swi5-1 francs suisses à l’homogénéité (jugé par coloration au bleu de Coomassie), comme indiqué précédemment13,21.
  2. Préparation des oligonucléotides ADN substrats énumérés au tableau 118.
    Remarque : Les oligonucléotides ont été achetés (voir Table des matières) et synthétisées à qualité CLHP. Pour le brin d’ADN appariement réaction, oligonucléotides 16FA(-), 16 a (-) _40bp et 16AR (+) _40bp sont nécessaires. Pour le test ADN de déplacement, des oligonucléotides 16A(-), 16FA _40bp (-) et 16AR (+) _40bp sont requis (Figure 1 et tableau 1). Toutes les concentrations d’ADN dans le présent protocole se référer pour fragmenter les concentrations par opposition à des concentrations de nucléotides.
  3. Pour former les donateurs dsDNA, mélanger une quantité équimolaire des brins complémentaires dans un tube à parois minces de PCR avec recuit tampon (10 mM Tris-HCl pH 7.5, 100 mM NaCl, 10 mM MgCl2), assurant un volume total est supérieur à 20 µL. effectuer ce mélange sur un support en métal prechilled sur glace (entre 2 ° C et 4 ° C).
    Remarque : La combinaison des oligonucléotides pour le test d’appariement sont 16 a (-) _40bp et 16AR (+) _40bp. Pour le dosage de déplacement, recuire oligonucléotides 16FA (-) _40bp et 16AR (+) _40bp.
  4. Chauffer le mélange recuit à 90 ° C pendant 5 minutes et refroidir à plus de 3 h à 30 ° C à l’aide d’une machine PCR. Stocker l’ADN recuit à-20 ° C.

2. DNA Strand appariement et déplacement

  1. Effectuer le brin d’ADN test l’appariement.
    1. Préparation de 1,6 mL de tampons de réaction A (30 millimètres HEPES-KOH pH 7.5, dithiothréitol 1 mM [TNT], 15 mM MgCl2, 0,25 mM ATP, 0,1 mg/mL d’albumine sérique bovine [BSA] et 0,0075 % polyoxyethylenesorbitan monolaurate) contenant 36 nM 16FA(-) dans une micro-centrifugeuse de 2,0 mL tube en plastique (polypropylène) et avant il incuber à 37 ° C pendant 5 min.
    2. Former des filaments Rad51-ADN simple brin, ajouter protéine Rad51 à une concentration finale de 1,5 µM dans le tampon de réaction pré-incubées et il incuber à 37 ° C pendant 5 min.
    3. Ajouter des protéines Swi5-1 francs suisses pour le mélange à une concentration finale de 0,15 µM et il incuber à 37 ° C pendant 5 minutes supplémentaire.
    4. Prendre 1,5 mL du mélange et transférez-le dans une cupule de quartz 1.0 x 1.0 cm contenant un agitateur magnétique et placez la cuve dans un spectrofluorimètre. Configurer le contrôleur de température du spectrophotomètre à 37 ° C, puis affectez-lui 450 tr/min pour assurer un mélange rapide de l’échantillon injecté de l’agitateur magnétique.
    5. Commencer à mesurer l’émission de fluorescence du FAM à 525 nm (bande passante : 20 nm) à excitation à 493 nm (bande passante : 1 nm). Collecte de données par seconde.
    6. Après le début de la mesure pour 100 s, injecter dsDNA ROX-étiqueté donneur à une concentration finale de 36 nM dans le mélange à l’aide d’une seringue et mesure la variation des émissions à intervalles de 1 s pour un autre 30 min.
  2. Effectuer le test de déplacement brin d’ADN.
    1. Préparation de 1,6 mL de tampons de réaction A contenant 36 nM 16A(-) dans un plastique micro-centrifugeuse de 2,0 mL tube et pré il incuber à 37 ° C pendant 5 min.
    2. Former des filaments de Rad51-ADN simple brin en présence de Swi5-1 francs suisses à 37 ° C, comme indiqué aux paragraphes 2.1.2. et 2.1.3.
    3. Prendre 1,5 mL du mélange et transférez-le dans la cupule de quartz contenant un agitateur magnétique et placer la cuve dans le spectrophotomètre, comme indiqué au point 2.1.4.
    4. Commencer à mesurer l’émission de fluorescence et après 100 s, injecter des donateurs d’ADN double brin FAM et ROX-marqués comme indiqué au point 2.1.6. Mesurer le changement dans l’émission de fluorescence à intervalles de 1 s pour un autre 30 min.

3. analyse des données expérimentales de l’appariement et déplacement

  1. Estimer l’efficacité maximale de frette.
    1. Préparer 16FA(-) recuit avec 16AR (+) _40bp et 16FA _40bp (-) recuit avec 16AR (+) _40bp en utilisant la procédure décrite à l’étape 1.3 et 1.4.
    2. Préparer les 130 μL de tampons de réaction A contenant 36 nM de soit 16FA(-), 16FA(-) recuit avec 16AR (+) _40bp, 16FA _40bp (-) recuit avec 16AR (+) _40bp ou 16FA _40bp (-) dans une cuvette de quartz de 0,2 x 1,0 cm.
    3. Placez la cuve dans le spectrofluorimètre et incuber à 37 ° C pendant 5 min.
    4. Mesurer les spectres de fluorescence de 500 à 600 nm à excitation à 493 nm.
    5. Pour tester l’effet de Rad51 sur l’émission de FAM et trempe de FAM par ROX, ajouter Rad51 à une concentration finale de 1,5 μM pour le mélange et laisser incuber à 37 ° C pendant 5 min.
    6. Mesurer les spectres de fluorescence de 500 à 600 nm à excitation à 493 nm.
    7. Calculer les FRET une efficacité maximale (Emaximale) à l’aide de l’équation ci-dessous :
      Emaximale = (intensité de la Fluorescence à 525 nm du dsDNA étiqueté avec FAM et ROX) / (intensité de la Fluorescence à 525 nm de FAM étiqueté ssDNA)
  2. Analyser les données expérimentales pour le test de déplacement.
    1. Pour convertir le changement en fluorescence observée dans l’essai de déplacement pour le changement relatif au montant du produit final, normaliser les premières données expérimentales obtenues de ce dosage à l’aide de l’équation ci-dessous, où Fbrut est intensité de la fluorescence de données brutes et Fnormalisée est le changement de fluorescence calculée par l’équation suivante.
      Fnormalisée = ([Fbruts au moment x]-[Fbruts au temps 0]) / (([Fbruts au temps 0] / Emaximale)-[Fbruts au temps 0])
      Fbruts au temps 0 est la fluorescence moyenne suivie pendant les 5 premières secondes après le temps mort (c'est-à-direle temps nécessaire pour le mélange après un quelle est introduit dans la cupule).
    2. Pour exclure les effets de Photoblanchiment et déplacement spontané, soustraire Fnormalisée sans protéines de Fnormalisée de l’échantillon pour obtenir FD, qui est le changement relatif au montant du produit final dans ce test.
      FD = [Fnormalisée d’échantillon] - [Fnormalisée sans protéines]
  3. Analyser les données expérimentales pour le test d’appariement.
    1. Normaliser les premières données expérimentales obtenues de l’appariement dosage à l’aide de l’équation ci-dessous, où Fbrut est intensité de la fluorescence de données brutes et Fnormalisée est le changement de fluorescence calculée par l’équation suivante.
      Fnormalisée = (Fbruts au moment x) / (Fbruts au temps 0)
      Fbruts au temps 0 est la fluorescence moyenne suivie pendant les 20 dernières s avant d’initier la réaction en injectant le substrat de l’ADN double brin.
    2. Pour convertir le changement en fluorescence dans le changement dans la quantité de substrat et exclure les effets de Photoblanchiment et appariement spontanée, normaliser Fnormalisée de l’échantillon à l’aide de l’équation ci-dessous, où FP est le changement dans la quantité de substrat pour ce dosage.
      FP = 1 - (([Fnormalisé sans protéines] - [Fnormalisée d’échantillon]) / [1-Emaximale])
    3. Afin d’étudier la cinétique de la réaction d’échange de brin de l’ADN, effectuer une analyse de régression non linéaire de dernier carré de la réaction de couplage à l’aide de l’analyse programme23 (voir Table des matières).
      1. Préparer un fichier au format .txt contenant les données en cours temps de FP.
      2. Lancez le programme et collez le script dans le Fichier de Code supplémentaires dans une fenêtre du programme :
      3. Démarrer une analyse de régression non linéaire de dernier carré. Les résultats de cette analyse apparaît dans la même fenêtre.

Representative Results

Afin d’analyser les données expérimentales pour les tests d’appariement et de déplacement, il est nécessaire de définir comment un changement dans l’émission de fluorescence de FAM correspond à une conversion de substrats de l’ADN en produits. Pour y parvenir, la gamme pertinente d’intensité de fluorescence doit être déterminée. Pour le test d’appariement, l’émission de fluorescence de 16FA(-), qui correspond à l’ADN simple brin substrat, est comparée avec l’émission de 16FA(-) recuit avec 16AR (+) _40bp, qui correspond aux produits finaux de cette réaction (Figure 2 a). Cela équivaut à l’efficacité maximale de la frette, et par conséquent la réduction maximale de l’intensité de fluorescence qui serait vraisemblablement si tout le substrat ADNsb a transformé le produit de l’ADN double brin. Pour le dosage de déplacement, l’émission de 16FA (-) _40bp recuit avec 16AR (+) _40bp, qui correspond au substrat, est comparée à l’émission de 16FA (-) _40bp, qui correspond au produit final (Figure 2 b). Dans ce cas, l’augmentation maximale de l’intensité de la fluorescence de FAM transmet un scénario dans lequel tous du substrat dsDNA est converti en ADN simple brin produit. S. pombe Rad51 n’affecte pas l’émission de fluorescence de FAM ou extinction de l’efficacité du FAM par ROX dans les deux tests (Figure 2). L’efficacité maximale de la frette doit être re-mesurée avec chaque nouvelle préparation d’oligonucléotides, car il dépend de l’étiquetage de l’efficacité des oligonucléotides.

Des données représentatives du DNA strand l’appariement et le déplacement des réactions sont indiquées à la Figure 3. Les effets des réactions spontanées entre les ADN de substrat et le Photoblanchiment étaient faibles dans les deux tests, telle que révélée par les changements négligeables vu l’émission de FAM sans Rad51 par rapport aux changements substantiels Sîn Rad51 (Figure 3 a et Figure 3 b). Basé sur les données présentées dans la Figure 3 a ou 3 b Figure, le changement de fluorescence a été transformé en la variation de la quantité de substrat (F,P) ou produit final (FD), respectivement, en utilisant les équations décrites dans les étapes 3.2.2 ou 3.3.2 ( Figure 3 et Figure 3D).

La réaction de couplage a été simulée en utilisant un modèle séquentiel de réaction triple, consistant en la formation de l’intermédiaire de trois brins première (C1), transitioning de premier intermédiaire dans le deuxième intermédiaire (C1 à C2) et la libération de l’ADN simple brin depuis le deuxième intermédiaire pour former les deux produits (D + E) (Figure 3E). Pour tester si la simulation à l’aide d’un ajustement du modèle séquentiel réaction triple les données expérimentales, résidus entre les données expérimentales de dosage et une courbe théorique obtenue par la simulation de l’appariement le brin d’ADN ont été calculés (Figure 3F). En outre, les résidus entre la réaction de couplage et une courbe théorique généré à l’aide d’un modèle de réaction en deux étapes séquentielles étaient également calculé (Figure 3). Les résidus de la réaction de couplage et le modèle en deux étapes montrent une déviation systématique dans les premiers stades, tandis que les résidus de la réaction de couplage et le modèle triple ne montrent pas une telle déviation. Cela indique que le modèle triple caractère mieux que le modèle en deux étapes pour simuler la réaction de couplage.

Pour vérifier que le modèle triple est conforme à la réaction de déplacement qui détecte l’étape tardive de l’échange de brin de l’ADN, nous avons généré une courbe théorique de la réaction de déplacement en utilisant les paramètres cinétiques obtenus à partir de simulation de l’appariement réaction illustré à la Figure 3 et l’a comparée avec les données expérimentales de la réaction de déplacement illustrée à la Figure 3D (Figure 3 H). La courbe théorique s’adapter les données expérimentales de l’essai de déplacement. D’après ces résultats, nous concluons que la simulation en utilisant le modèle triple est en mesure d’évaluer raisonnablement la réaction d’échange de brin ADN médiée par Rad51.

Données représentatives d’appariement de réaction contenant Rad51 et le complexe Swi5-1 francs suisses, une protéine complice de Rad51, le brin d’ADN sont indiquées dans la Figure 4 a. Le complexe Swi5-1 francs suisses a fortement stimulé l’activité de jumelage de Rad51. Comme l’ont montré en l’absence de Swi5-1 francs suisses, la réaction de couplage correspond mieux au modèle de trois étapes que le modèle en deux étapes en présence de Swi5-1 francs suisses (Figure 4 b). Par le biais de simulation de la réaction en utilisant le modèle triple, les constantes d’équilibre de réaction de chaque étape de la réaction avec ou sans Swi5-1 francs suisses ont été calculés. Les constantes d’équilibre de réaction a indiqué que le complexe Swi5-1 francs suisses ne stimule pas la première étape de la réaction (Figure 4, panneau un), où se forme un intermédiaire de trois brins, mais stimule fortement la transition C1-C2 ( Figure 4, panneau b) et la libération d’ADN simple brin par l’intermédiaire de C2 (Figure 4, groupe c).

Figure 1
Figure 1 : dispositif expérimental d’ADN chapelet essais sur l’appariement et le déplacement. Schémas de l’ADN des brins d’appariement (A) et essais de déplacement (B). Les cercles jaunes représentent Rad51 monomères. Vert des cercles contenant « F » et les cercles rouges contenant « R » représentent fluorescéine amidite (FAM) et carboxy-X-rhodamine (ROX), respectivement. Brins d’ADN de noir sont une séquence identique et complémentaires au bleu des brins d’ADN. Fines lignes noires avec des pointes de flèche pointent sur le nom de chaque oligonucléotide, tel que représenté dans le tableau 1. Ce chiffre a été adapté de Ito et al. 19 et modifiés. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : mesure de l’efficacité maximale de la frette des essais l’appariement et le déplacement. (A) comparaison des spectres de fluorescence entre le substrat de l’ADN simple brin, 16FA(-) et le produit de l’ADN double brin, 16FA(-) jumelé avec 16AR (+) _40bp, du test de l’appariement. Les lignes bleues et rouges représentent les spectres de fluorescence du substrat sans et avec Rad51, respectivement. Verts et violets lignes montrent les spectres de fluorescence du produit final sans et avec Rad51, respectivement. (B) la comparaison des spectres de fluorescence entre le substrat de l’ADN double brin, 16FA _40bp (-) jumelé avec 16AR (+) 16FA _40bp et produit de l’ADN simple brin, _40bp (-), d’obtenir un déplacement. Les lignes bleues et rouges représentent les spectres de fluorescence du produit final sans et avec Rad51, respectivement. Verts et violets lignes montrent les spectres de fluorescence du substrat sans et avec Rad51, respectivement. Ce chiffre est une adaptation d’Ito et al. 19 et modifiés. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : DNA strand l’appariement et le déplacement des réactions par l’intermédiaire de Rad51. (A) évolution temporelle de la fluorescence normalisée de la réaction de couplage avec ou sans Rad51. (B) évolution temporelle de la fluorescence normalisée de la réaction de déplacement avec ou sans Rad51. (C) Évolution temporelle de la modification d’un montant de substrat dans la réaction de couplage avec Rad51. (D) évolution temporelle de la modification d’un montant de substrat dans la réaction de déplacement avec Rad51. (E), un schéma du modèle séquentiel réaction triple. A et B correspondent à l’ADN double brin présynaptique filament et donateurs. C1 correspond au premier intermédiaire trois brins (immature). C2 correspond à la deuxième intermédiaire de trois brins (mature). D et E correspondent à un hétéroduplex et ADNsb libéré de C2. (F et G) résidus entre les données expérimentales du brin d’ADN dosage et une courbe théorique de l’appariement obtient par simulation à l’aide du modèle en deux étapes (G) ou triple (F). (H) points rouges indiquent des données expérimentales de la réaction de déplacement avec Rad51 montré dans panneau bleu D. ligne indique la courbe théorique des produits finaux. La courbe théorique a été générée par la simulation en utilisant les constantes de vitesse de réaction obtenues de l’appariement dosage indiqué dans le tableau C. Ce chiffre est une adaptation d’Ito et al. 19 et modifiés. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : Swi5-1 francs suisses stimule le deuxième et troisième étapes de l’ADN brin réaction d’échange. (A) évolution temporelle de la modification d’un montant de substrat dans la réaction de couplage avec ou sans Swi5-1 francs suisses (S5S1). (B) des résidus entre les données expérimentales de l’appariement de brin de l’ADN de dosage avec Swi5-1 francs suisses et une courbe théorique obtenue par simulation à l’aide de l’en deux étapes (ligne bleue) ou un modèle en trois étapes (ligne rouge). (C) l’appariement réaction illustrée à la Figure 4 a a été simulée par le modèle de trois étapes en utilisant l’analyse programme23 (voir Table des matières). Les constantes d’équilibre de réaction de chaque étape de la réaction, 1 m end (a), (b) de K2 et K3 (c), ont été extraites de la simulation. Ce chiffre est une adaptation d’Ito et al. 19 et modifiés. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Oligonucléotides de brin d’ADN appariement dosage
16FA(-) 5'-[FAM] - AAATGAACATAAAGTAAATAAGTATAAGGATAATACA
AAATAAGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA -3 '
16 a (-) _40bp 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-3'
16AR (+) _40bp 5 '- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX] -3'
Oligonucléotides pour test de déplacement brin d’ADN
16A(-) 5'-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAATA
AGTAAATGAATAAACATAGAAAATAAAGTAAAGGATAT AAA -3 '
16FA _40bp (-) AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAA-[FAM] - 5'-3'
16AR (+) _40bp 5 '- TTTTGTATTATCCTTATACTTATTTACTTTATGTTCATTT-[ROX] -3'

Tableau 1 : liste des oligonucléotides utilisées dans les essais de l’appariement et le déplacement de brin ADN. Le cas échéant, les positions des fluorophores (fluorescéine amidite, FAM ; carboxy-x-rhodamine, ROX) sont indiquées en carré entre parenthèses.

Discussion

Ici, nous avons décrit un protocole détaillé qui utilise frette pour mesurer les échanges brin ADN pilotée par Rad51 en temps réel. Ce qui est important, ces mesures permettent la détermination de la cinétique de la réaction. Alors que les descriptions données ci-dessus sont suffisantes pour reproduire nos résultats publiés, il y a plusieurs points critiques qui seront décrites dans cette section. En outre, les avantages et les inconvénients des méthodologies fondées sur la frette pour étudier l’échange de brin de l’ADN seront discutés, ainsi que l’application de ces techniques à étudier d’autres aspects du métabolisme de l’ADN.

Comme avec toutes les reconstitutions biochimiques, veiller à ce que tous les substrats de la réaction sont d’une grande pureté est indispensable. Il fait preuve de négligence à assumer l’absence de contaminantes activités basées uniquement sur la pureté apparente d’une préparation de protéines jugée par coloration au bleu de Coomassie. En particulier, la présence de traces de nucléases ou hélicases peut affecter considérablement les résultats de tests de l’appariement et le déplacement. Ainsi, nous encourageons vivement les essais pour de telles activités chaque fois qu’un nouveau lot de protéine est purifié. En outre, il est prudent de vérifier la pureté des substrats d’ADN synthétisés par électrophorèse sur gel de polyacrylamide natifs. Malgré les nombreuses entreprises garantissant la pureté des oligonucléotides, nous avons souvent trouvé grâce à nos propres tests que la pureté de l’ADN synthétisé peut varier entre les lots.

Il est important de considérer les deux points suivants lorsqu’il procède à des expériences avec des cuvettes de quartz. Tout d’abord, certaines protéines sont enclins à lier des cuvettes de quartz de façon non spécifique. Pour contrer cela, monolaurate de BSA et polyoxyethylenesorbitan sont inclus dans les mémoires tampons de réaction. Deuxièmement, la température a un effet dramatique sur l’intensité de fluorescence et de la vitesse de réaction. Pour minimiser cet effet, la cuvette de quartz doit être préalablement incubée à 37 ° C avant de l’utiliser.

Bien que des épreuves biochimiques conventionnels ont été extrêmement utiles dans l’étude d’échange de brin de l’ADN, ils ont plusieurs inconvénients. Dans une expérience typique de l’évolution temporelle, une réaction est incubée à une certaine température et parties aliquotes sont retirées à intervalles souhaités et déprotéinisés par traitement avec du détergent et protéase de mettre fin à la réaction. Au terme de l’évolution temporelle, les échantillons sont ensuite soumis à l’électrophorèse pour séparer les substrats de l’ADN des produits. L’avantage majeur de la méthode décrite ici est qu’elle permet l’observation en temps réel de la réaction sans aucune perturbation. N’importe quel validant lors de la réaction peut être inspectée sans interruption de la réaction elle-même et il n’y a aucun besoin de deproteinize les échantillons ou les soumettre aux forces potentiellement perturbateurs de l’électrophorèse. Cela est particulièrement pertinent pour l’analyse des structures d’ADN labiles.

Malgré ces atouts au cours des essais conventionnels, la méthode décrite ici a quelques inconvénients. Alors que l’utilisation d’oligonucléotide ADN substrats pour l’échange de brin simplifie l’interprétation des résultats, il est important de se rappeler que ces substrats ne ressemblent pas les substrats de l’ADN impliquée dans les ressources humaines dans la cellule. Certains tests classiques utilisent des substrats d’ADN plasmidique taille, qui sont plus susceptibles de refléter le nombre de paires de bases qui sont échangés en vivo. En outre, l’utilisation de substrats de dsDNA circulaire topologiquement restreinte dans un sous-ensemble de tests classiques peut recréer au moins partiellement les tensions dans l’ADN physiologique.

L’application de la méthode décrite ici a commencé à se désagréger les mécanismes moléculaires d’échange brin ADN pilotée par Rad51. Néanmoins, il y a beaucoup de questions intéressantes qui reste à trancher. Il y a des preuves claires que HR au cours de la méiose requiert Rad51 et Dmc1, la recombinase de RecA type spécifiques à la méiose dans les eukaryotes24. Cependant, l’absence de différences biochimiques majeures entre ces deux recombinases a déconcerté les chercheurs dans le domaine pour les années. En outre, les rôles de nombreux groupes distincts des facteurs accessoires de recombinaison a été un sujet focal de la recherche dans le domaine des ressources humaines. En plus d’élucider les différences biochimiques entre Rad51 et Dmc1, notre objectif est d’étudier et de comparer les effets des facteurs accessoires différents de recombinaison sur la cinétique de l’ADN brin échange dans l’immédiat. Enfin, il est important de souligner que la méthodologie axée sur la frette décrite ici n’est pas limitée à l’étude de l’ADN brin échange. Avec des modifications relativement mineures, nous envisageons de nombreux types d’applications pour cette technique en enquêtant sur fonctionnellement diverses protéines impliquées dans l’ADN du métabolisme25,26,27,28. Nous espérons que l’évolution de la situation décrite ici fournira plus options aux chercheurs appartenant à nombreuses disciplines différentes.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Ce travail a été financé par les subventions pour la recherche scientifique (A) (18H 03985) et sur des domaines novateurs (15H 05974) hi, for Young Scientists (B) (17K 15061) à BA et pour Scientific Research (B) (18H 02371) à HT de la société japonaise pour la Promotion de la Science ( JSPS).

Materials

Name Company Catalog Number Comments
0.2 x 1.0 cm quartz cuvette Hellma Analytics 105-250-15-40
1.0 x 1.0 cm quartz cuvette Hellma Analytics 101-10-40
adenosine triphosphate (ATP) Sigma A2383
DynaFit BioKin, Ldt. DynaFit is a program to analyze kinetics of biochemical reactions.
Fluorescent labeled and non-labeled oligonucleotides Eurofins Genomics The sequences of oligos are listed in Table. 1.
Magnetic stirrer Aisis (Japan) CM1609
PCR machine TAKARA (Japan) TP600 TAKARA PCR Thermal Cycler Dice
Spectrofluorometer JASCO FP8300 Contains a peltier temperature controller and magnetic stirrer system
Syringe HAMILTON 1702RN 25ul SYR (22s/2"/2)

DOWNLOAD MATERIALS LIST

References

  1. Camerini-Otero, R. D., Hsieh, P. Homologous recombination proteins in prokaryotes and eukaryotes. Annual Review of Genetics. 29, (1), 509-552 (1995).
  2. Cromie, G. A., Connelly, J. C., Leach, D. R. Recombination at double-strand breaks and DNA ends: conserved mechanisms from phage to humans. Molecular Cell. 8, (6), 1163-1174 (2001).
  3. Pierce, A. J., et al. Double-strand breaks and tumorigenesis. Trends in cell biology. 11, (11), S52-S59 (2001).
  4. Haber, J. E. Genome Stability. Garland Science. (2013).
  5. Kowalczykowski, S. C. An Overview of the Molecular Mechanisms of Recombinational DNA Repair. Cold Spring Harbor perspectives in biology. 7, (11), a016410 (2015).
  6. Bianco, P. R., Tracy, R. B., Kowalczykowski, S. C. DNA strand exchange proteins: a biochemical and physical comparison. Frontiers in bioscience: a journal and virtual library. 3, D570-D603 (1998).
  7. Renkawitz, J., Lademann, C. A., Jentsch, S. Mechanisms and principles of homology search during recombination. Nature Reviews Molecular Cell Biology. 15, (6), 369-383 (2014).
  8. Greene, E. C. DNA Sequence Alignment during Homologous Recombination. The Journal of biological chemistry. 291, (22), 11572-11580 (2016).
  9. Sung, P., Krejci, L., Van Komen, S., Sehorn, M. G. Rad51 recombinase and recombination mediators. Journal of Biological Chemistry. 278, (44), 42729-42732 (2003).
  10. Prakash, R., Zhang, Y., Feng, W., Jasin, M. Homologous recombination and human health: the roles of BRCA1, BRCA2, and associated proteins. Cold Spring Harbor perspectives in biology. 7, (4), a016600 (2015).
  11. Sung, P. Function of yeast Rad52 protein as a mediator between replication protein A and the Rad51 recombinase. Journal of Biological Chemistry. 272, (45), 28194-28197 (1997).
  12. Sung, P. Yeast Rad55 and Rad57 proteins form a heterodimer that functions with replication protein A to promote DNA strand exchange by Rad51 recombinase. Genes & Development. 11, (9), 1111-1121 (1997).
  13. Kurokawa, Y., Murayama, Y., Haruta-Takahashi, N., Urabe, I., Iwasaki, H. Reconstitution of DNA strand exchange mediated by Rhp51 recombinase and two mediators. PLoS biology. 6, (4), e88 (2008).
  14. Jensen, R. B., Carreira, A., Kowalczykowski, S. C. Purified human BRCA2 stimulates RAD51-mediated recombination. Nature. 467, (7316), 678-683 (2010).
  15. Liu, J., et al. Rad51 paralogues Rad55-Rad57 balance the antirecombinase Srs2 in Rad51 filament formation. Nature. 479, (7372), 245-248 (2011).
  16. Lu, C. -H., et al. Swi5-Sfr1 stimulates Rad51 recombinase filament assembly by modulating Rad51 dissociation. Proceedings of the National Academy of Sciences of the United States of America. (2018).
  17. Bazemore, L. R., Takahashi, M., Radding, C. M. Kinetic analysis of pairing and strand exchange catalyzed by RecA. Detection by fluorescence energy transfer. Journal of Biological Chemistry. 272, (23), 14672-14682 (1997).
  18. Gupta, R. C., Bazemore, L. R., Golub, E. I., Radding, C. M. Activities of human recombination protein Rad51. Proceedings of the National Academy of Sciences. 94, (2), 463-468 (1997).
  19. Ito, K., Murayama, Y., Takahashi, M., Iwasaki, H. Two three-strand intermediates are processed during Rad51-driven DNA strand exchange. Nature Structural & Molecular Biology. 25, (1), 29-36 (2018).
  20. Akamatsu, Y., Dziadkowiec, D., Ikeguchi, M., Shinagawa, H., Iwasaki, H. Two different Swi5-containing protein complexes are involved in mating-type switching and recombination repair in fission yeast. Proceedings of the National Academy of Sciences. 100, (26), 15770-15775 (2003).
  21. Haruta, N., et al. The Swi5-Sfr1 complex stimulates Rhp51/Rad51- and Dmc1-mediated DNA strand exchange in vitro. Nature Structural & Molecular Biology. 13, (9), 823-830 (2006).
  22. Argunhan, B., Murayama, Y., Iwasaki, H. The differentiated and conserved roles of Swi5-Sfr1 in homologous recombination. FEBS Letters. 591, (14), 2035-2047 (2017).
  23. Kuzmic, P. Program DYNAFIT for the analysis of enzyme kinetic data: application to HIV proteinase. Analytical biochemistry. 237, (2), 260-273 (1996).
  24. Brown, M. S., Bishop, D. K. DNA strand exchange and RecA homologs in meiosis. Cold Spring Harbor perspectives in biology. 7, (1), a016659 (2014).
  25. Rudert, W. A., et al. Double-labeled fluorescent probes for 5' nuclease assays: purification and performance evaluation. BioTechniques. 22, (6), 1140-1145 (1997).
  26. Xiao, J., Singleton, S. F. Elucidating a key intermediate in homologous DNA strand exchange: structural characterization of the RecA-triple-stranded DNA complex using fluorescence resonance energy transfer. Journal of Molecular Biology. 320, (3), 529-558 (2002).
  27. Grimme, J. M., et al. Human Rad52 binds and wraps single-stranded DNA and mediates annealing via two hRad52-ssDNA complexes. Nucleic Acids Research. 38, (9), 2917-2930 (2010).
  28. Algasaier, S. I., et al. DNA and Protein Requirements for Substrate Conformational Changes Necessary for Human Flap Endonuclease-1-catalyzed Reaction. The Journal of biological chemistry. 291, (15), 8258-8268 (2016).
Observation en temps réel de la réaction d’échange de brin ADN médiée par Rad51
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).More

Ito, K., Argunhan, B., Tsubouchi, H., Iwasaki, H. Real-time Observation of the DNA Strand Exchange Reaction Mediated by Rad51. J. Vis. Exp. (144), e59073, doi:10.3791/59073 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter